Molecular biological methods .1 Cloning procedures

4 Materials and Methods

4.1 Molecular biological methods .1 Cloning procedures

All constructs used in this study were PCR‐amplified from a human testis cDNA library (Invitrogen). All primers contain a restriction site for either FseI (5´) or AscI (3´) and were purchased from Dharmacon or MWG. The amplified cDNAs and fragments were cloned into plasmids harboring engineered FseI and AscI restriction sites at the 5’ and 3’ end, respectively. All constructs were confirmed by sequencing at the MPI in‐house DNA sequencing facility or at GATC (Konstanz).

Table 4.1.1A lists all primers for generating the constructs used in this study.

All cloning procedures were performed according to the standard techniques as described in Molecular Cloning, A Laboratory Manual, 2nd Edition, Sambrook, J., Fritsch, E.F., Maniatis, T., Cold Spring Harbor Laboratory Press 1989 and Current Protocols in Molecular Biology, Wiley, 1999.

NAME SEQUENCE COMMENTS

hu_Kif18A_P01 attaggccggccaatgtctgtcactgaggaag 5ʹ for FA cloning into pQE70 hu_Kif18A_P02 attaggcgcgccacatattgagttatatgattattg 3ʹ for FA cloning into pQE70 hu_Kif18A_P03 attaggcgcgccatttgtttatggcactgttgttgg 3ʹ for FA cloning into pQE70 hu_Kif18A_P05 taatggccggccttatatttgtttatggcactg 3`primer (for N‐tag)

hu_Kif18A_P06 taatggcgcgccttatatttgtttatggcactg 3`primer (for N‐tag) hu_Kif18A_P07 taatggcgcgccttatacatattgagttatatg 3`primer (for N‐tag)

hu_Kif18A_P08 attaggcgcgcccttagatttccttttgaaatatttc 3´ASC fulllength for pQE70 hu_Kif18A_P11 attaggccggcctatggttcttaatgtcaataatc 5ʹ with FseI and ATG hu_Kif18A_P148 attaggccggccgatgtcaaatgctgcttttgaatctg 5ʹ primer aa 593

The following standard molecular biology techniques have been used:

1) Typical PCR reactions for generating diverse Kif18A constructs were carried out as described in Table 4.1.1B. Table 4.1.1.C shows the PCR programm running in a Thermocycler Veriti, 96 well (Applied biosystems).

PCR REACTION

2μl DNA (human testis cDNA) 9.5μl milliQ H²O

20μl final reaction volume

Table 4.1.1.B and Table 4.1.1.C reports a typical PCR reaction and the PCR programm used to generate the constructs used in this study.

2) Agarose gels were prepared according to reaction shown in Table 4.1.1.D. DNA fragments were isolated using the Qiagen gel extraction kit according to manufacturers’ instructions.

NO. of CYCLES TEMPERATURE TIME

1 94 1’ solved in milliQ H²O

TBE

runningbuffer

90 mM Tris 90 mM Boratacid 2,5 mM EDTA

3) Afterwards the DNA was digested using the enzymes given in Table 4.1.1.E.

Following this reaction the PCR was purified using the Qiagen PCR purification kit

36.7μl or 1.7μl milliQ H2O

VOLUME COMPONENT

8µl insert

2 µl vector

1x 10x T4 DNA Ligasebuffer

66.7 U/µl T4-DNA-Ligase 2.5µl milliQ H2O

6) The DNA was purified and isolated according to the Qiagen Mini/Midi kit according to manufacturer’s instructions.

7) Nucleotide exchanges were performed by site directed mutagenesis using primers listed in Table 4.1.1I.

TUM VECTOR ORGANISM TAG

GP0030 pQE80‐FA bacteria n‐term: His

GP0031 pCS2‐GFP‐FA

mammalian/IV

T n‐term: GFP

GP0033 pGEX‐TEV‐FA bacteria n‐term: GST u. TEV cleavage GP0042 pFastBac‐Tev‐his‐F/A‐SAP baculovirus n‐term: His

GP0110 pcDNA5/FRT‐TO‐mCherry‐FA mammalian n‐term: mCherry GP0111 pcDNA5/FRT‐TO‐eGFP‐FA mammalian n‐term: eGFP GP0118 pFastBac‐10HIS‐TEV2‐F/A baculovirus his

NAME COMPANY

LB LB‐medium Difco LB‐Broth

LB‐agar LB‐agar Difco Ampiciliin 100 μg/ml

Table 4.1.1I lists all primers for mutagenesis.

NAME SEQUENCE COMMENTS

hu_Kif18A_P13 cttcagcctattgtatatgcaccagaagactgtagaa 5´T706 to A hu_Kif18A_P14 ttctacagtcttctggtgcatatacaataggctgaag 3´T706to A hu_Kif18A_P68 cggagaaaactaatgccaGAtcccttgaaaggacagc 5ʹ S674 to D hu_Kif18A_P69 gctgtcctttcaagggaTCtggcattagttttctccg 3ʹ S674 to D hu_Kif18A_P70 ggacagcatactctaaagGAtccaccatctcaaagtgtgc 5ʹ S684 to D hu_Kif18A_P71 gcacactttgagatggtggaTCctttagagtatgctgtcc 3ʹ S684 to D hu_Kif18A_P72 cttcagcctattgtatatGAaccagaagactgtagaaaagc 5ʹ T706 to E hu_Kif18A_73 gcttttctacagtcttctggtTCatatacaataggctgaag 3ʹ T706 to E hu_Kif18A_43 ggacagcatactctaaagGctccaccatctcaaagtg 5ʹ S684 to A hu_Kif18A_44 cactttgagatggtggagCctttagagtatgctgtcc 3ʹ S684 to A

hu_Kif18A_56 taccaacaacagtgccaCaaGcaaatagaaatgatgtg oligo for RNAi resistant hu_Kif18A_57 cacatcatttctatttgCttGtggcactgttgttggta oligo for RNAi resistant hu_Kif18A_58 tgaacttaaatcattctaTcaGcaacagtgccaCaaGcaa oligo for RNAi resistant hu_Kif18A_59 ttgCttGtggcactgttgCtgAtagaatgatttaagttca oligo for RNAi resistant hu_Kif18A_60 taaatcattctaTcaGcaGcaAtgccaCaaGcaaatagaa oligo for RNAi resistant hu_Kif18A_61 ttctatttgCttGtggcaTtgCtgCtgAtagaatgattta oligo for RNAi resistant hu_Kif18A_62 attctaTcaGcaGcaAtgTcaCaaGcaaatagaaatg oligo for RNAi resistant hu_Kif18A_63 catttctatttgCttGtgAcaTtgCtgCtgAtagaat oligo for RNAi resistant hu_Kif18A_23 cggagaaaactaatgccagctcccttgaaaggacagc 5ʹ S674 to A

Hu_Kif18A_24 gctgtcctttcaagggagctggcattagttttctccg 3ʹ S674 to A

Table 4.1.1J lists all mutagenesis primer used in this study.

NAME SEQUENCE COMMENTS

Hu_Kif18A_24 gctgtcctttcaagggagctggcattagttttctccg 3ʹ S674 to A

Table 4.1.1K summarizes all constructs used in this study.

TUM INSERT INSERT SPEC VECTOR TAG

TUM0301 hu_Kif18A aa1‐467 pQE80‐F/A HIS

TUM0306 hu_Kif18A wt,n‐term, aa1‐467 pGEX‐F/A GST

TUM0307 hu_Kif18A wt,n‐term, aa1‐367 pGEX‐F/A GST

TUM0481 hu_Kif18A wt,fl pFastBac‐his‐F/A HIS

TUM0579 hu_Kif18A wt,fl pCS2‐GFP‐FA GFP

TUM1344 hu_Kif18A mut,fl, ORFresistant pCS2‐GFP‐F/A GFP

TUM1596 hu_Kif18A wt,cterm,aa 593‐aa898 pGEX‐F/A GST

TUM1597 hu_Kif18A S674A,cterm,aa593‐898 pGEX‐F/A GST

TUM1598 hu_Kif18A S684A,cterm,aa593‐899 pGEX‐F/A GST

TUM1599 hu_Kif18A T706A,cterm,aa593‐898 pGEX‐F/A GST

TUM1600 hu_Kif18A S859A,cterm,aa593‐898 pGEX‐F/A GST

TUM1607 hu_Kif18A mut,fl,S674A pFastBac‐his‐F/A HIS

TUM1609 hu_Kif18A mut,fl,S674D pFastBac‐his‐F/A HIS

TUM1611 hu_Kif18A mut,fl,S859A pFastBac‐his‐F/A HIS

TUM1612 hu_Kif18A mut,fl,S859E pFastBac‐his‐F/A HIS

TUM1613 hu_Kif18A mut,fl,S674D,ORF,RES pcDNA5/FRT‐TO‐eGFP‐FA GFP TUM1615 hu_Kif18A mut,fl,S859A,ORF,RES pcDNA5/FRT‐TO‐eGFP‐FA GFP TUM1616 hu_Kif18A mut,fl,S859E,ORF,RES pcDNA5/FRT‐TO‐eGFP‐FA GFP TUM1623 hu_Kif18A mut,fl,S674A,ORF;RES pcDNA5/FRT‐TO‐eGFP‐FA GFP

4.2 Biochemical materials and methods 4.2.1 Purification of GST‐tagged proteins from E.coli

A single colony from JM 109rill carrying the GOI was inoculated in 20 ml LB with Ampicillin (100 μg/ml) and Chloramphenicol (34 μg/ml) and grown to an OD of 0.5.

Following this the starter culture was transferred to 2 L containing antibiotics. At an OD of 0.5 the expression was induced with IPTG (0.5 mM) o/n at 18°C. The bacteria were harvested by centrifugation at 4500 g for 30 minutes at 4°C in a SS34 (Sorvall) or JA25.50 (Beckman) rotor. The cells were lysed with 15 mL of lysisbuffer (100 mM Tris pH 7.4, 250 mM NaCL, 1 mM DTT, 1mM MgCL2, 0,3% TritonX‐100 and protease inhibitors) using Emulsi‐Flex‐C5. To obtain the clear lysate, cells were centrifuged at 10000 rpm in an SS34 rotor for 30 minutes at 4°. During the centrifugation step 1 ml of Glutathion‐Sepharose‐beads (Amersham) was washed in lysisbuffer to remove storing buffer, then the cleared bacterial lysate was added and rotated at 4°C for 4 h to allow the protein to bind to the resin.

After binding, the beads were washed in lysisbuffer without TritonX‐100 and proteaseinhibitors. The protein was eluted with elutionbuffer ( 100 mM Tris pH 8.0, 300 mM NaCl and 40 mM gluthatione and collected in 0.5 ml fractions and dialysed in 25 mM Tris pH7.4, 250 mM NaCl, 10 mM ß‐mercaptoethanol, 10% glycerol and 1 mM MgCl²o/n at 4°C and flash frozen and stored at ‐ 80°C.

4.2.2 Purification of His tagged proteins from SF9 cells

2*10⁷ SF9 cells were infected with 0.5 ml of P2 or P3 of His‐Kif18A^WT. After 40 hours cells were lysed in 25 mM Tris pH 7.6, 300 mM NaCl, 5 mM Imidazol, 1 mM MgCl², 1 mM DTT, 1 mM ATP, 0.2% TritonX‐100 and proteaseinhibitors using a douncer and the Emulsi‐Flex‐C5. To obtain the clear lysate cells were centrifuged at 25000 rpm in an JA25.50 rotor for 30 minutes at 4°.

During the centrifugation step 1 ml of NiNTabeads (Qiagen) were washed in lysisbuffer to remove storing buffer, then the cleared lysate was added and rotated at 4°C for 2 h to allow the protein to bind to the resin.

After binding, the beads were washed in lysisbuffer.The lysate was washed with Imidazol concentrations up to 40 mM. The protein was eluted with elutionbuffer ( 25 mM Tris pH 7.6, 300 mM NaCl, 200 mM Imidazol and 1 mM ATP and collected in 0.4 ml fractions and dialysed in 20 mM Tris pH 7.6, 300 mM NaCl, 10mM ß‐

mercaptoethanol, 10 % glycerol, 1 mM MgCl2 and 1 mM ATP o/n at 4°C and flash frozen and stored at ‐ 80°C.

4.2.3 Purification of tubulin from pig brains

Tubulin was purified from pig brain. Pig brains were purchased from a local slaughter. Pigbrains (about 1 kg; 50 brain‐halves) were transported in ice cold PBS.

Brains were cleaned at 4 °C by removal of blood vessels and meninges. Brains were collected in DB‐buffer (50 mM MES pH 6.6, 1 mM CaCl²) in a 1:1 ratio (w/v). Brains were homogenized in a mixer and homogenate was cleared by centrifugation (29000 g, 1 h, 4 °C). The supernatant (SN) was supplemented with one volume glycerol and one volume pre‐warmed (37 °C) HMPB‐buffer (1 M K‐Pipes pH 6.8, 10 mM MgCl², 20 mM EGTA). To this suspension, 1.5 mM ATP and 0.5 mM GTP was added. MTs were polymerized at 37 °C in a water bath for 1 h and pelleted at 150000 g for 30 min at 37 °C. The MT pellet was re‐suspended in ice cold DB buffer (1/10 of volume used for the homogenization) and kept at 4 °C for 30 min and the suspension was cleared by centrifugation (70000 g, 30 min 4 °C). The supernatant was again supplemented with one volume glycerol, one volume MMPB, 1.5 mM ATP and 0.5 mM GTP and incubated in a water bath for 30 min at 37 °C. The polymerized tubulin was pelleted at 150000 g for 30 min at 37 °C and the pellet was re‐suspended in ice cold BRB80 (80 mM K‐Pipes, pH 6.8, 1 mM MgCl²and 1 mM EGTA) and homogenized by douncing on ice for 30 min.

The homogenate was cleared by centrifugation (100000 g, 30 min, 4 °C) and the tubulin containing supernatant was separated. The tubulin concentration was determined by measuring the absorbance at 280 nm in BRB80 using the extension coefficient of (ε=115000 M^‐1cm^‐1). The concentration of the purified tubulin was adjusted to 10 mg/ml, aliquoted, snap frozen and stored at ‐ 80 °C.

4.2.4 Preparation of GMPCPP stabilized microtubules

GMPCPP microtubules were assembled in BRB80 (80 mM PIPES–KOH at pH 6.8, 1 mM MgCl² and 1 mM EGTA) plus 1 mM MgGMPCPP (Jena Biosciences, Germany) containing 0.6 μM rhodamine‐labeled and 2 μM unlabeled tubulin dimer, for the assembly of short microtubules 3.1 μM unlabeled tubulin dimer and 10 μM rhodamine‐labeled tubulin dimer was used. Assembly reactions were incubated for 2 h at 37 °C, pelleted in an ultracentrifuge (90 K for 5 min at 30°C; Beckman) and resuspended in BRB80 and kept at room temperature. The concentration of tubulin in the stabilized microtubule suspension was determined by measuring the absorbance at 280 nm in 6 M guanidine‐HCl using an extinction coefficient of (ε=115,000 M‐1cm‐1).

4.2.5 In vitro assay for GMP‐CPP microtubule depolymerization

Depolymerization reactions were performed in BRB80 (80 mM PIPES–KOH at pH 6.8, 1 mM MgCl2, and 1 mM EGTA) supplemented with different concentrations of His‐Kif18A^FL or storage buffer (control), microtubules (final tubulin dimer concentration 0.35 μM), 50 mM KCl (final Cl‐ concentration: 110 mM), ATP (final concentration 1 mM) or AMP‐PNP and incubated for 25 min. at RT. Where indicated, no additional KCl was added resulting in a final Cl‐ concentration of 60 mM. Afterwards reactions were either pelleted in an ultracentrifuge (90 K, 5 min at 30° C) and processed for SDS‐PAGE analysis or fixed in fixation buffer (0.25%

glutaraldehyde, 1% Triton X‐100, 15% glycerol in BRB80) and analyzed by

fluorescence microscopy. Reagents were purchased from Sigma (St Louis, MO). To determine the length of microtubules, pictures of individual microtubules were taken with a Deltavision microscope (Nikon TE200) and the length was measured with the applied precision software program.

4.2.6 Sedimentation assay

To separate tubulin dimer from microtubule polymer, samples were centrifuged in a TLA 100 rotor (Beckman) at 90K for 5 minutes at 25°C. Supernatant and pellet fractions were resuspended in sample buffer yielding equal volumes for all fractions. Samples were resolved by SDS‐polyacrylamide gel electrophoresis (SDS‐

PAGE). Afterwards gels were stained with Coomassie‐blue and destained.

4.2.7 Steady‐state ATPase

Microtubule and tubulin activated steady‐state ATPase rates were determined in a coupled enzymatic assay. The assay was performed in 12A25+buffer (12.5 mM Aces‐KOH, 25 mM potassium acetate, 1 mM EGTA, 5 mM MgCl2) at 22°C. His‐

Kif18A^FL concentrations were 35 nM. The assembly of microtubules from pig brain tubulin was obtained by spinning a freshly thawed tubulin aliquot at 120.000 g and 4°C, supplementing the supernatant with 1 mM GTP and 20 μM paclitaxel and removing excess nucleotides by centrifugation through a sucrose cushion. The microtubule pellet was resuspended in 12A25+, 20 μM paclitaxel, and the protein concentration determined at 280 nm. To avoid tubulin polymerization, tubulin was incubated on ice during the experiment.

4.2.8 In vitro gliding assay

The motility assay was performed essentially as described (http://www.proweb.org/kinesin/Methods/motility.html). For preparation of polarity marked GMPCPP stabilized microtubules 0.25 μM of rhodamine‐labeled

and 2 μM unlabeled tubulin dimer were incubated in BRB80 with 1 mM GMPCPP for 20 min at 37°C, pelleted in an ultracentrifuge and resuspended with a reaction containing 0.62 μM labeled tubulin dimer and 2 μM unlabeled tubulin dimer. After incubation for 40 min at 37°C, microtubules were pelleted in an ultracentrifuge and resuspended in BRB80. A flow chamber with a volume of about 15 μl (consisting of one glass coverslip separated by two parallel double sticky tapes) was loaded for 5 min with BRB80 supplemented with 0.5 mg ml‐1 casein (BRB80C). Then 15 μl motor mix (50 nM of insect derived His‐tagged His‐Kif18A^FL in BRB80C containing 1 mM ATP) were flowed in for 5 min followed by one washing step with BCA (BRB80 supplemented with 0.2 mg/ml casein and 1 mM ATP. Afterwards the motility solution (BRB80C supplemented with 10 μM paclitaxel, 10 mM MgATP, 20 mM D‐

glucose, 0.02 mg/ ml, glucose oxidase, 0.008 mg ml/ml catalase, 0.5% β‐

mercaptoethanol, and GMPCPP stabilized polarity marked microtubules) was rinsed in the flow chamber and was immediately observed by fluorescence microscopy (Zeiss, AxioImager1, 100x lens/1.4 n.a. oil‐immersion objective). Images were analyzed using Metamorph software.

4.2.9 Antibody Production

Purified GST‐tagged huKif18A^NT and a peptide comprising the C‐terminus of Kif18A (C‐KINPSMVRKFGRNISK) were used to immunize two different rabbits.

Antibodies against huKif18A^NT were purified using MBP‐huKif18A^NT coupled to N‐

hydroxysuccinimid activated sepharose beads (Amersham Pharmacia) as affinity matrix. The peptide was coupled via its sulfhodryl moiety to SulfoLink Coupling Gel from Pierce (Rockford, IL) and used for affinity purifications.

4.2.10 In vitro kinase assays

For the production of His‐Plk1, WT and KD versions, Sf9 insect cells were infected with the respective P3 baculovirus supernatants for 40 hours in the absence of a 3

hours incubation step with 100 nM okadaic acid (to obtain moderately active kinases) before lysis. The purification procedure was according to the one of His‐

Kif18A. For in vitro kinase assays 50 ng His‐Kif18A (aa 1‐898), 50 ng GST‐Kif18A(aa 1‐467) or 50 ng GST‐Kif18A (aa 593‐898) were combined either with 10 ng Cdk1 (Millipore) or 50 ng His‐Plk1 in Hepes buffer( 20 mM HEPES pH 7.5, 10 mM MgCl², 1 mM EGTA, 1 mM DTT ,1 mM ATP). Kinase reactions were carried out at 30°C for 0‐30 min. In these buffers 5 μCi [γ‐32P] ATP (Perkin Elmer ) were supplemented.

Reactions were stopped by addition of SDS sample buffer (3X) and by boiling at 95°C for 5 min. Reaction products were visualised by SDS‐PAGE followed by autoradiography.

4.2.11 Westernblotting

For immunoblot analyzes, protein samples, dissolved in sample buffer (3x 60 mM TrisHCl pH 6.8, 5 % SDS, 10 % ß‐Mercaptoethanol, 10 % Glycerol and Bromphenolbue) were loaded on SDS‐PAGE gels. Separated proteins were transferred to Nitrocellulose membranes (Schleicher & Schuell). After transferring, membranes were washed with blocking buffer (5 % low‐fat drymilk in PBST (PBS, 0.1% Tween)) for 1 h at RT. Primary antibodies were diluted in blockingbuffer.

Dilution of the antibodies, final concentrations and the companies from which they were purchased are listed below. After incubation with the primary antibodies, membranes were washed 3 times in PBST, following incubation with the HRP conjugated secondary goat‐anti mouse or goat antirabbit antibodies (0,3 μg/ml Dianova) for 1 h at RT. After 3 washes with PBST, bound antibodies were detected by ECL solution (Lumigen TMA6 Solution A/B GE Healthcare) using a digital Fujifilm LAS‐1000 camera attached to an intelligent Darkbox II (Raytest).

Table 4.2.11 summarizes the antibodies used in this study.

4.3 Cell biological materials and methods

Im Dokument Functional characterization of the mitotic kinesin-like protein Kif18A (Seite 107-120)