Master’s Thesis
To earn the Master of Science (MSc)
Master’s program: Biochemistry and Molecular Biomedicine
Dissecting a novel p53-miRNA axis in brown adipocytes
Presented by Magnus Domingo, BSc.
Submitted to
Karl Franzens University of Graz
Under supervision of
Assoz.-Prof. Priv.-Doz. Dr. Andreas Prokesch
Gottfried Schatz Research Center for Cell Signaling, Metabolism & Aging Cell Biology, Histology and Embryology, Medical University of Graz
1
Table of content
I. Abstract ...3
II. Zusammenfassung ...4
1. Introduction ...5
1.1. White-, Beige- & Brown Adipocytes ...5
1.2. Non-shivering thermogenesis ...6
1.3. Regulation of thermogenic adipocytes during fasting and cold ...7
1.4 p53 in the regulation of brown adipocyte metabolism ...8
1.5. miRNAs as important post-transcriptional regulators ...9
1.6. Preliminary data ... 10
1.7. Aim of this study ... 11
2. Materials & Methods... 12
2.1. Cell lines & differentiation ... 12
2.2. RNA/miRNA isolation ... 12
2.3. ChIP ... 13
2.3.1. Cross linking ... 13
2.3.2. Sonification Analysis ... 13
2.3.4. ChIP ... 14
2.3.5. qPCR ... 15
2.4. Luciferase Assay ... 16
2.4.1. Plasmid Construction ... 16
2.4.2. Cloning Strategy ... 16
2.4.3. Mmu-miR-92a- 1-5p Overexpression ... 19
2.4.4. Luciferase Assay in iBACs ... 19
2.4.5. Luciferase assay in HEK cells ... 20
2.5. NMR ... 20
2.6 Seahorse: ECAR measurement... 20
3. Results ... 21
3.1. Establishment of a p53 ChIP protocol in mature brown adipocytes ... 21
3.1.1. Optimization of DNA shearing ... 21
3.1.2. Optimization of cell lysis for ChIP assay ... 21
3.2. Adjusting the ChIP protocol ... 23
3.3. Slc2a5 downregulation by miR92a ... 28
3.3.1. Luciferase Assay in iBACs ... 28
3.3.2. Optimization of miRNA92a mimic overexpression ... 29
2
3.2.5. Luciferase Assay in HEK 293 ... 32
3.4. Fructose uptake and catabolism in brown adipocytes ... 32
3.5. Brown adipocytes might use fructose as substrate for glycolysis ... 34
4. Discussion & Outlook ... 35
4.1. Regulation of miRNA92a by p53: Troubleshooting the ChIP protocol ... 35
4.2. miR92a interaction with Slc2a5 ... 36
4.3. Evaluation of fructose uptake in brown adipocytes ... 37
4.4. Fructose as a substrate in mature brown adipocytes ... 37
4.5. Conclusion & Outlook ... 38
5. Appendix ... 39
5.1. Generated Slc2a5 Insert ... 39
5.2. List of Figures ... 40
5.3. List of tables ... 42
6. References ... 43
3
I. Abstract
Cold-activated brown adipose tissue (BAT) dissipates high amounts of glucose and fatty acid as substrate to generate heat. Thus, non-shivering thermogenesis is highly energy consuming and defines BAT as a metabolic sink. However, how this process is regulated under fasting conditions, when energy needs to be conserved, is still elusive.
Previous data from the lab showed that p53 signaling is the top enriched pathway and miR92a the most induced miRNA in BAT of fasted mice kept below thermoneutrality.
Bioinformatics analysis predicted a direct binding of p53 at the miR92a locus and in vitro experiments highlighted fructose transporter Slc2a5 as a potential downstream target. p53 has previously been identified as a regulator of BAT activity, thereby we aimed to further investigate this axis as potential energy conserving mechanism upon fasting. The direct binding of p53 on the miR92a locus was examined by Chromatin Immunoprecipitation-quantitative PCR (ChIP-qPCR). Furthermore, the interaction between miR92a and the 3’ untranslated region (3’UTR) of Slc2a5 was investigated by luciferase assay. Our results suggest a direct binding of miR92a to the Slc2a5 mRNA and a slight enrichment of p53 binding to the miRNA92a locus. However, the ChIP protocol for validating the interaction between p53 and the miR92a locus needs further improvement.
4
II. Zusammenfassung
Kälte aktivierbare, braune Adipozyten verbrennen zur passiven Wärmegenerierung große Mengen an Fettsäuren und Glukose. Dieser energieaufwändige Prozess definiert braunes Fettgewebe als pharmakologisches Target zur Bekämpfung metabolischer Erkrankungen. Viele Studien fokussierten sich deshalb darauf, Wege zu finden, um braunes Fettgewebe zu aktivieren. Welche molekularen Prozesse jedoch diese energieaufwendigen Mechanismen unter Fastenbedingungen regulieren, ist noch nicht bekannt. Diese Masterarbeit zielte darauf ab, einen neuen Signaltransduktionsweg näher zu untersuchen, der potenziell an der Regulierung von braunem Fett unter Fastenbedingungen beteiligt ist.
Vorherige Daten aus unserer Arbeitsgruppe zeigten, dass der Signaltransduktionsweg des Transkriptionsfakors p53 aktiviert und die miRNA92a die am stärksten induzierte miRNA unter Fastenbedingungen im braunen Fettgewebe von leicht Kälte-gestressten Mäusen ist. Bioinformatische Analysen bekräftigen eine potentielle direkte Interaktion zwischen p53 und miRNA92a, und in vitro Experimente weisen drauf hin, dass die Expression des Fruktose-Transporter Slc2a5 von dieser Achse reguliert wird. Um die Evidenz für diese Achse zu stärken, wurden direkte Interaktionen untersucht.
Die direkte Bindung von p53 an miR92a wurde mittels gezielter molekularbiologischer Methoden (Chromatin Immunoprezipitation-quantitative PCR) untersucht. Zusätzlich wurde eine Interaktion zwischen miR92a und der 3’ untranslatierte region (3’UTR) von Slc2a5 ermittelt. Die Ergebnisse deuten darauf hin, dass Slc2a5 ein direktes Target von miRNA92a ist. Eine direkte Interaktion zwischen p53 und dem miRNA92a Lokus konnte anhand der generierten Daten noch nicht eindeutig gezeigt werden, da nur eine geringe Anreicherung gemessen wurde. Dennoch liefern die Ergebnisse dieser Masterarbeit neue Erkenntnisse in der Regulation der Aktivität von braunem Fettgewebe unter Fasten und die Etablierung eines ChIP Protokolls für braune Fettzellen bietet wichtige Informationen für nachfolgende Experimente.
5
1. Introduction
1.1. White-, Beige- & Brown Adipocytes
There are two different types of adipocytes: white- and thermogenic- adipocytes (brown and beige) (reviewed in (Kajimura et al., 2015)). While the primary function of the commonly known white adipocyte is storing energy in form of triglycerides (TG), thermogenic adipocytes generate heat by dissipating energy in the respiratory chain.
Morphologically, thermogenic and white adipocytes can be discriminated by the high number of mitochondria in thermogenic adipocytes, giving them their brownish appearance. The quantity of mitochondria is reflective of their capacity to generate heat. Additionally, thermogenic adipocytes have smaller, but more lipid droplets compared to their white counterpart. White adipose tissue (WAT) is the predominant adipose depot in volume and can be found in several locations throughout the body, whereas brown adipose tissue (BAT) can mainly be found in the intrascapular region (reviewed in (Kajimura et al., 2015)). Human and rodent BAT are morphologically and molecularly distinct (Aaron M Cypess et al., 2009). Human BAT depots can mainly be found in infants and drastically diminish in adult humans (A.M. Cypess et al., 2009).
Additionally, brown adipocytes in adult humans rather resembles beige adipocytes and are located in head and neck and mesenteric regions (Wu et al., 2012). Still, human BAT in adults highly contributes to overall energy expenditure and represents an attractive target for the treatment of metabolic disorders (as reviewed in (Dong et al., 2018)).
Figure 1. Morphological difference between different type of adipocytes. White adipocytes (left) have one large lipid droplet.
In contrast, beige and brown adipocytes show increased number of mitochondria and a high amount of small lipid droplets.
Figure from (Paul, 2018)
6 1.2. Non-shivering thermogenesis
The main morphological differences between white and thermogenic adipocytes correlate with the important function in non-shivering thermogenesis (NST) of the latter.
NST takes place in mitochondria by uncoupling the proton gradient to generate heat instead of adenosine triphosphate (ATP) (reviewed in (Kajimura et al., 2015)).
The linchpin protein of NST is uncoupling protein 1 (UCP1), which takes on the task of uncoupling the proton gradient (Nedergaard, 1977). Brown adipose depots are highly innervated (as reviewed in (Bartness & Ryu, 2015)) and vascularized (as reviewed in (Cedikova et al., 2016)) to sustain signal transduction via sympathetic neurons and a constant nutrient supply by the blood. Secondly, high vascularization of thermogenic adipocytes is important for rapid dissemination of the heat through the whole body (Chouchani et al., 2019).
Cold exposure leads to sympathetic activation, resulting in norepinephrine (NE) release from postsynaptic neurons (reviewed in (Reinisch et al., 2020)). NE binding to ß-adrenergic receptors in BAT leads to increased glucose uptake by inducing the transcription of genes encoding for glucose transporters (Dallner et al., 2006).
Simultaneously, intracellular cAMP levels increased through ß-adrenergic signaling activate PKA. PKA signaling ultimately leads to the transcription of Pgc1a (Cao et al., 2004) which initiates UCP1 expression (Puigserver et al., 1998). In addition, ß- adrenergic receptor signaling, induced by e.g. ß-adrenergic agonists, cold exposure or exercise, leads to TG hydrolysis in BAT and WAT to release fatty acids for UCP1 activation and ultimately heat generation (as reviewed in (Blondin et al., 2020)).
Because thermogenic activity depends on high amounts of glucose uptake from the circulation, thermogenic adipocytes are also known as metabolic sinks (reviewed in Peirce & Vidal-Puig, 2013). Consequently, an increased BAT activity is associated with lower glycemia (Matsushita et al. 2014; Lee, Smith, et al. 2014) and an improved insulin sensitivity (Chondronikola et al., 2014). Additionally, high-caloric meals may lead to increased BAT activity to compensate for increased energy intake and maintain energy homeostasis (Rothwell, 1997).
7
1.3. Regulation of thermogenic adipocytes during fasting and cold
Since active BAT oxidizes high amounts of energy, NST is highly dependent on substrate availability (reviewed in (Reinisch et al., 2020)). Therefore, there should be counteractive measures to limit substrate uptake under situations of nutrient deprivation when energy needs to be directed to the brain. It was shown in studies using rodent models that one important regulatory node controlling BAT activity upon nutrient scarcity is the sympathetic nervous system (SNS) itself (reviewed in (Reinisch et al., 2020)).After two days of prolonged fasting, SNS activity was suppressed (Young and Landsberg, 1997 and as reviewed in (Reinisch et al., 2020)). Subsequently, NE turnover in BAT was reduced, resulting in diminishing ß-oxidation of TG and decreased substrate availability (Young et al., 1982). Mice fasted for 48 hours showed a reduced heart rate and oxygen consumption, indicating a reduced sympathetic outflow (Kimura et al., 2011), which corroborates aforementioned finding. Another study showed that upon hunger, secretion of hypothalamic neuropeptide Y (NPY) resulted in the activation of GABAergic neurons, in turn leading to decreased BAT temperature and downregulation of Ucp1 mRNA through suppression of the sympathetic tone (Nakamura et al., 2017; Shi et al., 2013). As proof of principle, knockout of NPY in mice led to elevated UCP1 expression, development of beige adipocytes, increased energy expenditure and thermogenic response to cold environment (Shi et al., 2013). In another study, challenging mild cold-stressed mice with prolonged fasting (48-72 hours) reduced BAT weight (Syamsunarno et al., 2014; Trayhurn & Jennings, 1988;
Zelewski & Swierczyński, 1990), accompanied with the decrease of other hallmarks of BAT activity like UCP1 protein levels (Desautels, 1985).
Interestingly, repetitive fasting protocols, like every other day fasting or intermittent fasting, did not change hallmarks of BAT activity. As example, expression of brown marker genes (Li et al., 2017) and glucose uptake capacity (Fabbiano et al., 2016) remained unchanged. These findings are in line with unaltered BAT weight, morphology and oxygen consumption of mild cold-stressed (25°C), short-term fasted mice (≤24 hours) (H. Ding et al., 2016).
Mice under severe cold stress (4°C), show a more pronounced competition between energy conservation upon fasting and the metabolic need of NST, to adapt to low temperature (reviewed in (Reinisch et al., 2020)). Short term cold stress (of 4°C for 4 hours) showed significant BAT weight reduction, as well as reduced lipid droplet and
8
intracellular TG contents indicating usage of intracellular FAs for heat generation (Syamsunarno et al., 2014). Furthermore, mRNA expression of genes involved in BAT activity was significantly reduced (Syamsunarno et al., 2014).
Taken together, FAs supply by WAT is sufficient for BAT activity upon short-term fasting (Shin et al., 2017). However, upon prolonged fasting and/or fasting with a simultaneous severe cold stress, BAT activity is reduced to save energy. In contrast, during periodic fasting, organisms seem to compensate for decreased food intake quickly in the refeeding phase, showing no or even improved changes in BAT morphology and function (Fabbiano et al., 2016; Li et al., 2017).
1.4 p53 in the regulation of brown adipocyte metabolism
p53 is the best described molecule in medical research (Dolgin, 2017), which is mainly due to its prominent function in tumor suppression and the fact that it is mutated in over 50% of human cancers (Magali et al., 2010). Recent studies emphasized an important role of p53 in metabolism and the function of p53 in brown adipocyte metabolism has been investigated in a few studies (Hallenborg et al., 2016; Irie et al., 1999; Molchadsky et al., 2013) but still lacks a consensus.
Zhao et. al showed that p53 is implied in a regulatory axis controlling BAT activity. They found that histone-methyltransferase KMT5c expression, which is induced through ß- adrenergic signaling cascade, leads to decreased Trp53 expression in brown adipocytes. Trp53 repression, in turn, leads to increased expression of thermogenic genes (Zhao et al., 2020). This is corroborated by several studies suggesting p53 as a positive regulator of brown adipocyte differentiation (as reviewed in (Lee et al., 2020)) and a negative regulator in thermogenic gene expression (like UCP1) (Al-Massadi et al., 2016; Hallenborg et al., 2016). Prdm16-overexpressing myogenic C2 cells for instance, showed the requirement of endogenous p53 levels for differentiation based on reduction of accumulated lipid droplet and lower expression of brown marker genes upon p53 knockdown (Molchadsky et al., 2013). Additionally, brown adipocyte-specific p53 overexpression in mice on a high-fat diet increased body weight gain, while BAT temperature and UCP1 protein expression were reduced (Al-Massadi et al., 2016), indicating p53 as a negative regulator for BAT activity. Mechanistically it is suggested that p53 mediates UCP1 repression by binding to Pgc1a (Hallenborg et al., 2016) and Prdm16 promoter in murine BAT (Molchadsky et al., 2013).
9
This data is in line with p53 stabilization as a fasting response, especially observable in epididymal WAT, liver, and skeletal muscle (Schupp et al., 2013). Consequently, increased p53 signaling upon fasting could be an important regulator of BAT activity.
1.5. miRNAs as important post-transcriptional regulators
Micro RNAs (miRNA) are small, non-coding, RNA molecules (approximately 20- 24 nucleotides) that have an important function in regulating gene expression (as reviewed in (O’Brien et al., 2018)). After being transcribed by Pol II and Pol III, Pri- miRNAs get processed and translocated form the nucleus to cytoplasm, where the now pre-miRNAs are further processed by DICER into mature miRNAs. miRNAs bind on the mRNA of target genes together with RISC complexes to complementary sequences, which are called seed sequences. By binding to mRNA, miRNAs inhibit mRNA translation or mediate their break down (as reviewed in (O’Brien et al., 2018)).
Over 60% of protein coding genes are predicted to be under the regulation of miRNAs (as reviewed in (Hermeking, 2012)). Since miRNAs are suggested to have evolved to effectively mediate with stress-responses (as reviewed in (Olejniczak et al., 2018)), there is a strong interconnection with p53 pathways. p53 is involved in processing precursor miRNA into mature miRNA and/or directly induces miRNA transcription (as reviewed in (Hermeking, 2012)).
Since p53 is suggested to only act as a transcription activator and not as a repressor (Fischer et al., 2014), p53`s effect on transcriptional repression might mainly be mediated indirectly via e.g. miRNAs. Furthermore, miRNAs that have been shown to be regulated by p53 contribute to various tumor suppressive effects, such as induction of cell cycle arrest, senescence, and apoptosis, as well as the inhibition of metastasis, angiogenesis, and glycolysis (as reviewed in (Hermeking, 2012)).
10 1.6. Preliminary data
Previous gene set enrichment analysis (GSEA) of transcriptome data and miRNA-seq analyses of mice that were fasted under mild cold-stress (22°C) showed p53 signaling as the most elevated pathway and miR92a the most induced miRNA in BAT. Recent findings of BAT-derived miR92a in serum also suggested this miRNA as a biomarker of BAT activity (Chen et al., 2016). Subsequent bioinformatic analysis predicted a potential binding site of p53 on the miR92a locus (Figure 2). Additionally, in vitro gain- and loss-of function experiments revealed a positive correlation between p53 and miR92a expression. This led to the hypothesis that p53 may directly induce miR92a expression transcription.
Furthermore, in silico analysis revealed several potential targets of miR92a, including several binding sites on the 3`UTR of the fructose transporter Slc2a5, which is the most downregulated gene upon fasting in the transcriptome data set. In vitro gain and loss of function studies reinforced an interaction between miR92a and Slc2a5. This led to
Mir92-1 locus P53 BS
Closest next p53 BS: ~8kB US
Figure 2. Bioinformatic analysis of miR92 locus. The miR92-1 locus can be seen in the middle (rectangle) and the potential p53 binding site is pointed at with the right arrow. The left arrow points at the next closest p53 binding site near the Mir92-1 locus, w which is around 8kb away.
11
the hypothesis that fructose may be used as an energy source by BAT which might be metabolized via glycolysis, thereby regulating BAT activity. In this model, p53 signaling upon nutrient deprivation would result in miR92a induction and in turn downregulation of fructose transporter Slc2a5 (as depicted in Figure 3) to curtail fructose catabolism in BAT under fasting.
1.7. Aim of this study
This work of this master thesis is aimed to validate direct interactions in the p53- miR92a-Slc2a5 axis. By using chromatin immunoprecipitation (ChIP), binding of p53 to the miR92a locus was examined. Moreover, using luciferase assays, the interaction between miR92a and Slc2a5 mRNA was studied. Furthermore, uptake and processing of fructose in immortalized brown adipocytes (iBACs) was examined by NMR and measurement extracellular acidification rate (ECAR).
Figure 3. Potential pathway in brown adipocytes. Upon external signals (like starvation or cold exposure) increased p53 expression leads to transcription of miR92a. As a result, miR92a binds to and downregulates Slc2a5 mRNA.
12
2. Materials & Methods
2.1. Cell lines & differentiation
Immortalized brown adipocytes (iBACs), a murine brown progenitor cell line, have been used as in vitro model. iBACs were maintained and differentiated according to a modified protocol from C.R. Kahn’s lab. In short: iBACs were cultivated in T75 flask (Nunc EasYFlask 75cm2 by Thermo Fisher Scientific) and can be transferred into Well plates if necessary. They were incubated at 37°C and 5% CO2 in “growth medium”.
After thawing, iBACs were passaged every other day for one week before experiments were conducted. Growth medium consisted of 10mM HEPES buffer (1M Gibco), 10%
FBS (HyClone) and 1% Penicillin/Streptomycin in Dulbecco´s Modified Eagle Medium- high glucose medium (DMEM, Gibco) containing 4.5 g/L-Glucose.
For differentiation, growth medium was changed to induction medium, consisting of 125 nM indomethacin, 500 nM Dexamethasone and 0.5 mM IBMX added to iBACs maintanance medium. All the substances mentioned above, are purchased from
“Sigma-Aldrich”.
After 2 days the induction medium was changed to maintenance Medium (MM). The maintenance medium consists of the iBACs growth medium with the addition of 10nM insulin and 1nM T3 (Sigma-Aldrich). Maintenance Medium was changed every other day.
Fully differentiated cells (after 7-9 days) were treated for 24 hours with 5µM Idasanutlin, a known p53 stabilizer (Q. Ding et al., 2013; Tovar et al., 2013), (by Cayman Chemicals), starved with starvation medium (10mM HEPES buffer (1M Gibco) in HBSS) or immediately harvested for ChIP.
HEK293 cell were cultivated in DMEM high Glucose with 10% FBS and 1%
Penicillin/Streptomycin.
2.2. RNA/miRNA isolation
For RNA isolation “ExtractMe: Kit for simultaneous isolation of RNA & DNA from animal tissue and cell culture, Cat. No. Em 09.1-250” was used according to its protocol.
The isolation of miRNAs of iBACs was done according to the protocol (“Norgen: Total RNA Purification Kit, Product # 17200, 37500, 17250, 17270”).
13 2.3. ChIP
2.3.1. Cross linking
Fully differentiated iBACs were crosslinked according to an established protocol (Prokesch et al., 2016) by adding “16% formaldehyde” (by pierce thermofisher scientific) to the flask. After 15 minutes, crosslinking was stopped by adding 2.5M glycine to a final concentration of 125mM for 5 minutes.
2.3.2. Sonification Analysis
To gain DNA fragments of about 100bp to 1000bp, different sonification cycles were tested by using the “Diogenode Bioruptor Pico”. The cells were resuspended in 1.5 ml hypotonic buffer (15-20 times the samples’s volume) and dounced 40 times. After checking the cell lysis under the microscope, the samples were pelleted at 3000xg at 4°C and washed twice with hypotonic buffer (20 mM HEPES/NaOH pH 7.5, 0.25 M Sucrose, 3 mM MgCl2, 0.2% NP-40, 3 mM 2-mercaptoethanol, 1mM PMSF, Complete protease inhibitor cocktail with 1 mM EDTA). Pelleted nuclei were resuspended in 400µl of lysis buffer and incubated on ice for 10 minutes.
100µl of solution containing nuclei were transferred to four “1.5 ml Bioruptor® Pico Microtubes with Caps”. Each Microtube was treated in the precooled Bioruptor by using following amount of sonication cycles: 5,10, 15 and 30. One cycle corresponds to 30sec ON/ 30sec OFF. 20µl of the sonicated samples were used for fragment size analysis. After transferring the 20µl into Eppendorf tubes, the samples were de- crosslinked using “Proteinase K (by Abion)” and DNA isolated using ExtractMe: Kit for simultaneous isolation of RNA & DNA from animal tissue and cell culture” according to protocol.
After measuring the DNA concentration of each sample with “NanoDrop® ND-1000 Spectrophotometer” by Peqlab, 0,5-1µg of DNA was diluted in 25µl ddH2O, 1X BlueJuice Loading buffer (Invitrogen by Thermo Fisher Scientific) was added per sample and loaded on a 1% Agarosegel without GelRed. Additionally, 100bp DNA ladder by New England Biolabs and/or “1 Kb Plus DNA Ladder” by Thermo Fisher Scientific were loaded. After approximately 50 minutes of electrophoresis by 95V, the gel was stained for at least 30 minutes with 50ml TAE buffer containing 20µl GelRed®
Nucleic Acid Gel Stain (Biotium). At last, it was analyzed with FluorChemQ (by Alpha Innotech).
14 2.3.4. ChIP
The sonicated samples (90µl each) were mixed with 910µl dilution buffer (50mM HEPES/NaOH pH 7.5, 155mM NaCl, 1.1% triton X-100, 0.11% Na-Deoxycholate, complete protease inhibitor cocktail with 1mM EDTA). An aliquot of 50µl was removed from the sample intended for IgG precipitation (for “5% Input Control”) and frozen at - 80°C. Afterwards, 3.54µg of D2H9O antibody (cell signaling) was originally (see Figure 8) and afterwards 2,5 µg were added for one precipitation (if not noted otherwise).
Antibody/beads/sample mixture was incubated for 2 hours at 4°C on a rotator.
While the chromatin/antibody mix was incubating, clear DynabeadsTM Protein G (Invitrogen by Thermo Fisher Scientific) (20µl/ IP) were washed 3 times, in 5 times the volume of a blocking buffer (0.5% BSA in PBS). Afterwards, the beads were incubated in 5 times the volume of blocking buffer, until the incubation of the antibody/chromatin mixture was finished (1-2h). After reconstituting the original volume in blocking buffer, 20µl of the beads were added to the chromatin/antibody sample and incubated at 4°C on a rotator overnight.
The following day, the Antibody/chromatin/bead mixture was washed 6 times with 1 ml of wash buffer (5M NaCl, 0.5M EDTA [Titriplex® II] pH 7.8, 1M Tris pH 7.5, Ipegal, Triton X100, Protease Inhibitor Cocktail [PIC], [every substance mentioned from Sigma-Aldrich]) by using a magnetic rack at 4°C. Incubation time between each wash step was 3 minutes, including the last wash step with cold TE buffer (with addition of PIC).
In case of increasing wash stringency (see Figure 12), NaCl concentration in the wash buffer was increased to a final concentration of 500nM and beads were washed with it in the final wash step instead. Lowering the wash stringency (also Figure 12) was done by washing beads with wash buffer 3 times instead of 6 times.
After aspirating TE buffer, 100µl of the elution buffer (1M NaHCO3, 20% SDS, solved in ultrapure H2O) was added and after moderate vortexing placed on a thermo mixer for 40 minutes at room temperature and 1000rpm. Afterwards, the supernatant is collected in a 1.5 DNA LoBind tube by Eppendorf AG, followed by adding another 100µl to the beads and continuing the incubation for 15 minutes, after moderate vortexing the elution/bead mix.
200µl of the elution buffer was added to the input chromatin and processed the same way, starting with the addition of 8µl of 5M NaCl to 200µl of the supernatants. The samples were incubated at 65°C overnight.
15
The following day the chromatin was de-crosslinked by adding 1µl of RNase A, incubated at 37°C for 30 minutes and subsequently adding 4µl 0.5M EDTA pH 7.8, 1M Tris-HCl pH 6.8 and 1µl proteinase K (10µg/µl). The samples were incubated at 45°C for 2 hours.
2.3.5. qPCR
cDNA samples were diluted to a final concentration of 1ng/µl. 1.5µl cDNA, 3µl SyberGreen (Blue S’Green qPCR 2x Mix by Biozym”) and 1.5µl of the respective 8nM forward and revers primer solution was used for qPCR. The following primers were used:
Target Forward Primer Reverse Primer
mMir92a 3 TTGGGATTTGTCGCAATGCTG TCTGGTCACAATCCCCACCA
mp21-0,1kbv2 CTGTTGCCTCTCGGAGACC CCTGAAGGCCAGAAAGCTAGT
neg. contr. (NEW 3) 1
TGAGCACAGGAGAAAAGGCAA GCCTACCAAGACAAATGAGCAG
Table 1. Primer Sequences. Primer names (related to loci) depicted on the left. The designed primer sequences used for the ChIP-qPCR. The forward primers in the middle and the reverse primers on the right side of the table.
The following program was used for the amplification of cDNA (“BioRads CFX384 Touch Real-Time PCR Detection System”)
Method: Calc Lid: 95°C Volume: 6µl
1. 95°C, 5:00 2. 95°C, 0:05 3. 60°C, 0:30 4. Plateread 5. Goto 2, 39X 6. 60°C, 0:31 7. 60°C, 0:05
+0.5°C/cycle Ramp 0.5°C/s 8. 8.Plateread 9. 9. Goto 7, 70X
16 2.4. Luciferase Assay
2.4.1. Plasmid Construction
The cloned plasmid-construct was generated by using the PsiCHECK2 vector (Promega). Primers constructed for the insert were generated by using 50 extra bases upstream and downstream. Around 10 to 15 bases at the end of the sequence were used as forward and reverse primers, subsequently attaching Xho1 and Not1 to their ends as depicted below:
Slc2a5_UTR_3_fwd ttaCTCGAGCagagccaggcca Slc2a5_UTR_3_rev taGCGGCCGCttctatgtatgtaac
Backbone and insert were digested with Xho1 and Not1 HF (by New England BioLabs).
Figure 2 shows the complete vector- construct generated using SnapGene software.
2.4.2. Cloning Strategy Minipreparation of Psicheck2
The PsiCheck2 glycerol stock was cultivated overnight in autoclaved Terrific-Broth- Medium (Carl Roth GmbH + Co) containing 1:1000 ampicillin. Bacteria suspension was centrifuged at max. speed and resuspended according to manufacturer’s protocol.
“QIAprep Spin Miniprep Kit” by Qiagen the miniprep was completed.
Figure 4. Cloned PsiCHECK2_Slc2a5_3'UTR construct. Insert is depicted in red.
17 PCR amplification of Slc2a5_3’UTR
RNA samples isolated from murine BAT were diluted to 1µg DNA in 10µl ddH2O.
Afterwards, 1µl of OligoDt and random Primers (both by Invitrogen by Thermo Fisher Scientific) were added to the 10µl DNA solution. DNA mix was incubated at 65°C for 5 minutes and kept at 4°C in a thermocycler (ProFlex PCR System by Thermo Fisher Scientific”). 2µl Deoxynucleotide (dNTP) Solution Mix (by New England Biolabs), 4µl reaction buffer, 1µl Revert Aid reverse transcriptase and 1µl RiboLock RNase inhibitor (all by Thermo Fisher Scientific) were added to the mix. Reverse transcription was facilitated by incubating the sample in the thermocycler with following temperature program:
Temperature Incubation time
25°C 5min
42°C 1h
70°C 5min
4°C infinity
Table 2. Temperature program of reverse transcriptase transcribing RNA into cDNA.
After reverse transcription, 10µl of cDNA was combined with 23,5µl ddH2O, 10µl 5x q5 reaction buffer, 1µl dNTPs (both by New England Biolabs), 2,5 µl each of 10µM Slc2a5 forward and reverse primer, 0.5 µl Q5 Pol (by New England Biolabs).
Amplification of the 3´UTR of Slc2a5 was performed by the following temperature profile:
18
Slc2a5_UTR_3
denaturing 98°C 30s
annealing 98°C 20s
58°C 30s 35 cycles
72°C 2min
final extension 72°C 2min
4°C infinite
Table 3. Temperature program of Slc2a5_UTR_3 PCR
Restriction digestion & Ligation
Amplificated Slc2a5_UTR_3 and PsiCheck2 vector (both 1µg) were cut with 1µl of restriction enzyme Xho1 and Not1-HF (by New England BioLabs Inc). Cutsmart buffer (1x, by New England BioLabs Inc), was added to Insert and PsiCheck2, before incubating the samples for one hour at 37°C Alkaline Phosphatase. Afterwards, Calf Intestinal phosphatase (CIP) (by New England Biolabs) was added to the PsiCheck2 mix.
A gel electrophoretic separation was done in a 1% Agarosegel at 92V for 1h. Bands of the size of around 1080 bp, were cut out and purified via “MinElute“ by Qiagen.
Ligation of insert and backbone were done according to following mixture: 3.48µl of the PsiCheck2 vector, 3.66µl Slc2a5_UTR_3 insert, 2µl T4 Ligation Buffer by New England Biolabs, 9.86µl ddH2O and 1µl Ligase by New England Biolabs. This mixture was incubated for 20 minutes at room temperature.
Escherichia coli Transformation
According to “NEB 5-alpha competent E. coli (high efficiency)” protocol by New England Biolabs, E. coli was transformed with 0.22µl PsiCheck2 vector (from 137.6ng/µl stock solution) as positive control, 5µl water as negative control and 5µl of
19
the PsiCheck2 containing the Slc2a5 insert. Transformed E. coli were plated on an agar plate with 1:1000 ampicillin and incubate overnight at 37°C.
Colony PCR
Colony PCR was done for 13 transformed PsiCheck_Slc2a5 colonies. A pipette tip with the respective colony was dipped each in one 20µl PCR reaction solution containing:
4µl 5x q5 reaction buffer, 0.4µl dNTPs, 1µl 10µM fwd and rev Primer each, 2µl Q5 Polymerase and 13,4 µl ddH2O. The same temperature cycle was used as before (see
“PCR amplification of Slc2a5_3’UTR” above) with 40 cycles. The amplicons were analyzed by 1% agarose gel electrophoresis. Miniprep was made of the positive band signals with subsequent restriction digestion as stated before. Positive signals were sent to sequencing with Slc2a5 primers.
Midipreparation
Isolation of the DNA- construct from the clones was made according to “Plasmid Midiprep kit” by ExtractMe. Overnight culture in 100ml of “Terrific-Broth-Medium by Carl Roth GmbH + Co” containing 5ug/ml ampicillin was made of the respective clones and incubated overnight.
2.4.3. Mmu-miR-92a- 1-5p Overexpression
Isolated miRNA (“see: 2.2. RNA/miRNA isolation”) of electroporated iBACs (see: 2.4.4) was transcribed to cDNA using “miRCURY® LNA® RT Kit” and further processed according “miRCURY LNA miRNA PCR Assay” protocol.
2.4.4. Luciferase Assay in iBACs
Fully differentiated iBACs were detached from a 6 well plate with Collagenase P- Trypsin solution (0.5mg/ml Collagenase P and 0.25% trypsin in PBS by Gibco). Around 500 000 Cells were electroporated with 1-,3- and/or 5µg PsiCheck2_Slc2a5 DNA construct and 1-1.5µl (1µM-1.5µM) “miRNA 92a mimic”/ “miRNA negative control” in a final volume of 100µl. As transfection control, 3µg of EGFP_LC3 vector was used.
Electroporation parameters of “Neon Transfection System by Invitrogen by life science”
were: “1300V”, “width:10” and “pulse: 2”. 100µl containing around 500k electroporated cells were seeded in collagen-coated plates (48 well). After one day of incubation in antibiotic-free maintenance medium, the medium was changed to normal maintenance medium and incubated for another day. The Luciferase assay was performed according to the manufactures instructions (“Dual-Luciferase®Reporter Assay
20
System”). In detail, after washing the cells twice with PBS, they were treated with 30µl of “1xPLB”. Thereafter, the plate was incubated at room temperature on a moderately spinning shaker for 45 minutes. The cells were detached by a cell scraper, mixed by pipetting up and down 60 times and transferred in a well of a 96 well plate.
Substrate and luciferase solution were prepared according to manufacturer’s protocol before luciferase signal was analyzed by “CLARIOstar Plus” by BMG Labtech. The device was set to measure luminescence of luciferase first, corresponding to emission measurement of 600nm, starting from 2.5s to 28.24s. Subsequently, Renilla emission was measured at 450nm, starting from 31.5s to 57.24s. In detail, 100µl of “LAR II” was injected first, followed by 100µl of “stop&glo” substrate.
2.4.5. Luciferase assay in HEK cells
HEK cells were transfected according to manufacturer’s protocol with 1.25µl
“Lipofectamine3000 Reagent”, 1µl (1µM) “miRNA 92a mimic”/ “miRNA negative control” by dharmacon in 40 000 cells in a collagen coated 48 well plate. Preparation and measurement of luciferase assay was according to the protocol in 2.4.3 Luciferase Assay in iBACs. Transfection efficiency was estimated by GFP signal and monitored after 1-2 days with “Nikon’s Eclipse TE 2000-U” microscope.
2.5. NMR
Mature iBACs were treated with 1.5g/L-fructose, 5g/L-fructose or control maintenance media. Thermogenesis was stimulated with 1µM isoproterenol for 1 hour. The cells were harvested according to a previously published protocol (Stekovic et al., 2019).
2.6 Seahorse: ECAR measurement
Mature iBACs were seeded in a Seahorse XF 96 culture microplate.
iBACs were cultivated in maintenance medium. Extracellular acidification rate (ECAR) was analyzed according to manufacturer’s protocol (Seahorse XFe96 Analyzer by Agilent). 27mM glucose or 25mM fructose was acutely injected following measurement of basal ECAR. After ECAR measurement BCA assay for protein quantification was done on well-plates to normalize the results.
21
3. Results
3.1. Establishment of a p53 ChIP protocol in mature brown adipocytes 3.1.1. Optimization of DNA shearing
To generate DNA fragments with a peak centered around ~300bp, different numbers of sonification cycles were applied to crosslinked DNA, as described in “2.3.2 Sonication analysis”. Subsequently, fragment length was analyzed by agarose gel electrophoresis as shown below.
Figure 5. Gelectrophoresis of fragmented iBACs DNA cultivated in maintenance media. Crosslinked iBACs samples were sonicated in Eppendorf tubes (A) or Bioruptor tubes (B). Used cycle numbers of sonication are noted above each lane. DNA ladder was loaded on the left slot. Base pairs are noted on the left side.
Using Bioruptor tubes (Figure 5B) instead of standard eppendorf tubes (Figure 5A) substantially improved DNA fragmentation by sonification, subsequently leading to smaller fragment sizes upon less sonification cycles. Ten cycles seemed to be the optimal cycle number leading to a DNA fragment size of less than 500bp when using Bioruptor tubes. Additional increase in cycle number does not show further recognizable size reduction and might lead to interference of protein binding to the DNA.
3.1.2. Optimization of cell lysis for ChIP assay
To optimize plasma membrane lysis and improve overall yield of crosslinked DNA-p53 material, an optional sonification step can be included after douncing (Prokesch et al., 2016). Since excessive sonication can lead to an interference of protein binding to DNA, the effectiveness of an additional sonification step was tested Therefore, four
22
protocols were performed without and with five sonication cycles at two different times during processing, respectively, to investigate whether an effect on the overall yield could be observed. Sonication to lyse the plasma membrane and sonication to fragment DNA were analyzed by agarose gel electrophoresis in the following combination (Figure 6): Un-sonicated for lysis and fragmentation; un-sonicated for lysis and sonicated for fragmentation; sonicated for lysis and un-sonicated for fragmentation; sonicated for lysis and fragmentation. Five cycles of sonication were used for lysis and/or DNA - fragmentation. No significant increase in yield could be observed in the amount of isolated DNA (L-/F+: 58ng/µl and L+/F+: 70ng/µl) and the fragment size was not reduced as seen in Figure 6.
Figure 6. Lysis efficiency was analyzed according to fragment length by running the DNA on a 1% agarose gel. Five cycles of sonication were used after douncing crosslinked iBACs (L+) to enhance plasma membrane lysis and/or after nuclei lysis to fragment DNA material (F+). By omitting sonication cycles (“L-“ or “F-“) different protocols were used to determine lysis efficiency.
23 3.2. Adjusting the ChIP protocol
Next, ChIP-qPCR was used to amplify chromatin derived from immunoprecipitation with p53 antibody. P21, a well described target gene of p53 (Benson et al., 2013), has been used as control locus. The locus for miR92a was our locus of interest, as we previously identified a potential interaction of p53 with miR92a. Primer pairs for negative controls have been designed at loci that are several kbs distant of p53 binding sides.
Using Eppendorf tubes with the highest number of sonification cycles (shown in Figure 5A) for DNA fragmentation showed no recognizable difference in enrichment (Figure 7). This led to the assumption that insufficient DNA fragmentation results in precipitation of too long DNA fragments, delivering qPCR signals from regions far distant from the locus of interest, including negative control loci. This is shown in Figure 7, where miR92a locus and p21 target regions (positive control) showed no increased enrichment over negative control.
Since p53 signalling has been shown to be increased upon starvation, in an effort to increase binding efficiency, iBACs have been starved for 24h in HBSS and HEPES before crosslinked material was harvested. Additionally, bioruptor tubes have been used for sonicating the DNA-protein complexes, as they have been validated to improve fragmentation of the DNA.
Figure 7. ChIP-qPCR precipitated with 3.54µg antibody and 20µl magnetic tubes. Eppendorf tubes were used for DNA fragmentation. After harvesting mature iBACs, cultivated in maintenance media, 40 cycles of sonication were used for DNA fragmentation.
miR92a IgG p21 IgG 0.0
0.5 1.0 1.5
ChIP-qPCR
%Input over neg. ctrl
24
ctrl stv
0.0 0.5 1.0 1.5 2.0
ChIP- qPCR
%Input over neg. ctrl miR92a
p21 IgG
Figure 8. qPCR of starved iBACs. Cells were starved for 24hrs in HBSS with 10mM Hepes (stv) while control sample remained in maintenance medium before harvest. 2.5µg of antibody combined with 20µl magnetic beads were used for precipitation after DNA fragmentation by 10 cycles of sonication.
While a slight enrichment over the negative control region was measured, comparing control with starved iBACs, ChIP-qPCR signal indicated no remarkable difference in enrichment of the p21 and miR92a loci (Figure 8).
As an alternative method, we used idasanutlin, a frequently used pharmacological agent that leads to stabilization of p53 at the protein level, resulting in activation of p53 target genes such as p21. In line, idasanutlin-treated samples showed increased pulldown of p21 and miR92a loci, when precipitated with 1.25µg antibodies (not shown). However, negative controls also increased noticeably, resulting in an overall reduced "%Input over negative control" enrichment compared to control sample (Figure 9).
Figure 9. qPCR of nutlin treated iBACs precipitated with 1.25µg antibody. Cells were treated for 24 hours with 5µM idasanutlin (Nutlin) in maintenance medium before harvesting. Control sample (Ctrl) was cultivated in maintenance medium before harvesting. 1.25µg of antibody (D2H9O) combined with 20µl magnetic beads were used for precipitation after 5 cycles of sonication.
Ctrl Nutlin
0 1 2 3 4
ChIP- qPCR
%Input over neg. ctrl miR92a
IgG p21
25
To test whether increasing the amount of antibody could increase the overall specific enrichment, we doubled the amount of antibody for pull down. This showed an overall increase in enrichment for the miRNA92 as well as for the p21 region. However, negative control signal proportionally increased as well. This ultimately shows reduced enrichment of idasanutlin treated sample over control sample, using 1.5 µg antibody (Figure 9) and no discernible change in enrichment of target regions miRNA92a and p21 using 2.5 µg antibody (Figure 10), depicted in “%Input over negative control”.
Ctrl Nutlin
0.0 0.5 1.0 1.5
ChIP- qPCR
%Input over neg. ctrl miR92a
p21 IgG
Figure 10. ChIP-qPCR of chromatin derived from control or nutlin treated iBACs precipitated with 2.5µg antibody. Cells were treated for 24 hours with 5µM idasanutlin (Nutlin) in maintenance medium before harvesting Control sample (Ctrl) was solely cultivated in maintenance medium before harvest. 2.5µg of antibody (D2H9O) combined with 20µl magnetic beads were used for precipitation after 5 cycles of sonication.
Taken together, using pharmacological agents to stabilize p53 or adjusting the antibody concentration did not result in improved binding efficiency. Moreover, overall enrichment was the highest using untreated samples (control) with less antibody (1.25µg) (Figure 10).
Since insufficient amounts of magnetic beads might result in high unspecific binding, different amounts of beads were tested for ChIP. Thus, 100µl (Figure 11A) or 200 µl (Figure 11B) (as suggested by the manufacturer) beads per sample were used for precipitation.
26
One hundred µl bead precipitation showed no change in enrichment of the control over idasanutlin treated sample (Figure 11A) in any of the examined loci. Using 200µl beads, miR92a and p21 loci showed high “%Input over negative control” enrichment in control compared to idasanutlin treated sample (Figure 11B). However, the dramatically increased enrichment of target loci pulled down by IgG antibodies suggests that increased unspecific binding is the reason for the increased overall enrichment of the control sample. In contrast, idasanutlin-treated samples showed lower enrichment of "%Input over negative control" pulled down with the p53 antibody, but enrichment of the same loci was drastically lower in comparison when the IgG antibody was used for pulldown. Taken together, while 100µl beads treatment showed no change in “%Input over negative control”, when using 200µl beads idasanutlin- treated samples seem to be lower compared to the control. However, the high enrichment of the control sample could be due to unspecific binding as indicated by high enrichment of loci precipitated with IgG. Since the negative control loci also showed the lowest %Input enrichment when using 200µl beads, further experiments were performed using this parameter (Figure 11B).
Figure 11. Bead analysis of cell precipitated with 100 µl (A) and 200µl (B) beads. After 24 hours incubation of iBACs with indasanutlin (Nutlin), harvested cells were precipitated with magnetic beads combined with 2.5µg D2H9O antibodies. Control sample (Ctrl) was harvested after cultivation in maintenance medium.
Ctrl Nutlin
0 1 2 3 4
ChIP- qPCR
%Input over neg. ctrl miR92a
IgG p21
B
Ctrl Nutlin
0.0 0.5 1.0 1.5 2.0
ChIP- qPCR
%Input over neg. ctrl miR92a
IgG p21
A
27
Figure 12. ChIP-qPCR of amplified chromatin derived from immunoprecipitation with p53 antibody. All samples were cultivated in maintenance medium and precipitated with 2.5µg antibody (D2H9O) combined with 200µl magnetic beads. Washing steps of bead- antibody/DNA complexes have been performed by using six steps with “wash buffer”
serving as control (Ctrl) and IgG control (IgG). By changing the wash buffer of the finals wash step from 150mM to 500mM NaCl stringency was increased (high salt). By reducing the wash steps with wash buffer by half (3 times) the stringency was lowered (reduced wash steps).
Another approach to optimize antibody specificity was done by using different numbers of washing steps or increased stringency of the washing buffer. By increasing stringency of the wash process (e. g. increasing wash steps, higher salt concentration in wash buffer) weak, unspecific bindings with antibodies might be reduced, while stronger bindings remain. No recognizable increase in miR92a enrichment could be observed when increasing the stringency of the wash buffer to salt concentrations of 500mM (Figure 12). Decreasing stringency however, increased %Input enrichment at the p21 locus while signals from the negative control and miR92a loci were unchanged.
However, inspection of the negative control signal revealed a drastically reduced p21 locus at reduced stringency, while miR92 remained the same ("reduced wash step" in Figure 12). Furthermore, all the other negative controls used (not shown in this Figure) showed increased enrichment comparable to p21 expression. All in all, lowering stringency seems to increase unspecific binding, while increasing it suggests a slight improvement of unspecific binding events.
Ctrl
IgG
high salt
reduced wash steps 0.0
0.5 1.0 1.5
ChIP- qPCR
%Input over neg. ctrl miR92a
p21
28
Combining the results of several independent experiments of iBACs cultivated in maintenance media, miR92a locus and positive control loci in the gene promoter of p21 showed significantly increased %Input, when pulling down p53 (Figure 13).
However, other negative controls used in these experiments (not shown) scatter drastically across runs and in some cases even surpass the enrichment values of target and positive control loci. Due to these conflicting results, further adjustment of the ChIP protocol may be required.
3.3. Slc2a5 downregulation by miR92a 3.3.1. Luciferase Assay in iBACs
To examine possible binding between Slc2a5 and miR92a using luciferase assay the 3’UTR of Slc2a5, harbouring predicted miR92a seed sequences, was cloned in a luciferase reporter vector (PsiCHECK2_Slc2a5_UTR_3). To establish an efficient co- transfection of reporter vector and miR92a in iBACs, three conditions with varying amount of the generated vector-construct was electroporated with miR92a mimic or non-targeting sequence control (ntc). Comparison of ntc and miRNA mimics of each condition (1-, 3- and 5µg PsiCheck2 vector product) showed that cells transfected with the highest amount of PsiCHECK2- vector had an approximately 20% reduction of luciferase signal, when transfected with miR92a (Figure 14A). This data indicated that miR92a interaction with Slc2a5 3’UTR could lead to reduced luciferase signal when 5
Figure 13. ChIP- qPCR of Chromatin derived from iBACs cultivated in maintenance medium. After DNA was fragmented upon 10 cycles of sonication, samples were precipitated with 2.5µg antibody (D2H90) and 200µl magnetic beads. Six wash steps were performed with “wash buffer”. Results are depicted in “%Input over negative control”. (n=3). The results shown are the mean ± SD.
IP-p53 IP-IgG
IP-p53 IP-IgG 0
1 2 3
ChIP- qPCR
%Input over neg. ctrl miR92a
p21
✱ ✱
29
µg of reporter vector is used.
Figure 14. Luciferase Assay of electroporated iBACs. (A) shows the pre-experiment, where the different amounts of PsiCHECK2_Slc2a5_UTR_3 product were transfected, are noted below the graph. All samples were co-transfected with 1µM of miR92a or non-targeting sequence as a negative control. (B) shows 5µg of the PsiCHECK2 vector product, like in (A), repeated with 3 samples each. (C) depicts the same condition as (B), with 1.5µMof miR92a/ntc co-transfected with it.
Therefore, iBACs were electroporated with 5µg of PsiCHECK- vector. Nevertheless, subsequent luciferase assay showed no effect (Figure 14B). Additionally, increasing the amount of co-transfected miRNA mimic 92a from 1µM to 1.5µM (Figure 14C) did not result in reduction of the luciferase signal upon miRNA92a mimic co-transfection.
3.3.2. Optimization of miRNA92a mimic overexpression
To validate sufficient overexpression of miR92a in iBACs transfected with miR92a- mimics in Figure 14B, gene expression of miR92a after electroporation was analyzed.
qPCR revealed increased miR92a expression upon overexpression of miR92a mimic compared to electroporation with non-targeting sequence control.
30
miR92a mimic ntc 0
50 100 150 200
miR92a overexpression
Relative experssion level
Figure 15. qPCR of iBACs overexpressed with miR92a. Around 500 000 iBACs were electroporated with 5µg
PsiCHECK2_Scl2a5_UTR_3 vector and 1µM mimic miR92a or non-targeting sequence (ntc). The normalized ratio between miR92a mimic and ntc,expressed is 176,5 to 1, indicating successful transfection of miRNA.
Overall Figure 15 suggests successful overexpression of miR92a.
To test transfection efficiency of electroporated iBACs an EGFP vector instead of the generated PsiCHECK2 construct was transfected. Observation of electroporated cells under bright-field fluorescence microscopy revealed a transfection efficiency of less than 10% (Figure 16).
Taking the results together, low transfection efficiency could obscure binding of miR92a to Slc2a5, leading to inconsistent results.
Figure 16. Transfection efficiency of electroporated iBACs. Around 500 000 mature iBACs were electroporated in a 100µl solution containing 3µg of EGFP_LC3 vector. Under the bright- field fluorescence microscope, the bright spots shown represent the successful transfection in cells.
31
To improve transfection efficiency, cationic lipid transfection was done in HEK cells.
Three different conditions were examined according to “lipofectamine3000” protocol, on three different cell densities.
Figure 17. Examination of Transfection efficiency with Lipofectamine3000. 100 000 HEK 293 cells were seeded in the first row (A-C), 60 000 cells in the second (D-F) and 40 000 cells in the third (G-I), before transfection. EGFP_LC3 Plasmid vector was transfected with lipofectamine reagent at following ratios: The first column (A-G) was transfected with 1:1.25 [0.2µg:0.25µl], second column (B-H) 1:2 [0.2µg:0:4] and third column (C-I) with double the amount of the second column (B- H) [0.4µg:0.8µl].
Figure 17 depicts varying cell number and Lipofectamine 3000 ratios. We observed that with fewer cell numbers, transfection showed a trend of improved efficacy. Further improvement can be seen when increasing the DNA:reagent ratio to 1:2. However, by using twice the DNA and Lipofectamine3000 reagent amount as in Figure 17B, E and H, no apparent increase in transfection efficacy was observed. Another important observation under these conditions was the noticeable onset of cell death, as a marked decrease in cells adhering to the surface was observed under the microscope.
Ultimately, confirming the higher the amount Lipofectamine3000 reagent in relation to cell number the higher the toxicity (as mentioned in manufacturers protocol).
Nevertheless, lipofectamine used at the lowest ratio on the highest cell count (105 cells as shown in Figure 17A) showed the worst transfection efficiency with 30-40%. While every transfection of conditions using 40 000 and 60 000 cells, reached at least 70%
32
(but in general 90%) efficacy. Subsequently, the condition with the highest transfection efficiency and no recognizable cell death was: 1:1.25 DNA: reagent ratio in 40 000 HEK cells (as shown in Figure 17G, reaching 80-90%).
3.2.5. Luciferase Assay in HEK 293
To validate direct binding of miR92a to Slc2a5 3’UTR, luciferase assay was performed.
We found that the luciferase signal was markedly reduced when miR92a was overexpressed in HEK cells indicating that miR92a binds to Slc2a5 mRNA, leading to the degradation of Slc2a5 mRNA (see Figure below).
ntc miR92a 0.0
0.5 1.0 1.5
0.2µg PsiCHECK2 +1µM miR92a/ntc
RLU (normalized to Renilla) 0.0588
Figure 18. miR92a downregulating Slc2a5. Luciferase assay was performed in HEK 293 cells according to lipofectamine3000 manual. 40 000 cells were transfected with 1µM miR92a or non-targeting control sequence and 0.2µg
PsiCHECK2_Slc2a5_UTR_3 in a ratio 1:1.25 with lipofectamine reagent. n=5. Two-tailed unpaired Student’s t test was performed. The results shown are the mean ± SEM.
3.4. Fructose uptake and catabolism in brown adipocytes
As Slc2a5 is a known fructose transporter (Barone et al., 2009), we next compared iBACs incubated for 24 hours in maintenance medium containing 1.5 or 5 g/L fructose with a control sample without added fructose. Nuclear magnetic resonance (NMR) measurements detected increasing amounts of fructose intracellularly, positively correlated with the amount of supplemented fructose (Figure 19). Similar effects could be observed, when stimulating b-adrenergic signaling with Isoproterenol. No difference in fructose amount with and without isoproterenol (see Figure 19) was observed.
33
Figure 19. Intracellular fructose measurement of mature iBACs via Nuclear Magnetic Resonance (NMR) measurement.
iBACs were incubated for 24 hours in Maintenance Media containing 1.5g/L (1.5Fru) and 5g/L fructose(5Fru), whereas no fructose was added to the maintenance medium in the control. With the same of each conditions other samples were treated with 1µM isoproterenol (depicted “…_iso”) for 1 hour before harvesting.
Fructolysis feeds into the glycolysis pathway after aldolase converts fructos-1- phosphate into glyceraldehyde and DHAP (Heinz et al., 1968). Although both usually metabolize to glyceraldehyde-3-phosphate, DHAP has an alternative pathway generating glycerol in order to ultimately produce triglycerides (Heinz et al., 1968).
What is unknown is whether and under which conditions brown adipocytes utilize fructose for thermogenesis. Hence, the next experiment aims to examine fructose metabolization in iBACs.
