II. Zusammenfassung
1. Introduction
1.1. White-, Beige- & Brown Adipocytes
There are two different types of adipocytes: white- and thermogenic- adipocytes (brown and beige) (reviewed in (Kajimura et al., 2015)). While the primary function of the commonly known white adipocyte is storing energy in form of triglycerides (TG), thermogenic adipocytes generate heat by dissipating energy in the respiratory chain.
Morphologically, thermogenic and white adipocytes can be discriminated by the high number of mitochondria in thermogenic adipocytes, giving them their brownish appearance. The quantity of mitochondria is reflective of their capacity to generate heat. Additionally, thermogenic adipocytes have smaller, but more lipid droplets compared to their white counterpart. White adipose tissue (WAT) is the predominant adipose depot in volume and can be found in several locations throughout the body, whereas brown adipose tissue (BAT) can mainly be found in the intrascapular region (reviewed in (Kajimura et al., 2015)). Human and rodent BAT are morphologically and molecularly distinct (Aaron M Cypess et al., 2009). Human BAT depots can mainly be found in infants and drastically diminish in adult humans (A.M. Cypess et al., 2009).
Additionally, brown adipocytes in adult humans rather resembles beige adipocytes and are located in head and neck and mesenteric regions (Wu et al., 2012). Still, human BAT in adults highly contributes to overall energy expenditure and represents an attractive target for the treatment of metabolic disorders (as reviewed in (Dong et al., 2018)).
Figure 1. Morphological difference between different type of adipocytes. White adipocytes (left) have one large lipid droplet.
In contrast, beige and brown adipocytes show increased number of mitochondria and a high amount of small lipid droplets.
Figure from (Paul, 2018)
6 1.2. Non-shivering thermogenesis
The main morphological differences between white and thermogenic adipocytes correlate with the important function in non-shivering thermogenesis (NST) of the latter.
NST takes place in mitochondria by uncoupling the proton gradient to generate heat instead of adenosine triphosphate (ATP) (reviewed in (Kajimura et al., 2015)).
The linchpin protein of NST is uncoupling protein 1 (UCP1), which takes on the task of uncoupling the proton gradient (Nedergaard, 1977). Brown adipose depots are highly innervated (as reviewed in (Bartness & Ryu, 2015)) and vascularized (as reviewed in (Cedikova et al., 2016)) to sustain signal transduction via sympathetic neurons and a constant nutrient supply by the blood. Secondly, high vascularization of thermogenic adipocytes is important for rapid dissemination of the heat through the whole body (Chouchani et al., 2019).
Cold exposure leads to sympathetic activation, resulting in norepinephrine (NE) release from postsynaptic neurons (reviewed in (Reinisch et al., 2020)). NE binding to ß-adrenergic receptors in BAT leads to increased glucose uptake by inducing the transcription of genes encoding for glucose transporters (Dallner et al., 2006).
Simultaneously, intracellular cAMP levels increased through ß-adrenergic signaling activate PKA. PKA signaling ultimately leads to the transcription of Pgc1a (Cao et al., 2004) which initiates UCP1 expression (Puigserver et al., 1998). In addition, ß-adrenergic receptor signaling, induced by e.g. ß-ß-adrenergic agonists, cold exposure or exercise, leads to TG hydrolysis in BAT and WAT to release fatty acids for UCP1 activation and ultimately heat generation (as reviewed in (Blondin et al., 2020)).
Because thermogenic activity depends on high amounts of glucose uptake from the circulation, thermogenic adipocytes are also known as metabolic sinks (reviewed in Peirce & Vidal-Puig, 2013). Consequently, an increased BAT activity is associated with lower glycemia (Matsushita et al. 2014; Lee, Smith, et al. 2014) and an improved insulin sensitivity (Chondronikola et al., 2014). Additionally, high-caloric meals may lead to increased BAT activity to compensate for increased energy intake and maintain energy homeostasis (Rothwell, 1997).
7
1.3. Regulation of thermogenic adipocytes during fasting and cold
Since active BAT oxidizes high amounts of energy, NST is highly dependent on substrate availability (reviewed in (Reinisch et al., 2020)). Therefore, there should be counteractive measures to limit substrate uptake under situations of nutrient deprivation when energy needs to be directed to the brain. It was shown in studies using rodent models that one important regulatory node controlling BAT activity upon nutrient scarcity is the sympathetic nervous system (SNS) itself (reviewed in (Reinisch et al., 2020)).After two days of prolonged fasting, SNS activity was suppressed (Young and Landsberg, 1997 and as reviewed in (Reinisch et al., 2020)). Subsequently, NE turnover in BAT was reduced, resulting in diminishing ß-oxidation of TG and decreased substrate availability (Young et al., 1982). Mice fasted for 48 hours showed a reduced heart rate and oxygen consumption, indicating a reduced sympathetic outflow (Kimura et al., 2011), which corroborates aforementioned finding. Another study showed that upon hunger, secretion of hypothalamic neuropeptide Y (NPY) resulted in the activation of GABAergic neurons, in turn leading to decreased BAT temperature and downregulation of Ucp1 mRNA through suppression of the sympathetic tone (Nakamura et al., 2017; Shi et al., 2013). As proof of principle, knockout of NPY in mice led to elevated UCP1 expression, development of beige adipocytes, increased energy expenditure and thermogenic response to cold environment (Shi et al., 2013). In another study, challenging mild cold-stressed mice with prolonged fasting (48-72 hours) reduced BAT weight (Syamsunarno et al., 2014; Trayhurn & Jennings, 1988;
Zelewski & Swierczyński, 1990), accompanied with the decrease of other hallmarks of BAT activity like UCP1 protein levels (Desautels, 1985).
Interestingly, repetitive fasting protocols, like every other day fasting or intermittent fasting, did not change hallmarks of BAT activity. As example, expression of brown marker genes (Li et al., 2017) and glucose uptake capacity (Fabbiano et al., 2016) remained unchanged. These findings are in line with unaltered BAT weight, morphology and oxygen consumption of mild cold-stressed (25°C), short-term fasted mice (≤24 hours) (H. Ding et al., 2016).
Mice under severe cold stress (4°C), show a more pronounced competition between energy conservation upon fasting and the metabolic need of NST, to adapt to low temperature (reviewed in (Reinisch et al., 2020)). Short term cold stress (of 4°C for 4 hours) showed significant BAT weight reduction, as well as reduced lipid droplet and
8
intracellular TG contents indicating usage of intracellular FAs for heat generation (Syamsunarno et al., 2014). Furthermore, mRNA expression of genes involved in BAT activity was significantly reduced (Syamsunarno et al., 2014).
Taken together, FAs supply by WAT is sufficient for BAT activity upon short-term fasting (Shin et al., 2017). However, upon prolonged fasting and/or fasting with a simultaneous severe cold stress, BAT activity is reduced to save energy. In contrast, during periodic fasting, organisms seem to compensate for decreased food intake quickly in the refeeding phase, showing no or even improved changes in BAT morphology and function (Fabbiano et al., 2016; Li et al., 2017).
1.4 p53 in the regulation of brown adipocyte metabolism
p53 is the best described molecule in medical research (Dolgin, 2017), which is mainly due to its prominent function in tumor suppression and the fact that it is mutated in over 50% of human cancers (Magali et al., 2010). Recent studies emphasized an important role of p53 in metabolism and the function of p53 in brown adipocyte metabolism has been investigated in a few studies (Hallenborg et al., 2016; Irie et al., 1999; Molchadsky et al., 2013) but still lacks a consensus.
Zhao et. al showed that p53 is implied in a regulatory axis controlling BAT activity. They found that histone-methyltransferase KMT5c expression, which is induced through ß-adrenergic signaling cascade, leads to decreased Trp53 expression in brown adipocytes. Trp53 repression, in turn, leads to increased expression of thermogenic genes (Zhao et al., 2020). This is corroborated by several studies suggesting p53 as a positive regulator of brown adipocyte differentiation (as reviewed in (Lee et al., 2020)) and a negative regulator in thermogenic gene expression (like UCP1) (Al-Massadi et al., 2016; Hallenborg et al., 2016). Prdm16-overexpressing myogenic C2 cells for instance, showed the requirement of endogenous p53 levels for differentiation based on reduction of accumulated lipid droplet and lower expression of brown marker genes upon p53 knockdown (Molchadsky et al., 2013). Additionally, brown adipocyte-specific p53 overexpression in mice on a high-fat diet increased body weight gain, while BAT temperature and UCP1 protein expression were reduced (Al-Massadi et al., 2016), indicating p53 as a negative regulator for BAT activity. Mechanistically it is suggested that p53 mediates UCP1 repression by binding to Pgc1a (Hallenborg et al., 2016) and Prdm16 promoter in murine BAT (Molchadsky et al., 2013).
9
This data is in line with p53 stabilization as a fasting response, especially observable in epididymal WAT, liver, and skeletal muscle (Schupp et al., 2013). Consequently, increased p53 signaling upon fasting could be an important regulator of BAT activity.
1.5. miRNAs as important post-transcriptional regulators
Micro RNAs (miRNA) are small, non-coding, RNA molecules (approximately 20- 24 nucleotides) that have an important function in regulating gene expression (as reviewed in (O’Brien et al., 2018)). After being transcribed by Pol II and Pol III, Pri-miRNAs get processed and translocated form the nucleus to cytoplasm, where the now pre-miRNAs are further processed by DICER into mature miRNAs. miRNAs bind on the mRNA of target genes together with RISC complexes to complementary sequences, which are called seed sequences. By binding to mRNA, miRNAs inhibit mRNA translation or mediate their break down (as reviewed in (O’Brien et al., 2018)).
Over 60% of protein coding genes are predicted to be under the regulation of miRNAs (as reviewed in (Hermeking, 2012)). Since miRNAs are suggested to have evolved to effectively mediate with stress-responses (as reviewed in (Olejniczak et al., 2018)), there is a strong interconnection with p53 pathways. p53 is involved in processing precursor miRNA into mature miRNA and/or directly induces miRNA transcription (as reviewed in (Hermeking, 2012)).
Since p53 is suggested to only act as a transcription activator and not as a repressor (Fischer et al., 2014), p53`s effect on transcriptional repression might mainly be mediated indirectly via e.g. miRNAs. Furthermore, miRNAs that have been shown to be regulated by p53 contribute to various tumor suppressive effects, such as induction of cell cycle arrest, senescence, and apoptosis, as well as the inhibition of metastasis, angiogenesis, and glycolysis (as reviewed in (Hermeking, 2012)).
10 1.6. Preliminary data
Previous gene set enrichment analysis (GSEA) of transcriptome data and miRNA-seq analyses of mice that were fasted under mild cold-stress (22°C) showed p53 signaling as the most elevated pathway and miR92a the most induced miRNA in BAT. Recent findings of BAT-derived miR92a in serum also suggested this miRNA as a biomarker of BAT activity (Chen et al., 2016). Subsequent bioinformatic analysis predicted a potential binding site of p53 on the miR92a locus (Figure 2). Additionally, in vitro gain- and loss-of function experiments revealed a positive correlation between p53 and miR92a expression. This led to the hypothesis that p53 may directly induce miR92a expression transcription.
Furthermore, in silico analysis revealed several potential targets of miR92a, including several binding sites on the 3`UTR of the fructose transporter Slc2a5, which is the most downregulated gene upon fasting in the transcriptome data set. In vitro gain and loss of function studies reinforced an interaction between miR92a and Slc2a5. This led to
Mir92-1 locus P53 BS
Closest next p53 BS: ~8kB US
Figure 2. Bioinformatic analysis of miR92 locus. The miR92-1 locus can be seen in the middle (rectangle) and the potential p53 binding site is pointed at with the right arrow. The left arrow points at the next closest p53 binding site near the Mir92-1 locus, w which is around 8kb away.
11
the hypothesis that fructose may be used as an energy source by BAT which might be metabolized via glycolysis, thereby regulating BAT activity. In this model, p53 signaling upon nutrient deprivation would result in miR92a induction and in turn downregulation of fructose transporter Slc2a5 (as depicted in Figure 3) to curtail fructose catabolism in BAT under fasting.
1.7. Aim of this study
This work of this master thesis is aimed to validate direct interactions in the p53-miR92a-Slc2a5 axis. By using chromatin immunoprecipitation (ChIP), binding of p53 to the miR92a locus was examined. Moreover, using luciferase assays, the interaction between miR92a and Slc2a5 mRNA was studied. Furthermore, uptake and processing of fructose in immortalized brown adipocytes (iBACs) was examined by NMR and measurement extracellular acidification rate (ECAR).
Figure 3. Potential pathway in brown adipocytes. Upon external signals (like starvation or cold exposure) increased p53 expression leads to transcription of miR92a. As a result, miR92a binds to and downregulates Slc2a5 mRNA.
12
2. Materials & Methods
2.1. Cell lines & differentiation
Immortalized brown adipocytes (iBACs), a murine brown progenitor cell line, have been used as in vitro model. iBACs were maintained and differentiated according to a modified protocol from C.R. Kahn’s lab. In short: iBACs were cultivated in T75 flask (Nunc EasYFlask 75cm2 by Thermo Fisher Scientific) and can be transferred into Well plates if necessary. They were incubated at 37°C and 5% CO2 in “growth medium”.
After thawing, iBACs were passaged every other day for one week before experiments were conducted. Growth medium consisted of 10mM HEPES buffer (1M Gibco), 10%
FBS (HyClone) and 1% Penicillin/Streptomycin in Dulbecco´s Modified Eagle Medium-high glucose medium (DMEM, Gibco) containing 4.5 g/L-Glucose.
For differentiation, growth medium was changed to induction medium, consisting of 125 nM indomethacin, 500 nM Dexamethasone and 0.5 mM IBMX added to iBACs maintanance medium. All the substances mentioned above, are purchased from
“Sigma-Aldrich”.
After 2 days the induction medium was changed to maintenance Medium (MM). The maintenance medium consists of the iBACs growth medium with the addition of 10nM insulin and 1nM T3 (Sigma-Aldrich). Maintenance Medium was changed every other day.
Fully differentiated cells (after 7-9 days) were treated for 24 hours with 5µM Idasanutlin, a known p53 stabilizer (Q. Ding et al., 2013; Tovar et al., 2013), (by Cayman Chemicals), starved with starvation medium (10mM HEPES buffer (1M Gibco) in HBSS) or immediately harvested for ChIP.
HEK293 cell were cultivated in DMEM high Glucose with 10% FBS and 1%
Penicillin/Streptomycin.
2.2. RNA/miRNA isolation
For RNA isolation “ExtractMe: Kit for simultaneous isolation of RNA & DNA from animal tissue and cell culture, Cat. No. Em 09.1-250” was used according to its protocol.
The isolation of miRNAs of iBACs was done according to the protocol (“Norgen: Total RNA Purification Kit, Product # 17200, 37500, 17250, 17270”).
13 2.3. ChIP
2.3.1. Cross linking
Fully differentiated iBACs were crosslinked according to an established protocol (Prokesch et al., 2016) by adding “16% formaldehyde” (by pierce thermofisher scientific) to the flask. After 15 minutes, crosslinking was stopped by adding 2.5M glycine to a final concentration of 125mM for 5 minutes.
2.3.2. Sonification Analysis
To gain DNA fragments of about 100bp to 1000bp, different sonification cycles were tested by using the “Diogenode Bioruptor Pico”. The cells were resuspended in 1.5 ml hypotonic buffer (15-20 times the samples’s volume) and dounced 40 times. After checking the cell lysis under the microscope, the samples were pelleted at 3000xg at 4°C and washed twice with hypotonic buffer (20 mM HEPES/NaOH pH 7.5, 0.25 M Sucrose, 3 mM MgCl2, 0.2% NP-40, 3 mM 2-mercaptoethanol, 1mM PMSF, Complete protease inhibitor cocktail with 1 mM EDTA). Pelleted nuclei were resuspended in 400µl of lysis buffer and incubated on ice for 10 minutes.
100µl of solution containing nuclei were transferred to four “1.5 ml Bioruptor® Pico Microtubes with Caps”. Each Microtube was treated in the precooled Bioruptor by using following amount of sonication cycles: 5,10, 15 and 30. One cycle corresponds to 30sec ON/ 30sec OFF. 20µl of the sonicated samples were used for fragment size analysis. After transferring the 20µl into Eppendorf tubes, the samples were de-crosslinked using “Proteinase K (by Abion)” and DNA isolated using ExtractMe: Kit for simultaneous isolation of RNA & DNA from animal tissue and cell culture” according to protocol.
After measuring the DNA concentration of each sample with “NanoDrop® ND-1000 Spectrophotometer” by Peqlab, 0,5-1µg of DNA was diluted in 25µl ddH2O, 1X BlueJuice Loading buffer (Invitrogen by Thermo Fisher Scientific) was added per sample and loaded on a 1% Agarosegel without GelRed. Additionally, 100bp DNA ladder by New England Biolabs and/or “1 Kb Plus DNA Ladder” by Thermo Fisher Scientific were loaded. After approximately 50 minutes of electrophoresis by 95V, the gel was stained for at least 30 minutes with 50ml TAE buffer containing 20µl GelRed®
Nucleic Acid Gel Stain (Biotium). At last, it was analyzed with FluorChemQ (by Alpha Innotech).
14 2.3.4. ChIP
The sonicated samples (90µl each) were mixed with 910µl dilution buffer (50mM HEPES/NaOH pH 7.5, 155mM NaCl, 1.1% triton X-100, 0.11% Na-Deoxycholate, complete protease inhibitor cocktail with 1mM EDTA). An aliquot of 50µl was removed from the sample intended for IgG precipitation (for “5% Input Control”) and frozen at -80°C. Afterwards, 3.54µg of D2H9O antibody (cell signaling) was originally (see Figure 8) and afterwards 2,5 µg were added for one precipitation (if not noted otherwise).
Antibody/beads/sample mixture was incubated for 2 hours at 4°C on a rotator.
While the chromatin/antibody mix was incubating, clear DynabeadsTM Protein G (Invitrogen by Thermo Fisher Scientific) (20µl/ IP) were washed 3 times, in 5 times the volume of a blocking buffer (0.5% BSA in PBS). Afterwards, the beads were incubated in 5 times the volume of blocking buffer, until the incubation of the antibody/chromatin mixture was finished (1-2h). After reconstituting the original volume in blocking buffer, 20µl of the beads were added to the chromatin/antibody sample and incubated at 4°C on a rotator overnight.
The following day, the Antibody/chromatin/bead mixture was washed 6 times with 1 ml of wash buffer (5M NaCl, 0.5M EDTA [Titriplex® II] pH 7.8, 1M Tris pH 7.5, Ipegal, Triton X100, Protease Inhibitor Cocktail [PIC], [every substance mentioned from Sigma-Aldrich]) by using a magnetic rack at 4°C. Incubation time between each wash step was 3 minutes, including the last wash step with cold TE buffer (with addition of PIC).
In case of increasing wash stringency (see Figure 12), NaCl concentration in the wash buffer was increased to a final concentration of 500nM and beads were washed with it in the final wash step instead. Lowering the wash stringency (also Figure 12) was done by washing beads with wash buffer 3 times instead of 6 times.
After aspirating TE buffer, 100µl of the elution buffer (1M NaHCO3, 20% SDS, solved in ultrapure H2O) was added and after moderate vortexing placed on a thermo mixer for 40 minutes at room temperature and 1000rpm. Afterwards, the supernatant is collected in a 1.5 DNA LoBind tube by Eppendorf AG, followed by adding another 100µl to the beads and continuing the incubation for 15 minutes, after moderate vortexing the elution/bead mix.
200µl of the elution buffer was added to the input chromatin and processed the same way, starting with the addition of 8µl of 5M NaCl to 200µl of the supernatants. The samples were incubated at 65°C overnight.
15
The following day the chromatin was de-crosslinked by adding 1µl of RNase A, incubated at 37°C for 30 minutes and subsequently adding 4µl 0.5M EDTA pH 7.8, 1M Tris-HCl pH 6.8 and 1µl proteinase K (10µg/µl). The samples were incubated at 45°C for 2 hours.
2.3.5. qPCR
cDNA samples were diluted to a final concentration of 1ng/µl. 1.5µl cDNA, 3µl SyberGreen (Blue S’Green qPCR 2x Mix by Biozym”) and 1.5µl of the respective 8nM forward and revers primer solution was used for qPCR. The following primers were used:
Target Forward Primer Reverse Primer
mMir92a 3 TTGGGATTTGTCGCAATGCTG TCTGGTCACAATCCCCACCA
mp21-0,1kbv2 CTGTTGCCTCTCGGAGACC CCTGAAGGCCAGAAAGCTAGT
neg. contr. (NEW 3) 1
TGAGCACAGGAGAAAAGGCAA GCCTACCAAGACAAATGAGCAG
Table 1. Primer Sequences. Primer names (related to loci) depicted on the left. The designed primer sequences used for the ChIP-qPCR. The forward primers in the middle and the reverse primers on the right side of the table.
The following program was used for the amplification of cDNA (“BioRads CFX384 Touch Real-Time PCR Detection System”)
Method: Calc Lid: 95°C Volume: 6µl
1. 95°C, 5:00 2. 95°C, 0:05 3. 60°C, 0:30 4. Plateread 5. Goto 2, 39X 6. 60°C, 0:31 7. 60°C, 0:05
+0.5°C/cycle Ramp 0.5°C/s 8. 8.Plateread 9. 9. Goto 7, 70X
16 2.4. Luciferase Assay
2.4.1. Plasmid Construction
The cloned plasmid-construct was generated by using the PsiCHECK2 vector (Promega). Primers constructed for the insert were generated by using 50 extra bases upstream and downstream. Around 10 to 15 bases at the end of the sequence were used as forward and reverse primers, subsequently attaching Xho1 and Not1 to their ends as depicted below:
Slc2a5_UTR_3_fwd ttaCTCGAGCagagccaggcca Slc2a5_UTR_3_rev taGCGGCCGCttctatgtatgtaac
Backbone and insert were digested with Xho1 and Not1 HF (by New England BioLabs).
Figure 2 shows the complete vector- construct generated using SnapGene software.
2.4.2. Cloning Strategy Minipreparation of Psicheck2
The PsiCheck2 glycerol stock was cultivated overnight in autoclaved Terrific-Broth-Medium (Carl Roth GmbH + Co) containing 1:1000 ampicillin. Bacteria suspension was centrifuged at max. speed and resuspended according to manufacturer’s protocol.
“QIAprep Spin Miniprep Kit” by Qiagen the miniprep was completed.
Figure 4. Cloned PsiCHECK2_Slc2a5_3'UTR construct. Insert is depicted in red.
17 PCR amplification of Slc2a5_3’UTR
RNA samples isolated from murine BAT were diluted to 1µg DNA in 10µl ddH2O.
Afterwards, 1µl of OligoDt and random Primers (both by Invitrogen by Thermo Fisher Scientific) were added to the 10µl DNA solution. DNA mix was incubated at 65°C for 5 minutes and kept at 4°C in a thermocycler (ProFlex PCR System by Thermo Fisher Scientific”). 2µl Deoxynucleotide (dNTP) Solution Mix (by New England Biolabs), 4µl reaction buffer, 1µl Revert Aid reverse transcriptase and 1µl RiboLock RNase inhibitor (all by Thermo Fisher Scientific) were added to the mix. Reverse transcription was facilitated by incubating the sample in the thermocycler with following temperature program:
Temperature Incubation time
25°C 5min
42°C 1h
70°C 5min
4°C infinity
Table 2. Temperature program of reverse transcriptase transcribing RNA into cDNA.
After reverse transcription, 10µl of cDNA was combined with 23,5µl ddH2O, 10µl 5x q5 reaction buffer, 1µl dNTPs (both by New England Biolabs), 2,5 µl each of 10µM Slc2a5 forward and reverse primer, 0.5 µl Q5 Pol (by New England Biolabs).
Amplification of the 3´UTR of Slc2a5 was performed by the following temperature profile:
18
Slc2a5_UTR_3
denaturing 98°C 30s
annealing 98°C 20s
58°C 30s 35 cycles
58°C 30s 35 cycles