II. Zusammenfassung
1. Introduction
1.5. miRNAs as important post-transcriptional regulators
Micro RNAs (miRNA) are small, non-coding, RNA molecules (approximately 20- 24 nucleotides) that have an important function in regulating gene expression (as reviewed in (O’Brien et al., 2018)). After being transcribed by Pol II and Pol III, Pri-miRNAs get processed and translocated form the nucleus to cytoplasm, where the now pre-miRNAs are further processed by DICER into mature miRNAs. miRNAs bind on the mRNA of target genes together with RISC complexes to complementary sequences, which are called seed sequences. By binding to mRNA, miRNAs inhibit mRNA translation or mediate their break down (as reviewed in (O’Brien et al., 2018)).
Over 60% of protein coding genes are predicted to be under the regulation of miRNAs (as reviewed in (Hermeking, 2012)). Since miRNAs are suggested to have evolved to effectively mediate with stress-responses (as reviewed in (Olejniczak et al., 2018)), there is a strong interconnection with p53 pathways. p53 is involved in processing precursor miRNA into mature miRNA and/or directly induces miRNA transcription (as reviewed in (Hermeking, 2012)).
Since p53 is suggested to only act as a transcription activator and not as a repressor (Fischer et al., 2014), p53`s effect on transcriptional repression might mainly be mediated indirectly via e.g. miRNAs. Furthermore, miRNAs that have been shown to be regulated by p53 contribute to various tumor suppressive effects, such as induction of cell cycle arrest, senescence, and apoptosis, as well as the inhibition of metastasis, angiogenesis, and glycolysis (as reviewed in (Hermeking, 2012)).
10 1.6. Preliminary data
Previous gene set enrichment analysis (GSEA) of transcriptome data and miRNA-seq analyses of mice that were fasted under mild cold-stress (22°C) showed p53 signaling as the most elevated pathway and miR92a the most induced miRNA in BAT. Recent findings of BAT-derived miR92a in serum also suggested this miRNA as a biomarker of BAT activity (Chen et al., 2016). Subsequent bioinformatic analysis predicted a potential binding site of p53 on the miR92a locus (Figure 2). Additionally, in vitro gain- and loss-of function experiments revealed a positive correlation between p53 and miR92a expression. This led to the hypothesis that p53 may directly induce miR92a expression transcription.
Furthermore, in silico analysis revealed several potential targets of miR92a, including several binding sites on the 3`UTR of the fructose transporter Slc2a5, which is the most downregulated gene upon fasting in the transcriptome data set. In vitro gain and loss of function studies reinforced an interaction between miR92a and Slc2a5. This led to
Mir92-1 locus P53 BS
Closest next p53 BS: ~8kB US
Figure 2. Bioinformatic analysis of miR92 locus. The miR92-1 locus can be seen in the middle (rectangle) and the potential p53 binding site is pointed at with the right arrow. The left arrow points at the next closest p53 binding site near the Mir92-1 locus, w which is around 8kb away.
11
the hypothesis that fructose may be used as an energy source by BAT which might be metabolized via glycolysis, thereby regulating BAT activity. In this model, p53 signaling upon nutrient deprivation would result in miR92a induction and in turn downregulation of fructose transporter Slc2a5 (as depicted in Figure 3) to curtail fructose catabolism in BAT under fasting.
1.7. Aim of this study
This work of this master thesis is aimed to validate direct interactions in the p53-miR92a-Slc2a5 axis. By using chromatin immunoprecipitation (ChIP), binding of p53 to the miR92a locus was examined. Moreover, using luciferase assays, the interaction between miR92a and Slc2a5 mRNA was studied. Furthermore, uptake and processing of fructose in immortalized brown adipocytes (iBACs) was examined by NMR and measurement extracellular acidification rate (ECAR).
Figure 3. Potential pathway in brown adipocytes. Upon external signals (like starvation or cold exposure) increased p53 expression leads to transcription of miR92a. As a result, miR92a binds to and downregulates Slc2a5 mRNA.
12
2. Materials & Methods
2.1. Cell lines & differentiation
Immortalized brown adipocytes (iBACs), a murine brown progenitor cell line, have been used as in vitro model. iBACs were maintained and differentiated according to a modified protocol from C.R. Kahn’s lab. In short: iBACs were cultivated in T75 flask (Nunc EasYFlask 75cm2 by Thermo Fisher Scientific) and can be transferred into Well plates if necessary. They were incubated at 37°C and 5% CO2 in “growth medium”.
After thawing, iBACs were passaged every other day for one week before experiments were conducted. Growth medium consisted of 10mM HEPES buffer (1M Gibco), 10%
FBS (HyClone) and 1% Penicillin/Streptomycin in Dulbecco´s Modified Eagle Medium-high glucose medium (DMEM, Gibco) containing 4.5 g/L-Glucose.
For differentiation, growth medium was changed to induction medium, consisting of 125 nM indomethacin, 500 nM Dexamethasone and 0.5 mM IBMX added to iBACs maintanance medium. All the substances mentioned above, are purchased from
“Sigma-Aldrich”.
After 2 days the induction medium was changed to maintenance Medium (MM). The maintenance medium consists of the iBACs growth medium with the addition of 10nM insulin and 1nM T3 (Sigma-Aldrich). Maintenance Medium was changed every other day.
Fully differentiated cells (after 7-9 days) were treated for 24 hours with 5µM Idasanutlin, a known p53 stabilizer (Q. Ding et al., 2013; Tovar et al., 2013), (by Cayman Chemicals), starved with starvation medium (10mM HEPES buffer (1M Gibco) in HBSS) or immediately harvested for ChIP.
HEK293 cell were cultivated in DMEM high Glucose with 10% FBS and 1%
Penicillin/Streptomycin.
2.2. RNA/miRNA isolation
For RNA isolation “ExtractMe: Kit for simultaneous isolation of RNA & DNA from animal tissue and cell culture, Cat. No. Em 09.1-250” was used according to its protocol.
The isolation of miRNAs of iBACs was done according to the protocol (“Norgen: Total RNA Purification Kit, Product # 17200, 37500, 17250, 17270”).
13 2.3. ChIP
2.3.1. Cross linking
Fully differentiated iBACs were crosslinked according to an established protocol (Prokesch et al., 2016) by adding “16% formaldehyde” (by pierce thermofisher scientific) to the flask. After 15 minutes, crosslinking was stopped by adding 2.5M glycine to a final concentration of 125mM for 5 minutes.
2.3.2. Sonification Analysis
To gain DNA fragments of about 100bp to 1000bp, different sonification cycles were tested by using the “Diogenode Bioruptor Pico”. The cells were resuspended in 1.5 ml hypotonic buffer (15-20 times the samples’s volume) and dounced 40 times. After checking the cell lysis under the microscope, the samples were pelleted at 3000xg at 4°C and washed twice with hypotonic buffer (20 mM HEPES/NaOH pH 7.5, 0.25 M Sucrose, 3 mM MgCl2, 0.2% NP-40, 3 mM 2-mercaptoethanol, 1mM PMSF, Complete protease inhibitor cocktail with 1 mM EDTA). Pelleted nuclei were resuspended in 400µl of lysis buffer and incubated on ice for 10 minutes.
100µl of solution containing nuclei were transferred to four “1.5 ml Bioruptor® Pico Microtubes with Caps”. Each Microtube was treated in the precooled Bioruptor by using following amount of sonication cycles: 5,10, 15 and 30. One cycle corresponds to 30sec ON/ 30sec OFF. 20µl of the sonicated samples were used for fragment size analysis. After transferring the 20µl into Eppendorf tubes, the samples were de-crosslinked using “Proteinase K (by Abion)” and DNA isolated using ExtractMe: Kit for simultaneous isolation of RNA & DNA from animal tissue and cell culture” according to protocol.
After measuring the DNA concentration of each sample with “NanoDrop® ND-1000 Spectrophotometer” by Peqlab, 0,5-1µg of DNA was diluted in 25µl ddH2O, 1X BlueJuice Loading buffer (Invitrogen by Thermo Fisher Scientific) was added per sample and loaded on a 1% Agarosegel without GelRed. Additionally, 100bp DNA ladder by New England Biolabs and/or “1 Kb Plus DNA Ladder” by Thermo Fisher Scientific were loaded. After approximately 50 minutes of electrophoresis by 95V, the gel was stained for at least 30 minutes with 50ml TAE buffer containing 20µl GelRed®
Nucleic Acid Gel Stain (Biotium). At last, it was analyzed with FluorChemQ (by Alpha Innotech).
14 2.3.4. ChIP
The sonicated samples (90µl each) were mixed with 910µl dilution buffer (50mM HEPES/NaOH pH 7.5, 155mM NaCl, 1.1% triton X-100, 0.11% Na-Deoxycholate, complete protease inhibitor cocktail with 1mM EDTA). An aliquot of 50µl was removed from the sample intended for IgG precipitation (for “5% Input Control”) and frozen at -80°C. Afterwards, 3.54µg of D2H9O antibody (cell signaling) was originally (see Figure 8) and afterwards 2,5 µg were added for one precipitation (if not noted otherwise).
Antibody/beads/sample mixture was incubated for 2 hours at 4°C on a rotator.
While the chromatin/antibody mix was incubating, clear DynabeadsTM Protein G (Invitrogen by Thermo Fisher Scientific) (20µl/ IP) were washed 3 times, in 5 times the volume of a blocking buffer (0.5% BSA in PBS). Afterwards, the beads were incubated in 5 times the volume of blocking buffer, until the incubation of the antibody/chromatin mixture was finished (1-2h). After reconstituting the original volume in blocking buffer, 20µl of the beads were added to the chromatin/antibody sample and incubated at 4°C on a rotator overnight.
The following day, the Antibody/chromatin/bead mixture was washed 6 times with 1 ml of wash buffer (5M NaCl, 0.5M EDTA [Titriplex® II] pH 7.8, 1M Tris pH 7.5, Ipegal, Triton X100, Protease Inhibitor Cocktail [PIC], [every substance mentioned from Sigma-Aldrich]) by using a magnetic rack at 4°C. Incubation time between each wash step was 3 minutes, including the last wash step with cold TE buffer (with addition of PIC).
In case of increasing wash stringency (see Figure 12), NaCl concentration in the wash buffer was increased to a final concentration of 500nM and beads were washed with it in the final wash step instead. Lowering the wash stringency (also Figure 12) was done by washing beads with wash buffer 3 times instead of 6 times.
After aspirating TE buffer, 100µl of the elution buffer (1M NaHCO3, 20% SDS, solved in ultrapure H2O) was added and after moderate vortexing placed on a thermo mixer for 40 minutes at room temperature and 1000rpm. Afterwards, the supernatant is collected in a 1.5 DNA LoBind tube by Eppendorf AG, followed by adding another 100µl to the beads and continuing the incubation for 15 minutes, after moderate vortexing the elution/bead mix.
200µl of the elution buffer was added to the input chromatin and processed the same way, starting with the addition of 8µl of 5M NaCl to 200µl of the supernatants. The samples were incubated at 65°C overnight.
15
The following day the chromatin was de-crosslinked by adding 1µl of RNase A, incubated at 37°C for 30 minutes and subsequently adding 4µl 0.5M EDTA pH 7.8, 1M Tris-HCl pH 6.8 and 1µl proteinase K (10µg/µl). The samples were incubated at 45°C for 2 hours.
2.3.5. qPCR
cDNA samples were diluted to a final concentration of 1ng/µl. 1.5µl cDNA, 3µl SyberGreen (Blue S’Green qPCR 2x Mix by Biozym”) and 1.5µl of the respective 8nM forward and revers primer solution was used for qPCR. The following primers were used:
Target Forward Primer Reverse Primer
mMir92a 3 TTGGGATTTGTCGCAATGCTG TCTGGTCACAATCCCCACCA
mp21-0,1kbv2 CTGTTGCCTCTCGGAGACC CCTGAAGGCCAGAAAGCTAGT
neg. contr. (NEW 3) 1
TGAGCACAGGAGAAAAGGCAA GCCTACCAAGACAAATGAGCAG
Table 1. Primer Sequences. Primer names (related to loci) depicted on the left. The designed primer sequences used for the ChIP-qPCR. The forward primers in the middle and the reverse primers on the right side of the table.
The following program was used for the amplification of cDNA (“BioRads CFX384 Touch Real-Time PCR Detection System”)
Method: Calc Lid: 95°C Volume: 6µl
1. 95°C, 5:00 2. 95°C, 0:05 3. 60°C, 0:30 4. Plateread 5. Goto 2, 39X 6. 60°C, 0:31 7. 60°C, 0:05
+0.5°C/cycle Ramp 0.5°C/s 8. 8.Plateread 9. 9. Goto 7, 70X
16 2.4. Luciferase Assay
2.4.1. Plasmid Construction
The cloned plasmid-construct was generated by using the PsiCHECK2 vector (Promega). Primers constructed for the insert were generated by using 50 extra bases upstream and downstream. Around 10 to 15 bases at the end of the sequence were used as forward and reverse primers, subsequently attaching Xho1 and Not1 to their ends as depicted below:
Slc2a5_UTR_3_fwd ttaCTCGAGCagagccaggcca Slc2a5_UTR_3_rev taGCGGCCGCttctatgtatgtaac
Backbone and insert were digested with Xho1 and Not1 HF (by New England BioLabs).
Figure 2 shows the complete vector- construct generated using SnapGene software.
2.4.2. Cloning Strategy Minipreparation of Psicheck2
The PsiCheck2 glycerol stock was cultivated overnight in autoclaved Terrific-Broth-Medium (Carl Roth GmbH + Co) containing 1:1000 ampicillin. Bacteria suspension was centrifuged at max. speed and resuspended according to manufacturer’s protocol.
“QIAprep Spin Miniprep Kit” by Qiagen the miniprep was completed.
Figure 4. Cloned PsiCHECK2_Slc2a5_3'UTR construct. Insert is depicted in red.
17 PCR amplification of Slc2a5_3’UTR
RNA samples isolated from murine BAT were diluted to 1µg DNA in 10µl ddH2O.
Afterwards, 1µl of OligoDt and random Primers (both by Invitrogen by Thermo Fisher Scientific) were added to the 10µl DNA solution. DNA mix was incubated at 65°C for 5 minutes and kept at 4°C in a thermocycler (ProFlex PCR System by Thermo Fisher Scientific”). 2µl Deoxynucleotide (dNTP) Solution Mix (by New England Biolabs), 4µl reaction buffer, 1µl Revert Aid reverse transcriptase and 1µl RiboLock RNase inhibitor (all by Thermo Fisher Scientific) were added to the mix. Reverse transcription was facilitated by incubating the sample in the thermocycler with following temperature program:
Temperature Incubation time
25°C 5min
42°C 1h
70°C 5min
4°C infinity
Table 2. Temperature program of reverse transcriptase transcribing RNA into cDNA.
After reverse transcription, 10µl of cDNA was combined with 23,5µl ddH2O, 10µl 5x q5 reaction buffer, 1µl dNTPs (both by New England Biolabs), 2,5 µl each of 10µM Slc2a5 forward and reverse primer, 0.5 µl Q5 Pol (by New England Biolabs).
Amplification of the 3´UTR of Slc2a5 was performed by the following temperature profile:
18
Slc2a5_UTR_3
denaturing 98°C 30s
annealing 98°C 20s
58°C 30s 35 cycles
72°C 2min
final extension 72°C 2min
4°C infinite
Table 3. Temperature program of Slc2a5_UTR_3 PCR
Restriction digestion & Ligation
Amplificated Slc2a5_UTR_3 and PsiCheck2 vector (both 1µg) were cut with 1µl of restriction enzyme Xho1 and Not1-HF (by New England BioLabs Inc). Cutsmart buffer (1x, by New England BioLabs Inc), was added to Insert and PsiCheck2, before incubating the samples for one hour at 37°C Alkaline Phosphatase. Afterwards, Calf Intestinal phosphatase (CIP) (by New England Biolabs) was added to the PsiCheck2 mix.
A gel electrophoretic separation was done in a 1% Agarosegel at 92V for 1h. Bands of the size of around 1080 bp, were cut out and purified via “MinElute“ by Qiagen.
Ligation of insert and backbone were done according to following mixture: 3.48µl of the PsiCheck2 vector, 3.66µl Slc2a5_UTR_3 insert, 2µl T4 Ligation Buffer by New England Biolabs, 9.86µl ddH2O and 1µl Ligase by New England Biolabs. This mixture was incubated for 20 minutes at room temperature.
Escherichia coli Transformation
According to “NEB 5-alpha competent E. coli (high efficiency)” protocol by New England Biolabs, E. coli was transformed with 0.22µl PsiCheck2 vector (from 137.6ng/µl stock solution) as positive control, 5µl water as negative control and 5µl of
19
the PsiCheck2 containing the Slc2a5 insert. Transformed E. coli were plated on an agar plate with 1:1000 ampicillin and incubate overnight at 37°C.
Colony PCR
Colony PCR was done for 13 transformed PsiCheck_Slc2a5 colonies. A pipette tip with the respective colony was dipped each in one 20µl PCR reaction solution containing:
4µl 5x q5 reaction buffer, 0.4µl dNTPs, 1µl 10µM fwd and rev Primer each, 2µl Q5 Polymerase and 13,4 µl ddH2O. The same temperature cycle was used as before (see
“PCR amplification of Slc2a5_3’UTR” above) with 40 cycles. The amplicons were analyzed by 1% agarose gel electrophoresis. Miniprep was made of the positive band signals with subsequent restriction digestion as stated before. Positive signals were sent to sequencing with Slc2a5 primers.
Midipreparation
Isolation of the DNA- construct from the clones was made according to “Plasmid Midiprep kit” by ExtractMe. Overnight culture in 100ml of “Terrific-Broth-Medium by Carl Roth GmbH + Co” containing 5ug/ml ampicillin was made of the respective clones and incubated overnight.
2.4.3. Mmu-miR-92a- 1-5p Overexpression
Isolated miRNA (“see: 2.2. RNA/miRNA isolation”) of electroporated iBACs (see: 2.4.4) was transcribed to cDNA using “miRCURY® LNA® RT Kit” and further processed according “miRCURY LNA miRNA PCR Assay” protocol.
2.4.4. Luciferase Assay in iBACs
Fully differentiated iBACs were detached from a 6 well plate with Collagenase P-Trypsin solution (0.5mg/ml Collagenase P and 0.25% trypsin in PBS by Gibco). Around 500 000 Cells were electroporated with 1-,3- and/or 5µg PsiCheck2_Slc2a5 DNA construct and 1-1.5µl (1µM-1.5µM) “miRNA 92a mimic”/ “miRNA negative control” in a final volume of 100µl. As transfection control, 3µg of EGFP_LC3 vector was used.
Electroporation parameters of “Neon Transfection System by Invitrogen by life science”
were: “1300V”, “width:10” and “pulse: 2”. 100µl containing around 500k electroporated cells were seeded in collagen-coated plates (48 well). After one day of incubation in antibiotic-free maintenance medium, the medium was changed to normal maintenance medium and incubated for another day. The Luciferase assay was performed according to the manufactures instructions (“Dual-Luciferase®Reporter Assay
20
System”). In detail, after washing the cells twice with PBS, they were treated with 30µl of “1xPLB”. Thereafter, the plate was incubated at room temperature on a moderately spinning shaker for 45 minutes. The cells were detached by a cell scraper, mixed by pipetting up and down 60 times and transferred in a well of a 96 well plate.
Substrate and luciferase solution were prepared according to manufacturer’s protocol before luciferase signal was analyzed by “CLARIOstar Plus” by BMG Labtech. The device was set to measure luminescence of luciferase first, corresponding to emission measurement of 600nm, starting from 2.5s to 28.24s. Subsequently, Renilla emission was measured at 450nm, starting from 31.5s to 57.24s. In detail, 100µl of “LAR II” was injected first, followed by 100µl of “stop&glo” substrate.
2.4.5. Luciferase assay in HEK cells
HEK cells were transfected according to manufacturer’s protocol with 1.25µl
“Lipofectamine3000 Reagent”, 1µl (1µM) “miRNA 92a mimic”/ “miRNA negative control” by dharmacon in 40 000 cells in a collagen coated 48 well plate. Preparation and measurement of luciferase assay was according to the protocol in 2.4.3 Luciferase Assay in iBACs. Transfection efficiency was estimated by GFP signal and monitored after 1-2 days with “Nikon’s Eclipse TE 2000-U” microscope.
2.5. NMR
Mature iBACs were treated with 1.5g/L-fructose, 5g/L-fructose or control maintenance media. Thermogenesis was stimulated with 1µM isoproterenol for 1 hour. The cells were harvested according to a previously published protocol (Stekovic et al., 2019).
2.6 Seahorse: ECAR measurement
Mature iBACs were seeded in a Seahorse XF 96 culture microplate.
iBACs were cultivated in maintenance medium. Extracellular acidification rate (ECAR) was analyzed according to manufacturer’s protocol (Seahorse XFe96 Analyzer by Agilent). 27mM glucose or 25mM fructose was acutely injected following measurement of basal ECAR. After ECAR measurement BCA assay for protein quantification was done on well-plates to normalize the results.
21
3. Results
3.1. Establishment of a p53 ChIP protocol in mature brown adipocytes 3.1.1. Optimization of DNA shearing
To generate DNA fragments with a peak centered around ~300bp, different numbers of sonification cycles were applied to crosslinked DNA, as described in “2.3.2 Sonication analysis”. Subsequently, fragment length was analyzed by agarose gel electrophoresis as shown below.
Figure 5. Gelectrophoresis of fragmented iBACs DNA cultivated in maintenance media. Crosslinked iBACs samples were sonicated in Eppendorf tubes (A) or Bioruptor tubes (B). Used cycle numbers of sonication are noted above each lane. DNA ladder was loaded on the left slot. Base pairs are noted on the left side.
Using Bioruptor tubes (Figure 5B) instead of standard eppendorf tubes (Figure 5A) substantially improved DNA fragmentation by sonification, subsequently leading to smaller fragment sizes upon less sonification cycles. Ten cycles seemed to be the optimal cycle number leading to a DNA fragment size of less than 500bp when using Bioruptor tubes. Additional increase in cycle number does not show further recognizable size reduction and might lead to interference of protein binding to the DNA.
3.1.2. Optimization of cell lysis for ChIP assay
To optimize plasma membrane lysis and improve overall yield of crosslinked DNA-p53 material, an optional sonification step can be included after douncing (Prokesch et al., 2016). Since excessive sonication can lead to an interference of protein binding to DNA, the effectiveness of an additional sonification step was tested Therefore, four
22
protocols were performed without and with five sonication cycles at two different times during processing, respectively, to investigate whether an effect on the overall yield could be observed. Sonication to lyse the plasma membrane and sonication to fragment DNA were analyzed by agarose gel electrophoresis in the following combination (Figure 6): Un-sonicated for lysis and fragmentation; un-sonicated for lysis and sonicated for fragmentation; sonicated for lysis and un-sonicated for fragmentation; sonicated for lysis and fragmentation. Five cycles of sonication were used for lysis and/or DNA - fragmentation. No significant increase in yield could be observed in the amount of isolated DNA (L-/F+: 58ng/µl and L+/F+: 70ng/µl) and the fragment size was not reduced as seen in Figure 6.
Figure 6. Lysis efficiency was analyzed according to fragment length by running the DNA on a 1% agarose gel. Five cycles of sonication were used after douncing crosslinked iBACs (L+) to enhance plasma membrane lysis and/or after nuclei lysis to fragment DNA material (F+). By omitting sonication cycles (“L-“ or “F-“) different protocols were used to determine lysis efficiency.
23 3.2. Adjusting the ChIP protocol
Next, ChIP-qPCR was used to amplify chromatin derived from immunoprecipitation with p53 antibody. P21, a well described target gene of p53 (Benson et al., 2013), has been used as control locus. The locus for miR92a was our locus of interest, as we previously identified a potential interaction of p53 with miR92a. Primer pairs for negative controls have been designed at loci that are several kbs distant of p53 binding sides.
Using Eppendorf tubes with the highest number of sonification cycles (shown in Figure
Using Eppendorf tubes with the highest number of sonification cycles (shown in Figure