RNA/miRNA isolation

For RNA isolation “ExtractMe: Kit for simultaneous isolation of RNA & DNA from animal tissue and cell culture, Cat. No. Em 09.1-250” was used according to its protocol.

The isolation of miRNAs of iBACs was done according to the protocol (“Norgen: Total RNA Purification Kit, Product # 17200, 37500, 17250, 17270”).

13 2.3. ChIP

2.3.1. Cross linking

Fully differentiated iBACs were crosslinked according to an established protocol (Prokesch et al., 2016) by adding “16% formaldehyde” (by pierce thermofisher scientific) to the flask. After 15 minutes, crosslinking was stopped by adding 2.5M glycine to a final concentration of 125mM for 5 minutes.

2.3.2. Sonification Analysis

To gain DNA fragments of about 100bp to 1000bp, different sonification cycles were tested by using the “Diogenode Bioruptor Pico”. The cells were resuspended in 1.5 ml hypotonic buffer (15-20 times the samples’s volume) and dounced 40 times. After checking the cell lysis under the microscope, the samples were pelleted at 3000xg at 4°C and washed twice with hypotonic buffer (20 mM HEPES/NaOH pH 7.5, 0.25 M Sucrose, 3 mM MgCl2, 0.2% NP-40, 3 mM 2-mercaptoethanol, 1mM PMSF, Complete protease inhibitor cocktail with 1 mM EDTA). Pelleted nuclei were resuspended in 400µl of lysis buffer and incubated on ice for 10 minutes.

100µl of solution containing nuclei were transferred to four “1.5 ml Bioruptor® Pico Microtubes with Caps”. Each Microtube was treated in the precooled Bioruptor by using following amount of sonication cycles: 5,10, 15 and 30. One cycle corresponds to 30sec ON/ 30sec OFF. 20µl of the sonicated samples were used for fragment size analysis. After transferring the 20µl into Eppendorf tubes, the samples were de-crosslinked using “Proteinase K (by Abion)” and DNA isolated using ExtractMe: Kit for simultaneous isolation of RNA & DNA from animal tissue and cell culture” according to protocol.

After measuring the DNA concentration of each sample with “NanoDrop® ND-1000 Spectrophotometer” by Peqlab, 0,5-1µg of DNA was diluted in 25µl ddH2O, 1X BlueJuice Loading buffer (Invitrogen by Thermo Fisher Scientific) was added per sample and loaded on a 1% Agarosegel without GelRed. Additionally, 100bp DNA ladder by New England Biolabs and/or “1 Kb Plus DNA Ladder” by Thermo Fisher Scientific were loaded. After approximately 50 minutes of electrophoresis by 95V, the gel was stained for at least 30 minutes with 50ml TAE buffer containing 20µl GelRed®

Nucleic Acid Gel Stain (Biotium). At last, it was analyzed with FluorChemQ (by Alpha Innotech).

14 2.3.4. ChIP

The sonicated samples (90µl each) were mixed with 910µl dilution buffer (50mM HEPES/NaOH pH 7.5, 155mM NaCl, 1.1% triton X-100, 0.11% Na-Deoxycholate, complete protease inhibitor cocktail with 1mM EDTA). An aliquot of 50µl was removed from the sample intended for IgG precipitation (for “5% Input Control”) and frozen at -80°C. Afterwards, 3.54µg of D2H9O antibody (cell signaling) was originally (see Figure 8) and afterwards 2,5 µg were added for one precipitation (if not noted otherwise).

Antibody/beads/sample mixture was incubated for 2 hours at 4°C on a rotator.

While the chromatin/antibody mix was incubating, clear DynabeadsTM Protein G (Invitrogen by Thermo Fisher Scientific) (20µl/ IP) were washed 3 times, in 5 times the volume of a blocking buffer (0.5% BSA in PBS). Afterwards, the beads were incubated in 5 times the volume of blocking buffer, until the incubation of the antibody/chromatin mixture was finished (1-2h). After reconstituting the original volume in blocking buffer, 20µl of the beads were added to the chromatin/antibody sample and incubated at 4°C on a rotator overnight.

The following day, the Antibody/chromatin/bead mixture was washed 6 times with 1 ml of wash buffer (5M NaCl, 0.5M EDTA [Titriplex® II] pH 7.8, 1M Tris pH 7.5, Ipegal, Triton X100, Protease Inhibitor Cocktail [PIC], [every substance mentioned from Sigma-Aldrich]) by using a magnetic rack at 4°C. Incubation time between each wash step was 3 minutes, including the last wash step with cold TE buffer (with addition of PIC).

In case of increasing wash stringency (see Figure 12), NaCl concentration in the wash buffer was increased to a final concentration of 500nM and beads were washed with it in the final wash step instead. Lowering the wash stringency (also Figure 12) was done by washing beads with wash buffer 3 times instead of 6 times.

After aspirating TE buffer, 100µl of the elution buffer (1M NaHCO3, 20% SDS, solved in ultrapure H²O) was added and after moderate vortexing placed on a thermo mixer for 40 minutes at room temperature and 1000rpm. Afterwards, the supernatant is collected in a 1.5 DNA LoBind tube by Eppendorf AG, followed by adding another 100µl to the beads and continuing the incubation for 15 minutes, after moderate vortexing the elution/bead mix.

200µl of the elution buffer was added to the input chromatin and processed the same way, starting with the addition of 8µl of 5M NaCl to 200µl of the supernatants. The samples were incubated at 65°C overnight.

15

The following day the chromatin was de-crosslinked by adding 1µl of RNase A, incubated at 37°C for 30 minutes and subsequently adding 4µl 0.5M EDTA pH 7.8, 1M Tris-HCl pH 6.8 and 1µl proteinase K (10µg/µl). The samples were incubated at 45°C for 2 hours.

2.3.5. qPCR

cDNA samples were diluted to a final concentration of 1ng/µl. 1.5µl cDNA, 3µl SyberGreen (Blue S’Green qPCR 2x Mix by Biozym”) and 1.5µl of the respective 8nM forward and revers primer solution was used for qPCR. The following primers were used:

Target Forward Primer Reverse Primer

mMir92a 3 TTGGGATTTGTCGCAATGCTG TCTGGTCACAATCCCCACCA

mp21-0,1kbv2 CTGTTGCCTCTCGGAGACC CCTGAAGGCCAGAAAGCTAGT

neg. contr. (NEW 3) 1

TGAGCACAGGAGAAAAGGCAA GCCTACCAAGACAAATGAGCAG

Table 1. Primer Sequences. Primer names (related to loci) depicted on the left. The designed primer sequences used for the ChIP-qPCR. The forward primers in the middle and the reverse primers on the right side of the table.

The following program was used for the amplification of cDNA (“BioRads CFX384 Touch Real-Time PCR Detection System”)

Method: Calc Lid: 95°C Volume: 6µl

1. 95°C, 5:00 2. 95°C, 0:05 3. 60°C, 0:30 4. Plateread 5. Goto 2, 39X 6. 60°C, 0:31 7. 60°C, 0:05

+0.5°C/cycle Ramp 0.5°C/s 8. 8.Plateread 9. 9. Goto 7, 70X

16 2.4. Luciferase Assay

2.4.1. Plasmid Construction

The cloned plasmid-construct was generated by using the PsiCHECK2 vector (Promega). Primers constructed for the insert were generated by using 50 extra bases upstream and downstream. Around 10 to 15 bases at the end of the sequence were used as forward and reverse primers, subsequently attaching Xho1 and Not1 to their ends as depicted below:

Slc2a5_UTR_3_fwd ttaCTCGAGCagagccaggcca Slc2a5_UTR_3_rev taGCGGCCGCttctatgtatgtaac

Backbone and insert were digested with Xho1 and Not1 HF (by New England BioLabs).

Figure 2 shows the complete vector- construct generated using SnapGene software.

2.4.2. Cloning Strategy Minipreparation of Psicheck2

The PsiCheck2 glycerol stock was cultivated overnight in autoclaved Terrific-Broth-Medium (Carl Roth GmbH + Co) containing 1:1000 ampicillin. Bacteria suspension was centrifuged at max. speed and resuspended according to manufacturer’s protocol.

“QIAprep Spin Miniprep Kit” by Qiagen the miniprep was completed.

Figure 4. Cloned PsiCHECK2_Slc2a5_3'UTR construct. Insert is depicted in red.

17 PCR amplification of Slc2a5_3’UTR

RNA samples isolated from murine BAT were diluted to 1µg DNA in 10µl ddH2O.

Afterwards, 1µl of OligoDt and random Primers (both by Invitrogen by Thermo Fisher Scientific) were added to the 10µl DNA solution. DNA mix was incubated at 65°C for 5 minutes and kept at 4°C in a thermocycler (ProFlex PCR System by Thermo Fisher Scientific”). 2µl Deoxynucleotide (dNTP) Solution Mix (by New England Biolabs), 4µl reaction buffer, 1µl Revert Aid reverse transcriptase and 1µl RiboLock RNase inhibitor (all by Thermo Fisher Scientific) were added to the mix. Reverse transcription was facilitated by incubating the sample in the thermocycler with following temperature program:

Temperature Incubation time

25°C 5min

42°C 1h

70°C 5min

4°C infinity

Table 2. Temperature program of reverse transcriptase transcribing RNA into cDNA.

After reverse transcription, 10µl of cDNA was combined with 23,5µl ddH2O, 10µl 5x q5 reaction buffer, 1µl dNTPs (both by New England Biolabs), 2,5 µl each of 10µM Slc2a5 forward and reverse primer, 0.5 µl Q5 Pol (by New England Biolabs).

Amplification of the 3´UTR of Slc2a5 was performed by the following temperature profile:

18

Slc2a5_UTR_3

denaturing 98°C 30s

annealing 98°C 20s

58°C 30s 35 cycles

72°C 2min

final extension 72°C 2min

4°C infinite

Table 3. Temperature program of Slc2a5_UTR_3 PCR

Restriction digestion & Ligation

Amplificated Slc2a5_UTR_3 and PsiCheck2 vector (both 1µg) were cut with 1µl of restriction enzyme Xho1 and Not1-HF (by New England BioLabs Inc). Cutsmart buffer (1x, by New England BioLabs Inc), was added to Insert and PsiCheck2, before incubating the samples for one hour at 37°C Alkaline Phosphatase. Afterwards, Calf Intestinal phosphatase (CIP) (by New England Biolabs) was added to the PsiCheck2 mix.

A gel electrophoretic separation was done in a 1% Agarosegel at 92V for 1h. Bands of the size of around 1080 bp, were cut out and purified via “MinElute“ by Qiagen.

Ligation of insert and backbone were done according to following mixture: 3.48µl of the PsiCheck2 vector, 3.66µl Slc2a5_UTR_3 insert, 2µl T4 Ligation Buffer by New England Biolabs, 9.86µl ddH2O and 1µl Ligase by New England Biolabs. This mixture was incubated for 20 minutes at room temperature.

Escherichia coli Transformation

According to “NEB 5-alpha competent E. coli (high efficiency)” protocol by New England Biolabs, E. coli was transformed with 0.22µl PsiCheck2 vector (from 137.6ng/µl stock solution) as positive control, 5µl water as negative control and 5µl of

19

the PsiCheck2 containing the Slc2a5 insert. Transformed E. coli were plated on an agar plate with 1:1000 ampicillin and incubate overnight at 37°C.

Colony PCR

Colony PCR was done for 13 transformed PsiCheck_Slc2a5 colonies. A pipette tip with the respective colony was dipped each in one 20µl PCR reaction solution containing:

4µl 5x q5 reaction buffer, 0.4µl dNTPs, 1µl 10µM fwd and rev Primer each, 2µl Q5 Polymerase and 13,4 µl ddH2O. The same temperature cycle was used as before (see

“PCR amplification of Slc2a5_3’UTR” above) with 40 cycles. The amplicons were analyzed by 1% agarose gel electrophoresis. Miniprep was made of the positive band signals with subsequent restriction digestion as stated before. Positive signals were sent to sequencing with Slc2a5 primers.

Midipreparation

Isolation of the DNA- construct from the clones was made according to “Plasmid Midiprep kit” by ExtractMe. Overnight culture in 100ml of “Terrific-Broth-Medium by Carl Roth GmbH + Co” containing 5ug/ml ampicillin was made of the respective clones and incubated overnight.

2.4.3. Mmu-miR-92a- 1-5p Overexpression

Isolated miRNA (“see: 2.2. RNA/miRNA isolation”) of electroporated iBACs (see: 2.4.4) was transcribed to cDNA using “miRCURY® LNA® RT Kit” and further processed according “miRCURY LNA miRNA PCR Assay” protocol.

2.4.4. Luciferase Assay in iBACs

Fully differentiated iBACs were detached from a 6 well plate with Collagenase P-Trypsin solution (0.5mg/ml Collagenase P and 0.25% trypsin in PBS by Gibco). Around 500 000 Cells were electroporated with 1-,3- and/or 5µg PsiCheck2_Slc2a5 DNA construct and 1-1.5µl (1µM-1.5µM) “miRNA 92a mimic”/ “miRNA negative control” in a final volume of 100µl. As transfection control, 3µg of EGFP_LC3 vector was used.

Electroporation parameters of “Neon Transfection System by Invitrogen by life science”

were: “1300V”, “width:10” and “pulse: 2”. 100µl containing around 500k electroporated cells were seeded in collagen-coated plates (48 well). After one day of incubation in antibiotic-free maintenance medium, the medium was changed to normal maintenance medium and incubated for another day. The Luciferase assay was performed according to the manufactures instructions (“Dual-Luciferase®Reporter Assay

20

System”). In detail, after washing the cells twice with PBS, they were treated with 30µl of “1xPLB”. Thereafter, the plate was incubated at room temperature on a moderately spinning shaker for 45 minutes. The cells were detached by a cell scraper, mixed by pipetting up and down 60 times and transferred in a well of a 96 well plate.

Substrate and luciferase solution were prepared according to manufacturer’s protocol before luciferase signal was analyzed by “CLARIOstar Plus” by BMG Labtech. The device was set to measure luminescence of luciferase first, corresponding to emission measurement of 600nm, starting from 2.5s to 28.24s. Subsequently, Renilla emission was measured at 450nm, starting from 31.5s to 57.24s. In detail, 100µl of “LAR II” was injected first, followed by 100µl of “stop&glo” substrate.

2.4.5. Luciferase assay in HEK cells

HEK cells were transfected according to manufacturer’s protocol with 1.25µl

“Lipofectamine3000 Reagent”, 1µl (1µM) “miRNA 92a mimic”/ “miRNA negative control” by dharmacon in 40 000 cells in a collagen coated 48 well plate. Preparation and measurement of luciferase assay was according to the protocol in 2.4.3 Luciferase Assay in iBACs. Transfection efficiency was estimated by GFP signal and monitored after 1-2 days with “Nikon’s Eclipse TE 2000-U” microscope.

2.5. NMR

Mature iBACs were treated with 1.5g/L-fructose, 5g/L-fructose or control maintenance media. Thermogenesis was stimulated with 1µM isoproterenol for 1 hour. The cells were harvested according to a previously published protocol (Stekovic et al., 2019).

2.6 Seahorse: ECAR measurement

Mature iBACs were seeded in a Seahorse XF 96 culture microplate.

iBACs were cultivated in maintenance medium. Extracellular acidification rate (ECAR) was analyzed according to manufacturer’s protocol (Seahorse XFe96 Analyzer by Agilent). 27mM glucose or 25mM fructose was acutely injected following measurement of basal ECAR. After ECAR measurement BCA assay for protein quantification was done on well-plates to normalize the results.

21

3. Results

3.1. Establishment of a p53 ChIP protocol in mature brown adipocytes 3.1.1. Optimization of DNA shearing

To generate DNA fragments with a peak centered around ~300bp, different numbers of sonification cycles were applied to crosslinked DNA, as described in “2.3.2 Sonication analysis”. Subsequently, fragment length was analyzed by agarose gel electrophoresis as shown below.

Figure 5. Gelectrophoresis of fragmented iBACs DNA cultivated in maintenance media. Crosslinked iBACs samples were sonicated in Eppendorf tubes (A) or Bioruptor tubes (B). Used cycle numbers of sonication are noted above each lane. DNA ladder was loaded on the left slot. Base pairs are noted on the left side.

Using Bioruptor tubes (Figure 5B) instead of standard eppendorf tubes (Figure 5A) substantially improved DNA fragmentation by sonification, subsequently leading to smaller fragment sizes upon less sonification cycles. Ten cycles seemed to be the optimal cycle number leading to a DNA fragment size of less than 500bp when using Bioruptor tubes. Additional increase in cycle number does not show further recognizable size reduction and might lead to interference of protein binding to the DNA.

3.1.2. Optimization of cell lysis for ChIP assay

To optimize plasma membrane lysis and improve overall yield of crosslinked DNA-p53 material, an optional sonification step can be included after douncing (Prokesch et al., 2016). Since excessive sonication can lead to an interference of protein binding to DNA, the effectiveness of an additional sonification step was tested Therefore, four

22

protocols were performed without and with five sonication cycles at two different times during processing, respectively, to investigate whether an effect on the overall yield could be observed. Sonication to lyse the plasma membrane and sonication to fragment DNA were analyzed by agarose gel electrophoresis in the following combination (Figure 6): Un-sonicated for lysis and fragmentation; un-sonicated for lysis and sonicated for fragmentation; sonicated for lysis and un-sonicated for fragmentation; sonicated for lysis and fragmentation. Five cycles of sonication were used for lysis and/or DNA - fragmentation. No significant increase in yield could be observed in the amount of isolated DNA (L-/F+: 58ng/µl and L+/F+: 70ng/µl) and the fragment size was not reduced as seen in Figure 6.

Figure 6. Lysis efficiency was analyzed according to fragment length by running the DNA on a 1% agarose gel. Five cycles of sonication were used after douncing crosslinked iBACs (L+) to enhance plasma membrane lysis and/or after nuclei lysis to fragment DNA material (F+). By omitting sonication cycles (“L-“ or “F-“) different protocols were used to determine lysis efficiency.

23 3.2. Adjusting the ChIP protocol

Next, ChIP-qPCR was used to amplify chromatin derived from immunoprecipitation with p53 antibody. P21, a well described target gene of p53 (Benson et al., 2013), has been used as control locus. The locus for miR92a was our locus of interest, as we previously identified a potential interaction of p53 with miR92a. Primer pairs for negative controls have been designed at loci that are several kbs distant of p53 binding sides.

Using Eppendorf tubes with the highest number of sonification cycles (shown in Figure 5A) for DNA fragmentation showed no recognizable difference in enrichment (Figure 7). This led to the assumption that insufficient DNA fragmentation results in precipitation of too long DNA fragments, delivering qPCR signals from regions far distant from the locus of interest, including negative control loci. This is shown in Figure 7, where miR92a locus and p21 target regions (positive control) showed no increased enrichment over negative control.

Since p53 signalling has been shown to be increased upon starvation, in an effort to increase binding efficiency, iBACs have been starved for 24h in HBSS and HEPES before crosslinked material was harvested. Additionally, bioruptor tubes have been used for sonicating the DNA-protein complexes, as they have been validated to improve fragmentation of the DNA.

Figure 7. ChIP-qPCR precipitated with 3.54µg antibody and 20µl magnetic tubes. Eppendorf tubes were used for DNA fragmentation. After harvesting mature iBACs, cultivated in maintenance media, 40 cycles of sonication were used for DNA fragmentation.

miR92a IgG p21 IgG 0.0

0.5 1.0 1.5

ChIP-qPCR

%Input over neg. ctrl

24

Figure 8. qPCR of starved iBACs. Cells were starved for 24hrs in HBSS with 10mM Hepes (stv) while control sample remained in maintenance medium before harvest. 2.5µg of antibody combined with 20µl magnetic beads were used for precipitation after DNA fragmentation by 10 cycles of sonication.

While a slight enrichment over the negative control region was measured, comparing control with starved iBACs, ChIP-qPCR signal indicated no remarkable difference in enrichment of the p21 and miR92a loci (Figure 8).

As an alternative method, we used idasanutlin, a frequently used pharmacological agent that leads to stabilization of p53 at the protein level, resulting in activation of p53 target genes such as p21. In line, idasanutlin-treated samples showed increased pulldown of p21 and miR92a loci, when precipitated with 1.25µg antibodies (not shown). However, negative controls also increased noticeably, resulting in an overall reduced "%Input over negative control" enrichment compared to control sample (Figure 9).

Figure 9. qPCR of nutlin treated iBACs precipitated with 1.25µg

25

To test whether increasing the amount of antibody could increase the overall specific enrichment, we doubled the amount of antibody for pull down. This showed an overall increase in enrichment for the miRNA92 as well as for the p21 region. However, negative control signal proportionally increased as well. This ultimately shows reduced enrichment of idasanutlin treated sample over control sample, using 1.5 µg antibody (Figure 9) and no discernible change in enrichment of target regions miRNA92a and p21 using 2.5 µg antibody (Figure 10), depicted in “%Input over negative control”.

Ctrl Nutlin

0.0 0.5 1.0 1.5

ChIP- qPCR

%Input over neg. ctrl _miR92a

p21 IgG

Figure 10. ChIP-qPCR of chromatin derived from control or nutlin treated iBACs precipitated with 2.5µg antibody. Cells were treated for 24 hours with 5µM idasanutlin (Nutlin) in maintenance medium before harvesting Control sample (Ctrl) was solely cultivated in maintenance medium before harvest. 2.5µg of antibody (D2H9O) combined with 20µl magnetic beads were used for precipitation after 5 cycles of sonication.

Taken together, using pharmacological agents to stabilize p53 or adjusting the antibody concentration did not result in improved binding efficiency. Moreover, overall enrichment was the highest using untreated samples (control) with less antibody (1.25µg) (Figure 10).

Since insufficient amounts of magnetic beads might result in high unspecific binding, different amounts of beads were tested for ChIP. Thus, 100µl (Figure 11A) or 200 µl (Figure 11B) (as suggested by the manufacturer) beads per sample were used for precipitation.

26

One hundred µl bead precipitation showed no change in enrichment of the control over idasanutlin treated sample (Figure 11A) in any of the examined loci. Using 200µl beads, miR92a and p21 loci showed high “%Input over negative control” enrichment in control compared to idasanutlin treated sample (Figure 11B). However, the dramatically increased enrichment of target loci pulled down by IgG antibodies suggests that increased unspecific binding is the reason for the increased overall enrichment of the control sample. In contrast, idasanutlin-treated samples showed lower enrichment of "%Input over negative control" pulled down with the p53 antibody, but enrichment of the same loci was drastically lower in comparison when the IgG antibody was used for pulldown. Taken together, while 100µl beads treatment showed no change in “%Input over negative control”, when using 200µl beads idasanutlin-treated samples seem to be lower compared to the control. However, the high enrichment of the control sample could be due to unspecific binding as indicated by high enrichment of loci precipitated with IgG. Since the negative control loci also showed the lowest %Input enrichment when using 200µl beads, further experiments were performed using this parameter (Figure 11B).

Figure 11. Bead analysis of cell precipitated with 100 µl (A) and 200µl (B) beads. After 24 hours incubation of iBACs with indasanutlin (Nutlin), harvested cells were precipitated with magnetic beads combined with 2.5µg D2H9O antibodies. Control sample (Ctrl) was harvested after cultivation in maintenance medium.

Ctrl Nutlin

27 medium and precipitated with 2.5µg antibody (D2H9O)

serving as control (Ctrl) and IgG control (IgG). By changing the wash buffer of the finals wash step from 150mM to 500mM NaCl stringency was increased (high salt). By reducing the wash steps with wash buffer by

serving as control (Ctrl) and IgG control (IgG). By changing the wash buffer of the finals wash step from 150mM to 500mM NaCl stringency was increased (high salt). By reducing the wash steps with wash buffer by

Im Dokument Dissecting a novel p53-mirna axis in brown adipocytes (Seite 13-0)