The Chaperone-associated Ubiquitin Ligase CHIP Is Able to Target p53 for Proteasomal Degradation

(1)

The Chaperone-associated Ubiquitin Ligase CHIP Is Able to Target p53 for Proteasomal Degradation*

Received for publication, February 10, 2005, and in revised form, May 13, 2005 Published, JBC Papers in Press, May 23, 2005, DOI 10.1074/jbc.M501574200

Claudia Esser‡, Martin Scheffner§, and Jo¨ rg Ho¨ hfeld‡^¶

From the‡Institute for Cell Biology and Bonner Forum Biomedizin, Rheinische Friedrich-Wilhelms-University Bonn, Ulrich-Haberland-Str. 61a, D-53121 Bonn, Germany and the§Department of Biology, Laboratory for Biochemistry, University of Konstanz , 78457 Konstanz, Germany

The cellular level of the tumor suppressor p53 is tightly regulated through induced degradation via the ubiquitin/proteasome system. The ubiquitin ligase Mdm2 plays a pivotal role in stimulating p53 turnover.

However, recently additional ubiquitin ligases have been identified that participate in the degradation of the tumor suppressor. Apparently, multiple degradation pathways are employed to ensure proper destruction of p53. Here we show that the chaperone-associated ubiq- uitin ligase CHIP is able to induce the proteasomal deg- radation of p53. CHIP-induced degradation was ob- served for mutant p53, which was previously shown to associate with the chaperones Hsc70 and Hsp90, and for the wild-type form of the tumor suppressor. Our data reveal that mutant and wild-type p53 transiently asso- ciate with molecular chaperones and can be diverted onto a degradation pathway through this association.

The p53 tumor suppressor has been termed “the guardian of the genome” (1). In normal cells p53 is present at low concen- tration. DNA damage and other stresses such as hypoxia cause an accumulation of p53, which leads to cell cycle arrest or apoptosis (2, 3). p53 acts as a transcription factor to activate target genes that are involved in these responses to prevent damaged cells from proliferating and passing mutations on to the next generation (4). Cells that lack functional p53 are unable to respond appropriately to stress and are prone to oncogenic transformation. In fact, missense mutations that inactivate p53 are found in⬃50% of all human tumors making them the most frequent genetic alterations in cancer (5, 6).

p53 is regulated through a variety of posttranslational mod- ifications, including phosphorylation, acetylation, and attachment of ubiquitin, the small ubiquitin-like modifier SUMO and the ubiquitin-like protein Nedd8 (4, 7, 8). Central to the regulation of p53 is the ubiquitin ligase Mdm2 (8 –10). Ubiquitin ligases (E3(s))¹ provide specificity to ubiquitin conjugation as they mediate the final step in the conjugation process, following the activation of ubiquitin by the E1 enzyme and its trans- fer onto a ubiquitin-conjugating (E2) enzyme (11). Mdm2 be- longs to the RING finger E3s, which facilitate ubiquitylation by tethering the E2-ubiquitin complex to the substrate protein

(12). Mdm2-mediated ubiquitylation targets p53 for degradation by the 26 S proteasome and is of central importance for establishing low p53 levels in normal cells (13, 14). The functional interplay between Mdm2 and p53 was elegantly demonstrated in gene knock-out studies, in which the embryonic lethality ofmdm2null mice was rescued by simultaneous de- letion of thep53gene (15, 16). Stress-induced phosphorylation of p53 attenuates the interaction with Mdm2, leading to stabi- lization and activation of the transcription factor (17). Intrigu- ingly, Mdm2 is itself a transcriptional target of p53, which establishes a negative feedback loop to terminate p53-mediated stress responses (18). Additional mechanisms that regulate the Mdm2-p53 interplay include autoubiquitylation of Mdm2, the association of Mdm2 with diverse binding partners, and alterations of the intracellular localization of Mdm2 and p53 (8, 10, 19, 20). Furthermore, Mdm2 not only mediates ubiquitylation of p53 but can also conjugate Nedd8 to the tumor suppressor to inactivate its transcriptional activity (7).

Despite the central role of Mdm2 in proteasomal targeting of p53, additional ubiquitin ligases were recently shown to participate in the degradation of the tumor suppressor in normal cells, including p300, Pirh2, and COP1 (21–23). Although p300 seems to cooperate with Mdm2 during ubiquitylation, Pirh2 and COP1 trigger the destruction of p53 independent of Mdm2.

Multiple degradation pathways apparently exist to maintain low levels of p53 in normal cells. It is unclear whether these degradation pathways are truly redundant or whether they are selectively engaged in p53 destruction dependent on cell line- age, developmental stage, or physiological situation. In any case, the complexity of p53 degradation may allow to integrate diverse signaling events through which p53 can be regulated.

We have recently identified a pathway for protein degradation in the mammalian cytoplasm and nucleus that involves a close cooperation of the molecular chaperones Hsc70 and Hsp90 with the ubiquitin-proteasome system (24). Of central importance on this degradation pathway is the chaperone- associated ubiquitin ligase CHIP (25). Through binding to the carboxyl termini of Hsc70 and Hsp90, CHIP mediates the ubiquitylation of chaperone-bound client proteins in conjunction with E2 enzymes of the Ubc4/5 family and induces client degradation by the 26 S proteasome (26 –28). Affected chaperone clients can be broadly divided into two subclasses: (i) Hsc70- and Hsp90-associated signaling proteins, for example the glucocorticoid hormone receptor (26, 29) and the oncogenic receptor tyrosine kinase ErbB2 (30) and (ii) aggregation- prone proteins that are subjected to chaperone-assisted qual- ity control, such as misfolded cystic fibrosis transmembrane conductance regulator (31, 32) and hyperphosphorylated tau (33, 34). However, the full range of cellular substrates of CHIP remains to be explored. Remarkably, mice that lack CHIP develop apoptosis in multiple organs after environmen-

* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked

“advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

¶To whom correspondence should be addressed. Tel.: 49-228-735308;

Fax: 49-228-735302; E-mail: hoehfeld@uni-bonn.de.

1The abbreviations used are: E3, ubiquitin-protein isopeptide ligase;

E2, ubiquitin carrier protein; E1, ubiquitin-activating enzyme; MOPS, 3-(N-morpholino)propanesulfonic acid; siRNA, small interfering RNA;

GA, geldanamycin.

THEJOURNAL OFBIOLOGICALCHEMISTRY Vol. 280, No. 29, Issue of July 22, pp. 27443–27448, 2005

This paper is available on line at http://www.jbc.org

27443

Konstanzer Online-Publikations-System (KOPS) URL: http://nbn-resolving.de/urn:nbn:de:bsz:352-167692 https://dx.doi.org/10.1074/jbc.M501574200

(2)

tal challenge (35). This seems to reflect the role of CHIP in the conformational regulation of the heat shock transcription factor but may also mirror altered associations between the chaperone machinery and diverse apoptosis regulators in the absence of CHIP (36).

Many transforming mutants of p53 display structural de- fects and were previously found associated with the molecular chaperones Hsc70 and Hsp90 in tissue culture cells and in human tumor specimens (37–39). For example, Arg¹⁷⁵mutations destabilize loop regions within the DNA binding domain, leading to partial unfolding and association with Hsc70 (40 – 44). In contrast to the findings for mutant p53, an interaction of wild-type p53 with molecular chaperones could not be detected by coimmunoprecipitation (39, 45). However, this does not ex- clude that the extended chaperone interactions observed for mutant p53 actually represent a pathological exaggeration of transient interactions between wild-type p53 and the cellular chaperone machinery, similar to observations made for other signaling proteins (46, 47). Wild-type p53 possesses an intrinsic conformational lability (48, 49), and may therefore undergo dynamic associations with molecular chaperones at a posttranslational stage. Such associations may modulate the pres- entation of p53 for degradation and could serve as sensors of cell stress. Here we show that wild-type p53 and an Arg¹⁷⁵ mutant form of the tumor suppressor (p53R175H) can be targeted for proteasomal degradation by the CHIP ubiquitin ligase. Our data thus reveal a novel degradation pathway for the tumor suppressor that is entered through a transient association of wild-type and mutant p53 with molecular chaperones.

MATERIALS AND METHODS

Purified Proteins and Antibodies—The following proteins were ex- pressed recombinantly and purified as described previously: rat Hsc70, human Hsp40, human UbcH5b, human CHIP, and wheat E1 (26, 50, 51). Purified bovine ubiquitin was purchased from Sigma. For immunoblotting anti-p53 (DO-1; Oncogene Research Products, San Diego, CA), polyclonal anti-Hsc/Hsp70 (F. U. Hartl, MPI for Biochemistry), monoclonal anti-Hsc/Hsp70 (SPA-820; StressGen Biotechnologies, San Diego, CA), and anti-CHIP antibodies (25) were used.

Cell Culture and Transfection—H1299 cells were grown in RPMI media (Sigma) supplemented with 10% fetal calf serum, penicillin, and streptomycin. Transfection of H1299 cells was performed using DOTAP liposomal transfection reagent according to the protocol of the manufacturer (Roche Diagnostics). U2OS cells were grown in Dulbecco’s modified Eagle’s medium (Invitrogen) supplemented with 10% fetal calf serum, penicillin, and streptomycin. For transfection of U2OS cells Effectene transfection reagent (Qiagen, Valencia, CA) was used. Cell extracts were prepared 24 h post-transfection.

Degradation Assays—To analyze the degradation kinetics of p53, H1299 cells were seeded in six-well plates and were transfected with 0.1

␮g of pRC/CMV-p53wt or 0.1␮g of pcDNA3.1-p53R175H and 1.2␮g of pcDNA3.1-CHIP as indicated. The total amount of added DNA was kept constant at 2.5␮g/well by the addition of pcDNA3.1. Protein lysates were prepared at indicated time points after addition of cycloheximide (60␮g/ml). Cells were washed once with phosphate-buffered saline and lysed in radioimmune precipitation assay buffer (25 mMTris-HCl, pH 8.0, 150 mMNaCl, 0.1% SDS, 0.5% sodium deoxycholate, 1% Nonidet P-40, 10% glycerol, 2 mMEDTA) supplemented with Complete protease inhibitor (Roche Diagnostics). The lysate was centrifuged at 20,000⫻g for 30 min at 4 °C, and the supernatant was used as a soluble extract.

Equal amounts of protein were separated by SDS-PAGE. Levels of p53 and p53R175H were determined by immunoblotting and quantified at indicated time points. To analyze the effect of geldanamycin on the degradation of p53, H1299 cells were treated with geldanamycin (1␮^M) and dimethyl sulfoxide, respectively, 12 h after transfection.

In Vitro Ubiquitylation Assay—In vitro transcription of p53 and p53R175H was performed with pRC/CMV-p53wt and pcDNA3.1-p53R175H using the T7 RiboMax system according to the manufacturer’s instructions (Promega). The obtained RNA was used forin vitrotranslation of radiola- beled p53 and p53R175H with nuclease-treated rabbit reticulocyte lysate (Promega). For ubiquitylation of p53 and p53R175H, 8␮l of the translation reactions was incubated with 0.1␮^ME1, 4␮^MUbcH5b, 6␮^MCHIP, 6␮^M Hsc70, and 0.6␮^MHsp40 as indicated. Each sample received 2.5␮g/␮l

ubiquitin, 1␮g/␮l ubiquitin-aldehyde, 10 m^MATP, 10 mMMgCl2, 10 mM

dithiothreitol, 10 mMphosphocreatine, and 10 mMcreatine kinase. The total volume of the samples was adjusted to 20␮l with 25 m^MMOPS, pH 7.2, 100 mMKCl, and 1 mMphenylmethylsulfonyl fluoride. Samples were incubated for 2 h at 30 °C and then analyzed by SDS-PAGE and phosphorimaging.

Reporter Gene Assays—H1299 cells were seeded in six-well plates and were transfected with 0.6␮g of a firefly luciferase reporter gene plasmid (pp53-TA-Luc; BD Biosciences Clontech), 0.2␮g pRC/CMV-p53wt, and 1.2

␮g pcDNA3.1-CHIP as indicated. The total amount of added DNA was kept constant at 2.5␮g/well by addition of pcDNA3.1. U2OS cells were seeded in six-well plates and were transfected with 0.2␮g of ppluc-p53 and increasing amounts of pcDNA3.1-CHIP from 0 to 0.5␮g as indicated.

The total amount of DNA was kept constant at 0.8␮g/well by the addition of pcDNA3.1. Cells were washed once with phosphate-buffered saline and lysed in 100␮l of lysis buffer (50 m^MMOPS, pH 7.2, 100 mMKCl, 0.5%

Tween 20) containing Complete protease inhibitor. The lysate was centrifuged at 20,000⫻gfor 30 min at 4 °C, and the supernatant was used as a soluble extract. 5␮l of cell extract were analyzed with luciferase assay reagent (Promega). Levels of p53 and CHIP were determined after SDS-PAGE and immunoblotting.

RNA Interference—Endogenous CHIP was depleted in U2OS cells using siRNA oligonucleotides (Dharmacon, Lafayette, CO). The oligonucleotide CHIP1 is directed against the sequence GAA- GAAGCGCTGGAACAGC, and CHIP2 targets the sequence ACCAC- GAGGGTGATGAGGA of the human CHIP gene. Green fluorescent protein siRNA (GGCTACGTCCAGGAGCGCACC) served as the control. U2OS cells were seeded in six-well plates and were transfected twice at a 72-h interval with siRNA oligonucleotides using Lipo- fectamine 2000 (Invitrogen) according to the manufacturer’s recom- mendations. 72 h after the second transfection cells were washed once with phosphate-buffered saline and lysed in 100␮l of radioimmune precipitation assay buffer supplemented with Complete protease inhibitor. The lysate was centrifuged at 20,000⫻gfor 30 min at 4 °C, and the supernatant was used as a soluble extract. Equal amounts of protein were separated by SDS-PAGE. Levels of CHIP and p53 were determined by immunoblotting.

RESULTS

p53R175H but Not Wild-type p53 Forms Stable Complexes with Hsc70 in H1299 Cells—To investigate a potential influ- ence of the chaperone-associated ubiquitin ligase CHIP on the turnover of p53, the human lung cancer cell line H1299 was used. In an initial experiment we analyzed the association of wild-type p53 and the conformational mutant p53R175H with Hsc70 following transient transfection of the p53-deficient cell line with corresponding expression plasmids. Although wild- type p53 was not found in association with Hsc70, complexes between p53R175H and Hsc70 were readily detectable after immunoprecipitation (Fig. 1). Transient transfection of H1299 cells thus recapitulates the findings obtained in p53-expressing cell lines and tumor specimens that conformational mutants but not wild-type p53 form stable complexes with molecular chaperones (37–39).

p53R175H and Wild-type p53 Can Be Targeted for Degrada- tion by the CHIP Ubiquitin Ligase—As the p53R175H mutant of p53 was found associated with Hsc70, we investigated whether the turnover of the mutant form is affected by CHIP. Upon elevation of the cellular levels of CHIP in H1299 cells a significant decline in the levels of coexpressed p53R175H was observed (Fig. 2A). This decline could be attributed to an accelerated deg- FIG. 1.p53R175H forms stable complexes with Hsc/Hsp70 in contrast to wild-type p53.H1299 cells were transiently transfected with pRC/CMV-p53wt (p53) and pcDNA3.1-p53R175H (p53R175H) as indicated. Control cells were untransfected. For immunoprecipitation a specific anti-p53 antibody (␣-p53 IP) was used. After SDS-PAGE and immunoblotting p53-associated Hsc/Hsp70 was detected using a polyclonal anti-Hsc/Hsp70 antibody. To monitor expression levels, 25␮g of protein extracts (ex.) were loaded.

(3)

radation of p53R175H induced by the CHIP ubiquitin ligase (Fig.

2, BandC). Apparently, the oncogenic mutant protein can be turned over by a chaperone-assisted degradation pathway.

Despite the fact that complexes between wild-type p53 and Hsc70 were not detectable by immunoprecipitation, it was previously speculated that wild-type p53 may undergo highly transient interactions with molecular chaperones (39). We reasoned that such transient interactions might become detectable upon CHIP overexpression, when even those proteins that associate with Hsc70 in a highly transient manner would be irreversibly diverted onto a degradation pathway (29, 31, 32). In fact, CHIP was able to induce the degradation of wild-type p53, albeit with a slightly reduced efficiency when compared with the findings for p53R175H (Fig. 3). Our data reveal that wild-type p53 associates transiently with molecular chaperones and can be diverted onto a degradation pathway through this association.

Geldanamycin Induces the Degradation of Wild-type and Mutant p53 in H1299 Cells—We investigated how the ansamy- cin antibiotic geldanamycin (GA) affects p53 degradation. GA specifically inhibits Hsp90, which usually results in the proteasomal degradation of client proteins that depend on the activity of the chaperone (52). The turnover of wild-type and mutant p53 was stimulated upon GA treatment, consistent with an association of both forms with Hsp90 (Fig. 4). However, only in the case of p53R175H was a synergistic effect of GA treatment and CHIP elevation observed. The prolonged and more stable association of mutant p53 with Hsp90 and Hsc70 may provide the molecular basis for this synergism.

CHIP Mediates Ubiquitylation of p53 and p53R175H in Co- operation with UbcH5b and Hsc70 —To verify that CHIP acts as an E3 ubiquitin ligase during p53 degradation, p53 and p53R175H werein vitrotranslated in rabbit reticulocyte lysate.

Upon addition of purified CHIP to translation reactions, ubiquitylated forms of wild-type and mutant p53 accumulated (Fig.

5). An increase in the amount of ubiquitylated p53 was also observed when UbcH5b and Hsc70 were added, suggesting a close cooperation of CHIP, UbcH5b, and Hsc70 during the ubiquitylation of p53, similar to recent observations for other CHIP substrates (26, 32).

CHIP Affects p53-mediated Transcription—We analyzed how CHIP influences p53-mediated transcription using a reporter construct that contains firefly luciferase under the control of a p53-response element. Overexpression of CHIP led to a significant reduction of luciferase activity in corresponding cell extracts (Fig. 6A). Conceivably, such a reduction may be caused by a CHIP-induced degradation of luciferase itself.

However, it was previously shown that CHIP does not target luciferase for degradation but stimulates the folding of lucifer- FIG. 2.CHIP targets p53R175H for proteasomal degradation.

H1299 cells were transiently transfected with pcDNA3.1-p53R175H (p53R175H) and pcDNA3.1-CHIP (CHIP) as indicated.A, to analyze the effect of CHIP on steady state levels of p53R175H, protein lysates were prepared. After SDS-PAGE and immunoblotting p53R175H and CHIP were detected by specific antibodies. Immunodetection of Hsc/Hsp70 served as loading control.B, to determine the effect of CHIP on the half-life of p53R175H, protein lysates were prepared at the indicated time points after cycloheximide (60␮g/ml) treatment. The amount of p53R175H was analyzed by immunoblotting using a specific anti-p53 antibody. 25␮g of total protein were loaded for each time point.C, the amount of p53R175H in presence of CHIP (open triangles) and absence of CHIP (closed triangles) was quantified. Presented data were averaged from six independent experiments.Error barsrepresent the S.D.

FIG. 3.CHIP targets wild-type p53 for proteasomal degrada- tion.H1299 cells were transiently transfected with pRC/CMV-p53wt (p53) and pcDNA3.1-CHIP (CHIP) as indicated.A, to analyze the effect of CHIP on steady state levels of p53, protein lysates were prepared.

After SDS-PAGE and immunoblotting p53 and CHIP were detected by specific antibodies. Immunodetection of Hsc/Hsp70 served as loading control.B, to determine the effect of CHIP on the half-life of p53, protein lysates were prepared at the indicated time points after cycloheximide (60␮g/ml) treatment. The amount of p53 was analyzed by immunoblotting using a specific anti-p53 antibody. 25 ␮g of total protein were loaded for each time point.C, the amount of p53 in presence of CHIP (open squares) and absence of CHIP (closed squares) was quantified.

Presented data were averaged from six independent experiments.Error barsrepresent the S.D.

FIG. 4.Geldanamycin stimulates the degradation of p53 and p53R175H.The effect of geldanamycin on the degradation of p53 and p53R175H was investigated in H1299 cells coexpressing CHIP when indicated. Cells were cultured overnight with GA and Me2SO (DMSO) as indicated. Data are shown as the ratio of degradation rates determined in control cellsversustreated cells.Error barsrepresent the S.D.

of three independent experiments.

FIG. 5.The ubiquitin ligase CHIP induces ubiquitylation of p53 in cooperation with UbcH5b and Hsc70.A,in vitrotranslated p53 and p53R175H were incubated with purified Hsc70, Hsp40, UbcH5b, and CHIP as indicated. All reactions received the ubiquitin- activating enzyme E1. Ubiquitylation was assessed by autoradiogra- phy.B, quantification of data obtained underA. The amount of ubiquitylated p53 detected in the presence of Hsc70, Hsp40, and UbcH5b was set to 1.

(4)

ase in tissue culture cells (53). In this regard the observed reduction of luciferase activity rather appears to be an under- estimate of the effect of CHIP on p53-mediated transcription.

Notably, the observed reduction in luciferase activity was com- parable with the reduction of p53 levels (Fig. 6B). CHIP-induced attenuation of p53-mediated transcription was also observed in U2OS cells that endogenously express p53 (Fig. 6C).

It seems that CHIP alters p53-dependent transcriptional responses through an induced degradation of p53.

Depletion of Endogenous CHIP Stabilizes p53—Endogenous levels of CHIP were depleted in U2OS cells following transfection with siRNAs (Fig. 7). Intriguingly, depletion of the chaperone-associated ubiquitin ligase caused a significant increase of p53 levels. The findings emphasize the role of chaperone- assisted degradation in maintaining low concentrations of p53 under physiological conditions.

DISCUSSION

Here we identify a novel degradation pathway for the tumor suppressor p53. This pathway is entered through a transient association of wild-type and mutant p53 with molecular chaperones and involves the chaperone-associated ubiquitin ligase CHIP. CHIP cooperates with E2 enzymes of the Ubc4/5 family to mediate the attachment of an ubiquitin-derived degradation signal to chaperone-bound p53, which leads to the proteasomal destruction of the tumor suppressor. CHIP-mediated degradation critically depends on the interaction of the ubiquitin ligase with the chaperones Hsc70 and Hsp90, which were shown to present chaperone clients to the ubiquitin ligase (26, 29, 31, 32). It has long been appreciated that oncogenic mutant forms of p53 associate with Hsc70 and Hsp90 in tissue culture cells and in tumor specimens (37, 39). Because of conformational alterations mutant p53s are retained in complexes with the two chaperones and with several of their regulatory cochaperones

(39, 54). Therefore, oncogenic mutants are amenable to a regulation through chaperone-assisted degradation. A similar association with molecular chaperones was not yet unequivocally demonstrated for wild-type p53, as complexes between the tumor suppressor and Hsc70 or Hsp90 could not be isolated (39). It was speculated, however, that such complexes may escape detection because of their highly transient nature (39).

Such transient associations with Hsc70 or Hsp90 may become detectable when the chaperone client is irreversibly diverted onto a degradation pathway through the action of the CHIP ubiquitin ligase. In fact, we observed that wild-type p53 is sensitive to an elevation of the cellular levels of the chaperone- associated ubiquitin ligase. Furthermore, depletion of endogenous CHIP stabilized wild-type p53 in U2OS cells. Taken to- gether, our data establish a role of molecular chaperones in the regulation of wild-type p53.

Evidence suggests that chaperones associate with p53 at multiple stages and influence the oligomeric state, the nucleo- cytoplasmic transport and the transcriptional activity of the tumor suppressor (reviewed in Refs. 55–59). For example, Hsc70 was shown to sequester a mutant form of p53 in the cytoplasm by masking a nuclear localization signal present at the carboxyl terminus (56). p53 displays multiple binding sites for Hsc70, located in the amino-terminal transactivation domain, the DNA-binding core domain, and the carboxyl terminus (60 – 63). Binding sites within the core domain are recognized with particularly high affinity by Hsc70, but they appear to be buried within the native protein. On the other hand, the amino-terminal region of p53 seems to be natively unfolded, and the carboxyl terminus is relatively unstructured (64 – 66).

Binding sites within these regions may remain accessible for Hsc70 when the protein is largely in a native conformation.

Notably, studies using conformational antibodies indicate that even the core domain is a metastable structure that is easily perturbed upon treatment with chelating or oxidizing agents or by raising the temperature (49, 67). The core domain is also recognized by Hsp90 (57, 68), and Walerychet al.(58) recently demonstrated that Hsp90 is required to maintain the DNA binding activity of the core domain under physiological conditions. Apparently, p53 is a protein of large conformational flexibility and seems to be in a conformational equilibrium between native and less structured states. This flexibility may provide the means for complex intra- and intermolecular interactions and for the association of p53 with a multitude of regulatory proteins. The accompanying conformational changes are apparently assisted by Hsc70 and Hsp90. In this regard the extended chaperone interactions observed for mutant p53 seem to represent a pathologic exaggeration of phys- iologic interactions of wild-type p53 with the chaperone machinery.

Conceivably, the CHIP-mediated degradation pathway might be entered through an association of a chaperone client with either Hsc70 or Hsp90, as CHIP is able to bind both chaperones. Treatment of tissue culture cells with small molecular inhibitors of Hsp90, such as GA, has helped to verify FIG. 6.CHIP influences p53-mediated transcription.A, H1299

cells were transiently transfected with a reporter plasmid expressing firefly luciferase under control of a p53 response element. Cotransfec- tions were carried out using p53 and CHIP expression vectors as indicated. Protein lysates were prepared, and luciferase activity was meas- ured. Activities are expressed relative to uninduced promoter activity, which was set to 1. Theerror barsrepresent the S.D. of three independent experiments.B, levels of p53 and CHIP were detected by immunoblotting using specific antibodies. 40␮g of total protein were loaded.

Immunodetection of Hsc/Hsp70 served as loading control.C, U2OS cells were transiently transfected with a reporter plasmid expressing firefly luciferase under control of a p53 response element. Increasing amounts of pcDNA-CHIP were cotransfected ranging from 0 to 0.5 ␮g DNA.

Activities are expressed relative to p53-induced promoter activity, which was set to 100%.

FIG. 7.CHIP ablation by siRNA stabilizes p53.U2OS cells were transfected with siRNA oligonucleotides targeting two different se- quences of CHIP (CHIP1 and CHIP2) and green fluorescent protein (GFP) siRNA as indicated. Levels of CHIP and p53 were analyzed after the separation of 30␮g of protein extracts on a SDS-PAGE and immunoblotting using specific antibodies. Actin served as loading control.

(5)

this hypothesis. Geldanamycin blocks the interaction of Hsp90 with chaperone clients. Remarkably, the Hsp90 inhibitor stimulates the CHIP-mediated degradation of signaling proteins that rely on an association with Hsc70 and Hsp90, i.e. the oncogenic receptor tyrosine kinase ErbB2 (30). GA treatment dissociates Hsp90 while increasing the association of Hsc70 with ErbB2. Redistribution into Hsc70 complexes followed by proteasomal degradation was also observed for oncogenic mutants of p53 upon treatment of tumor cell lines with GA (39).

Here we show that GA-mediated inhibition of Hsp90 induces the degradation of mutant and wild-type p53 in H1299 cells.

This provides additional evidence for an association of both forms with molecular chaperones. GA-induced degradation of mutant but not wild-type p53 was further stimulated by the overexpression of CHIP. The highly transient association of wild-type p53 with Hsc70 and Hsp90 may limit the synergistic effects of GA treatment and CHIP overexpression. In any case, the diversion of chaperone clients, including p53, onto a proteasomal degradation pathway seems to be preferentially mediated by an Hsc70/CHIP chaperone machinery.

The observation that elevated CHIP levels increase the sen- sitivity of oncogenic mutant forms of p53 against Hsp90 inhibitors might be of profound relevance for cancer treatment.

Several Hsp90-inhibitors are currently tested in clinical trials as anti-tumor agents (52). The expression level of CHIP might be an important determinant of the therapeutic success of such pharmacological interventions.

Notably, siRNA-mediated depletion of CHIP significantly stabilized p53. This suggests a critical role of chaperone-assisted degradation in maintaining low concentrations of the tumor suppressor under physiological conditions and points to a novel link between the cellular chaperone machinery and apoptosis regulation. Intriguingly, recent evidence also suggests a cross-talk between CHIP and Mdm2 in p53 regulation (59). The molecular basis for this cross-talk is provided by the formation of a heterocomplex comprising Mdm2, p53, and Hsp90 (59, 69). In the heterocomplex the activity of Mdm2 to ubiquitylate p53 is inhibited by Hsp90 (64). At the same time Mdm2 and Hsp90 cooperate to stimulate the unfolding of native p53 tetramers (59). Because of its ability to bind Hsp90, CHIP can enter the heterocomplex and then further promote p53 unfolding (59). This may represent an initial step in divert- ing p53 from Mdm2-mediated regulation onto a CHIP-induced degradation pathway. In line with a role of CHIP in apoptosis regulation, an anti-apoptotic activity of CHIP was recently demonstrated based on the analysis of CHIP knock-out mice (35). Although the anti-apoptotic activity was largely attributed to the role of CHIP in the conformational regulation of the heat shock transcription factor, the ability of the chaperone- associated ubiquitin ligase to induce p53 degradation may con- tribute to this activity.

REFERENCES 1. Lane, D. P. (1992)Nature358,15–16 2. Levine, A. J. (1997)Cell88,323–331

3. Vousden, K. H., and Lu, X. (2002)Nat. Rev. Cancer2,594 – 604 4. Vogelstein, B., Lane, D., and Levine, A. J. (2000)Nature408,307–310 5. Hainaut, P., and Hollstein, M. (2000)Adv. Cancer Res.77,81–137 6. Woods, Y. L., and Lane, D. P. (2003)Hematol. J.4,233–247

7. Xirodimas, D. P., Saville, M. K., Bourdon, J. C., Hay, R. T., and Lane, D. P.

(2004)Cell118,83–97 8. Harper, J. W. (2004)Cell118,2– 4

9. Freedman, D. A., Wu, L., and Levine, A. J. (1999)Cell. Mol. Life Sci.55, 96 –107

10. Michael, D., and Oren, M. (2003)Semin. Cancer Biol.13,49 –58

11. Hershko, A., Ciechanover, A., and Varshavsky, A. (2000) Nat. Med. 10, 1073–1081

12. Fang, S., Jensen, J. P., Ludwig, R. L., Vousden, K. H., and Weissman, A. M.

(2000)J. Biol. Chem.275,8945– 8951

13. Kubbutat, M. H., Jones, S. N., and Vousden, K. H. (1997)Nature387,299 –303 14. Haupt, Y., Maya, R., Kazaz, A., and Oren, M. (1997)Nature387,296 –299 15. Jones, S. N., Roe, A. E., Donehower, L. A., and Bradley, A. (1995)Nature378,

206 –208

16. Montes de Oca Luna, R., Wagner, D. S., and Lozano, G. (1995)Nature378, 203–206

17. Prives, C., and Hall, P. A. (1999)J. Pathol.187,112–126

18. Barak, Y., Juven, T., Haffner, R., and Oren, M. (1993)EMBO J.12,461– 468 19. Linares, L. K., Hengstermann, A., Ciechanover, A., Mu¨ller, S., and Scheffner,

M. (2003)Proc. Natl. Acad. Sci. U. S. A.100,12009 –12014

20. Sui, G., Affar el, B., Shi, Y., Brignone, C., Wall, N. R., Yin, P., Donohoe, M., Luke, M. P., Calvo, D., Grossman, S. R., and Shi, Y. (2004)Cell117, 859 – 872

21. Grossman, S. R., Deato, M. E., Brignone, C., Chan, H. M., Kung, A. L., Tagami, H., Nakatani, Y., and Livingston, D. M. (2003)Science300,342–344 22. Leng, R. P., Lin, Y., Ma, W., Wu, H., Lemmers, B., Chung, S., Parant, J. M.,

Lozano, G., Hakern, R., and Benchimol, S. (2003)Cell112,779 –791 23. Dornan, D., Wertz, I., Schimizu, H., Arnott, D., Frantz, G. D., Dowd, P.,

O’Rourke, K., Koeppen, H., and Dixit, V. M. (2004)Nature429,86 –92 24. Esser, C., Alberti, S., and Ho¨hfeld, J. (2004)Biochim. Biophys. Acta1695,

171–188

25. Ballinger, C. A., Connell, P., Wu, Y., Hu, Z., Thompson, L. J., Yin, L.-Y., and Patterson, C. (1999)Mol. Cell. Biol.19,4535– 4545

26. Demand, J., Alberti, S., Patterson, C., and Ho¨hfeld, J. (2001)Curr. Biol.11, 1569 –1577

27. Murata, S., Minami, Y., Minami, M., Chiba, T., and Tanaka, K. (2001)EMBO Rep.2,1133–1138

28. Jiang, J., Ballinger, C. A., Wu, Y., Dai, Q., Cyr, D. M., Ho¨hfeld, J., and Patterson, C. (2001)J. Biol. Chem.276,42938 – 42944

29. Connell, P., Ballinger, C. A., Jiang, J., Wu, Y., Thompson, L. J., Ho¨hfeld, J., and Patterson, C. (2001)Nat. Cell Biol.3,93–96

30. Xu, W., Marcu, M., Yuan, X., Mimnaugh, E., Patterson, C., and Neckers, L.

(2002)Proc. Natl. Acad. Sci. U. S. A.99,12847–12852

31. Meacham, G. C., Patterson, C., Zhang, W., Younger, J. M., and Cyr, D. M.

(2001)Nat. Cell Biol.3,100 –105

32. Alberti, S., Bo¨hse, K., Arndt, V., Schmitz, A., and Ho¨hfeld, J. (2004)Mol. Biol.

Cell15,4003– 4010

33. Shimura, H., Schwartz, D., Gygi, S. P., and Kosik, K. S. (2004)J. Biol. Chem.

279,4869 – 4876

34. Petrucelli, L., Dickson, D., Kehoe, K., Taylor, J., Snyder, H., Grover, A., De Lucia, M., McGowan, E., Lewis, J., Prihar, G., Kim, J., Dillmann, W. H., Browne, S. E., Hall, A., Voellmy, R., Tsuboi, Y., Dawson, T. M., Wolozin, B., Hardy, J., and Hutton, M. (2004)Hum. Mol. Genet.13,703–714 35. Dai, Q., Zhang, C., Wu, Y., McDonough, H., Whaley, R. A., Godfrey, V., Li,

H. H., Madamanchi, N., Xu, W., Neckers, L., Cyr, D., and Patterson, C.

(2003)EMBO J.22,5446 –5458

36. Mosser, D. D., and Morimoto, R. I. (2004)Oncogene23,2907–2918 37. Davidoff, A. M., Iglehart, J. D., and Marks, J. R. (1992)Proc. Natl. Acad. Sci.

U. S. A.89,3439 –3442

38. Blagosklonny, M. V., Toretsky, J., and Neckers, L. (1995) Oncogene 11, 933–939

39. Whitesell, L., Sutphin, P. D., Pulcini, E. J., Martinez, J. D., and Cook, P. H.

(1998)Mol. Cell. Biol.18,1517–1524

40. Hinds, P. W., Finlay, C. A., Quartin, R. S., Baker, S. J., Fearon, E. R., Vogelstein, B., and Levine, A. J. (1990)Cell Growth & Differ.1,571–580 41. Gannon, J. V., Greaves, R. Iggo, R., and Lane, D. P. (1990) EMBO J.9,

1595–1602

42. Stephen, C. W., and Lane, D. P. (1992)J. Mol. Biol.225,577–583 43. Bargonetti, J., Manfredi, J. J., Chen, X., Marshak, D. R., and Prives, C. (1993)

Genes Dev.7,2565–2574

44. Cho, Y., Gorina, S., Jeffrey, P. D., and Pavletich, N. P. (1994)Science265, 346 –355

45. Finlay, C. A., Hinds, P. W., Tan, T. H., Eliyahu, D., Oren, M., and Levine, A. J.

(1988)Mol. Cell. Biol.8,531–539

46. Xu, Y., Singer, M. A., and Lindquist, S. (1999)Proc. Natl. Acad. Sci. U. S. A.

96,109 –114

47. Cheung, J., and Smith, D. F. (2000)Mol. Endocrinol.14,939 –946 48. Milner, J., and Watson, J. V. (1990)Oncogene5,1683–1690

49. Hainaut, P., Butcher, S., and Milner, J. (1995)Br. J. Cancer71,227–231 50. Ho¨hfeld, J., and Jentsch, S. (1997)EMBO J.16,6209 – 6216

51. Alberti, S., Demand, J., Esser, C., Emmerich, N., Schild, H., and Ho¨hfeld, J.

(2002)J. Biol. Chem.277,45920 – 45927 52. Neckers, L. (2002)Trends Mol. Med.8,S55– 61

53. Kampinga, H. H., Kanon, B., Salomons, F. A., Kabakov, A. E., and Patterson, C. (2003)Mol. Cell. Biol.23,4948 – 4958

54. King, F. W., Wawrzynow, A., Ho¨hfeld, J., and Zylicz, M. (2001)EMBO J.20, 6297– 6305

55. Zylicz, M., King, F. W., and Wawrzynow, A. (2001)EMBO J.20,4634 – 4638 56. Akakura, S., Yoshida, M., Yoneda, Y., and Horinouchi, S. (2001)J. Biol. Chem.

276,14649 –14657

57. Mu¨ ller, L., Schaupp, A., Walerych, D., Wegele, H., and Buchner, J. (2004) J. Biol. Chem.279,48846 – 48854

58. Walerych, D., Kudla, G., Gutkowska, M., Wawrzynow, B., Mu¨ller, L., King, F. W., Helwak, A., Boros, J., Zylicz, A., and Zylicz, M. (2004)J. Biol. Chem.

279,48836 – 48845

59. Burch, L., Shimizu, H., Smith, A., Patterson, C., and Hupp, T. R. (2004)J. Mol.

Biol.337,129 –145

60. Stu¨ rzbecher, H. W., Addison, C., and Jenkins, J. R. (1988)Mol. Cell. Biol.8, 3740 –3747

61. Lam, K. T., and Calderwood, S. K. (1992)Biochem. Biophys. Res. Commun.

184,167–174

62. Fourie, A. M., Sambrook, J. F., and Gething, M. J. (1994)J. Biol. Chem.269, 30470 –30478

63. Fourie, A. M., Hupp, T. R., Lane, D. P., Sang, B. C., Barbosa, M. S., Sambrook,

(6)

J. F., and Gething, M. J. (1997)J. Biol. Chem.272,19471–19479 64. Pavletich, N. P., Chambers, K. A., and Pabo, C. O. (1993) Genes Dev.7,

2556 –2564

65. Bell, S., Klein, C., Mu¨ ller, L., Hansen, S., and Buchner, J. (2002)J. Mol. Biol.

322,917–927

66. Dawson, R., Mu¨ ller, L., Dehner, A., Klein, C., Kessler, H., and Buchner, J.

(2003)J. Mol. Biol.332,1131–1141

67. Hainaut, P., and Milner, J. (1993)Cancer Res.53,4469 – 4473

68. Ru¨ diger, S., Freund, S. M., Veprintsev, D. B., and Fersht, A. R. (2002)Proc.

Natl. Acad. Sci. U. S. A.99,11085–11090

69. Peng, Y., Chen, L., Li, C., Lu, W., and Chen, J. (2001)J. Biol. Chem.276, 40583– 40590