3. Results and Discussion
3.1. Initial Screening for Discrimination between C and 5mC
3.2.2 Screening of Modified Nucleotides for 5mC Detection
3.2.2.2. Testing KOD exo - DNA Polymerase for Incorporation of Modified
3.2.2.2. Testing KOD exo- DNA Polymerase for Incorporation of Modified Nucleotides
Furthermore, the in position 6 modified dGTP derivatives were tested towards their potentials to be used for 5mC detection by employing the B-family DNA polymerase KOD exo- (see Figure 20). To ensure quantitative evaluation of those single-nucleotide incorporation primer extension experiments, all experiments were done at least in triplicates. Figure 20 summarises all observed incorporation efficiencies opposite C or 5mC as well as the discrimination ratio, determined by calculating the quotient of % incorporation opposite C and % incorporation opposite 5mC. Colour coding highlights those nucleotides with the most efficient incorporation by KOD exo- (blue) as well as those leading to the highest discrimination (red).
In contrast, utilising the sequence-family B DNA polymerase KOD exo- I found that this DNA polymerase is capable to incorporate all modified nucleotides with only slightly decreased incorporation efficiencies compared to the unmodified dGMP. As already observed before, the incorporation efficiencies decrease with increased steric hindrance of the introduced modification.
Therefore, nucleotide 1a is incorporated with a higher efficiency than nucleotide 1d. The same tendency can be observed for the amino modified nucleotides 9a - 9o as well as for the thio modified nucleotides 10, 10a and 10b.
Interestingly, I observed the tendency that all modified nucleotides are more efficiently processed opposite C than opposite 5mC by KOD exo- (see Figure 20). As mentioned before, already by processing of the unmodified dGTP, discrimination can be observed with favoured incorporation opposite C. This discrimination improves by the usage of modified nucleotides. The best discrimination ratios were measured during incorporation of nucleotides 1b, 9b, 9g and 9o. By employing KOD exo-
with the unmodified dGTP a discrimination ratio of 1.36 was found. This discrimination increases remarkably, if the oxygen in position 6 is alkylated. Nucleotide 1a already shows improved discrimination compared to dGTP, but the introduction of the bigger ethyl-group in nucleotide 1b leads to an even higher discrimination. Hence, the discrimination ratio observed during processing of dGTP (1.36) can be improved to a factor of 3.16 for nucleotide 1b. The employment of larger modifications does not further improve the discrimination ratio. So, discrimination decreases for nucleotides 1c and 1d. Similar effects can be observed for the amino modified nucleotides 9a - 9d. Again, the discrimination increases with introduction of a methylamino- (9a) or ethylamino-group (9b) in comparison to 6-amino-dGTP 9. This effect vanishes after introduction of more bulky modifications (9c - 9f). Interestingly, the difference in incorporation efficiencies opposite C and 5mC increases further by employment of tertiary amines (9h - 9o), as the highest discrimination can be observed by the most rigid, sterically hindered modification pyrrolidine 9o. In this case, a threefold higher incorporation can be observed opposite C, compared to 5mC. Improved discrimination for 6-thio dGTP 10 was observed before. Additional modification by alkylation (10a+b) improves this discrimination further, but still discrimination detected by processing of nucleotide 1b is best (see Figure 20).
Figure 20: Structures of modified dG*TP analogues, including % incorporation opposite C or 5mC employing DNA polymerase KOD exo- in single-nucleotide incorporation primer extension reactions. 50 µM dGTP or dG*TP and 5 nM KOD exo- were used;; reactions were stopped after 10 min. Experiments were done at least in triplicates. Arithmetic mean is given;; errors are given in the appendix.
3.3.2.2.1. Kinetics for Incorporation of O6-Alkyl-dGTP Derivatives by KOD exo-
To further investigate these findings, I determined steady-state kinetics[114] for incorporation of the nucleotides dGMP and 1a - 1d opposite C and 5mC (see Table 1). Those nucleotides were chosen for further studies, as they proved most promising in previous experiments in combination with KOD exo-. Comparison of the catalytic efficiencies (kcat/KM) observed for processing of dGTP and the 6-alkyl modified nucleotides opposite C and 5mC in the template strand confirms all tendencies observed in the above described primer extension experiments. The incorporation efficiencies of all modified nucleotides decrease with increased steric hindrance of the modifications, as the catalytic efficiencies decrease sequentially from 1.5 ± 0.1 s-1M-1 observed during processing of dGTP to 0.031±0.005 s-1M-1 for 1d (see Table 1 + Figure 21).
However, the ratio of the catalytic efficiencies observed during processing of the respective nucleotide opposite C in comparison to the incorporation opposite the epigenetic marker 5mC varies.
Unmodified dGTP is processed opposite C with 1.4 fold higher catalytic efficiency compared to the incorporation opposite 5mC. This discrimination ratio for nucleotide incorporation opposite C in comparison to the incorporation opposite 5mC increases for nucleotide 1a to a factor of 2.6 and for nucleotide 1b even further to 4.2 (see Table 1).
3. Results and Discussion 46
Table 1: Steady-state kinetic analysis of single-nucleotide incorporation of dGMP and modified nucleotides 1a -
1d opposite C or 5mC employing DNA polymerase KOD exo-. The ratio was calculated by the quotient of kcat/KM
opposite C and kcat/KM opposite 5mC.
nucleotide template kcat [s-1][a] KM [µM][a] kcat/KM [s-1µM-1][a] ratio dGTP C 5.9 ± 0.1 4.0 ± 0.3 1.5 ± 0.1 1.36
5mC 3.5 ± 0.1 3.3 ± 0.3 1.1 ± 0.1
1a C 3.338 ± 0.001 20.7 ± 2.6 0.16 ± 0.02 2.58
5mC 1.12 ± 0.6 18.2 ± 1.6 0.062 ± 0.010
1b C 2.27 ± 0.06 15.8 ± 2.0 0.14 ± 0.02 4.24
5mC 0.91 ± 0.06 27.4 ± 4.0 0.033 ± 0.007
1c C 2.55 ± 0.04 24.1 ± 3.1 0.105 ± 0.015 1.08
5mC 1.47 ± 0.02 15.2 ± 1.4 0.097 ± 0.011
1d C 2.44 ± 0.14 78.8 ± 8.8 0.031 ± 0.005 1.48
5mC 1.19 ± 0.09 56.0 ± 7.7 0.021 ± 0.004
[a]
Data points derive from triplicates. ± describes SD.
Sequence primer: 5´-d(CGAAATGATCCCATCCAGCTGC)-3´
When increasing the steric bulk of the nucleotide modification, a decline of the ratio to 1.1 for nucleotide 1c and 1.5 for 1d can be observed. Having a closer look at the kinetic data depicted in Table 1, it can be seen, that discrimination between C and 5mC is mainly based on differences in kcat. For incorporation of all nucleotides, kcat is higher for processing opposite C than 5mC indicating more efficient incorporation opposite the template containing C, although KM was as well higher for the incorporation opposite C. Solely for processing of nucleotide 1b a lower KM can be observed for the incorporation opposite C. Hence, kcat/KM shows the best discrimination in case of 1b, proving 1b to be the most promising nucleotide in combination with KOD exo-.
Figure 21: Kinetic studies of incorporation of dGMP and 1a-d by KOD exo-. a) Partial primer / template sequence used;; b) left: chemical structure and PAGE analysis of single-nucleotide incorporation primer extension experiments of dGMP and nucleotides 1a-d employing KOD exo-. 50 µM dGTP or dG*TP and 5 nM KOD exo-
were used;; reactions were stopped after indicated time points;; right: steady-state kinetics of single-nucleotide incorporation of dGMP or dG*MP opposite C (black solid line) or 5mC (red dashed line). Experiments were done at least in triplicates.
3. Results and Discussion 48