• Keine Ergebnisse gefunden

Table S1.

N/A
N/A
Info
Herunterladen
Protected

Academic year: 2022

Aktie "Table S1."

Copied!
1
0
0

Wird geladen.... (Jetzt Volltext ansehen)

Jetzt herunterladen ( 1 Seite )

Volltext

(1)

Table S1. Characteristics of potential allergens in HSP70 family

MW Stability PI Antigenicity Hydrophilicity Relative abundances (%)

B9N9W6 71 900 stable 5.34 0.5714 hydrophilic 0.076

B9GEL5 94160 unstable 5.24 0.4785 hydrophilic 0.071

B9GJ14 73209 stable 5.56 0.5707 hydrophilic 0.141

B9HN74 73261 stable 5.56 0.5485 hydrophilic 0.011

B9HV59 62378 unstable 5.31 0.4412 hydrophobic 0.016

B9HMG2 71265 stable 5.14 0.5936 hydrophilic 0.060

B9HMG7 71173 stable 5.09 0.5741 hydrophilic 0.011

B9HMG8 71116 stable 5.13 0.6194 hydrophilic 0.049

B9HTJ7 71131 stable 5.09 0.5777 hydrophilic 0.005

B9NBF4 71139 stable 5.12 0.598 hydrophilic 0.049

Referenzen

Jetzt herunterladen ( DOCX - 1 Seite - 14.10 KB )

ÄHNLICHE DOKUMENTE

Table S1

Table S1 Radiocarbon dating analyses results of the sediment core TOC 11-04 Depth (cm) Conventional. radiocarbon age

Table S1

Transparent glaze, smooth and glossy surface with cracks, proper firing, well preserved, no obvious signs of corrosion.. 02 03

Table S1.

Determined material (NHMW, SDEI) Tetralobus crassicollis Laurent, 1964a Determined material (HNHM, MNHN, RMCA) Tetralobus curticollis Candèze, 1893. Determined material (HNHM,

Table S1.

The remaining ones required other combinations of forward (F) and reverse (R) primers. 1994) is 5’TCCAATGCACTAATCTGCCATATTA3’, which is different from primer Pat* used in this

Table S1.

selective imaging tumor in the presence of inflammation Braem et spontaneous DBA/1 2 groups, interventional glucose 18F no week 15 and clinical score, FDG

Table S1.

[r]

Table S1

[r]

Table S1.

The result was analysed after adjusting for age, sex, race, PIR, BMI, physical activity, diabetes, alcohol consumption, estimated glomerular filtration rate, CVD,