Table S1.

Determined material (NHMW, SDEI) Tetralobus crassicollis Laurent, 1964a Determined material (HNHM, MNHN, RMCA) Tetralobus curticollis Candèze, 1893. Determined material (HNHM,

The remaining ones required other combinations of forward (F) and reverse (R) primers. 1994) is 5’TCCAATGCACTAATCTGCCATATTA3’, which is different from primer Pat* used in this

Table S1 Radiocarbon dating analyses results of the sediment core TOC 11-04 Depth (cm) Conventional. radiocarbon age

Transparent glaze, smooth and glossy surface with cracks, proper firing, well preserved, no obvious signs of corrosion.. 02 03

selective imaging tumor in the presence of inflammation Braem et spontaneous DBA/1 2 groups, interventional glucose 18F no week 15 and clinical score, FDG

[r]

The result was analysed after adjusting for age, sex, race, PIR, BMI, physical activity, diabetes, alcohol consumption, estimated glomerular filtration rate, CVD,

[r]