• Keine Ergebnisse gefunden

Table S1

N/A
N/A
Protected

Academic year: 2022

Aktie "Table S1"

Copied!
2
0
0

Wird geladen.... (Jetzt Volltext ansehen)

Volltext

(1)

Table S1

Sample list of the all selected celadon shards from the Dalian Island shipwreck of the Yuan Dynasty.

Sample No. Appearance and state of conservation 01

Transparent glaze, smooth and glossy surface with cracks, proper firing, well preserved, no obvious signs of corrosion

02 03 04 05

06 Transparent glaze, rough surface, partially corroded,

contaminated cracks (No. 06), many white spots on the ridges and rim (No. 07)

07

08 Matt glaze, rough surface, seriously corroded, partly peeled, and efflorescent glaze layer (No. 09 and No. 10)

09 10

11 Underfired sample, opaque, smooth surface, slightly corroded Table S2

Summary of the supplemental characterization results

Sample No.

Crystalline phases detected by XRD*

OM and SEM results

Firing temperature (℃)

**

01 quartz The glazes are clear and

transparent, there are some scratches and pits on the surface, no obvious corrosion traces.

-***

02 not detected -

03 quartz -

04 - 1245

05 not detected -

06 not detected There are a large number of

hemispherically-shaped pits on the glaze surface and

1265

(2)

some yellow substances in the cracks.

07 not detected

There are a lot of white spots on the ridges and rim, which proved to be

corrosion craters.

-

08 quartz, anorthite, diopside It can be found in the manuscript.

1215

09 quartz, anorthite, diopside, quintinite 1190

10 -

There are densely spaced plate-like anorthite crystals in the glaze and the

surrounding glass phase was corroded, showing a porous structure.

-

11 - - 1060

* XRD was applied to the glaze surface of the samples.

** The firing temperature of the bodies was examined by dilatometer, and the method can be seen in Method section of the manuscript.

*** The sample has not been tested.

Referenzen

ÄHNLICHE DOKUMENTE

Table S1 Radiocarbon dating analyses results of the sediment core TOC 11-04 Depth (cm) Conventional. radiocarbon age

The remaining ones required other combinations of forward (F) and reverse (R) primers. 1994) is 5’TCCAATGCACTAATCTGCCATATTA3’, which is different from primer Pat* used in this

selective imaging tumor in the presence of inflammation Braem et spontaneous DBA/1 2 groups, interventional glucose 18F no week 15 and clinical score, FDG

[r]

[r]

The result was analysed after adjusting for age, sex, race, PIR, BMI, physical activity, diabetes, alcohol consumption, estimated glomerular filtration rate, CVD,

[r]

Note: RT-qPCR, reverse transcription quantitative polymerase chain reaction; VWF, von Willebrand factor; p38 MAPK, p38 mitogen-activated protein kinase;