Volltext
Table S1 The characteristics of 30 patients with ovarian cancer.
Variable Group Case (n, %)
Age (years)
≥50
<50
21 (70%) 9 (30%) FIGO stage
I II III IV
6 (20%) 12 (40%) 7 (23.3%) 5 (16.7%) Histological grade
G1-2 G3
18 (60%) 12 (40%) Tumor size (cm)
≥2
<2
16 (53.3%) 14 (46.7%) Familial status
sporadic familial
23 (76.7%) 7 (23.3%) Lymph node metastasis
Negative Positive
21 (70%) 9 (30%) CA-125 (U/mL)
≥500
<500
10 (33.3%) 20 (66.6%)
ÄHNLICHE DOKUMENTE
Table S1 Radiocarbon dating analyses results of the sediment core TOC 11-04 Depth (cm) Conventional. radiocarbon age
Transparent glaze, smooth and glossy surface with cracks, proper firing, well preserved, no obvious signs of corrosion.. 02 03
The remaining ones required other combinations of forward (F) and reverse (R) primers. 1994) is 5’TCCAATGCACTAATCTGCCATATTA3’, which is different from primer Pat* used in this
selective imaging tumor in the presence of inflammation Braem et spontaneous DBA/1 2 groups, interventional glucose 18F no week 15 and clinical score, FDG
[r]
[r]
The result was analysed after adjusting for age, sex, race, PIR, BMI, physical activity, diabetes, alcohol consumption, estimated glomerular filtration rate, CVD,
[r]
