Characterisation of the proto-oncoprotein DEK

(1)

Dissertation zur Erlangung des akademischen Grades des Doktors der Naturwissenschaften (Dr. rer. nat.)

Universität Konstanz

Mathematisch-Naturwissenschaftliche Sektion Fachbereich Biologie

vorgelegt von Ingo Scholten

Referenten: Prof Dr. Rolf Knippers Prof Dr. Winfried Boos

Termin der mündlichen Prüfung: 20.04.2004

(2)

Abstract ... 3

Zusammenfassung ... 4

1. Introduction... 6

1.1. Overview: DEK ... 6

1.2. Basic properties of DEK ... 7

1.3. DNA-binding and supercoiling... 8

1.4. Interactions with other proteins ... 10

1.4.1. DEK, a member of the exon-exon junction complex? ... 10

1.4.2. Association with chromatin-proteins... 10

1.4.3. Binding to the viral protein LANA ... 11

1.5. The DEK-CAN proto-oncoprotein ... 11

1.6. DEK and cell proliferation / differentiation ... 13

1.7. DNA-damage response... 14

1.7.1. DNA double-strand break repair: the ATM pathway... 14

1.7.2. DEK and DNA repair ... 16

1.8. Aims ... 17

2. Materials & Methods... 18

2.1. Reagents... 18

2.2. Standard Techniques ... 18

2.3. Molecular Biology and Biochemistry... 18

2.3.1. Cloning... 18

2.3.2. Vectors and Constructs... 20

2.3.3. Expression and Purification of his-tagged DEK... 27

2.3.4. Far Western and South Western Blotting... 27

2.3.5. 2D protein gel electrophoresis... 29

2.3.6. Two Hybrid System ... 30

2.4. Cell Culture ... 32

2.4.1. Cell-Lines ... 32

2.4.2. RNA Interference ... 32

2.4.3. Overexpression: 'tet-off' System... 33

2.4.4. Irradiation of Cells ... 33

2.4.5. FACS ... 33

2.5. Immunocytochemistry and Antibodies... 34

3. Results ... 36

3.1. Basic characterisation ... 36

3.1.1. DEK antibodies and GFP-DEK... 36

3.1.2. Expression-levels and isoelectric point ... 44

3.1.3. RNA interference: DEK knock-down ... 45

3.1.4. DEK overexpression ... 54

3.2. Co-immunolocalisation ... 55

3.2.1. DEK and splicing... 55

3.2.2. Co-localisation with nuclear markers... 59

3.3. Yeast two-hybrid screening ... 65

3.3.1. Library screening... 65

3.3.2. Testing DEK fragments for multimerisation... 71

(3)

3.4. Biochemical assays with recombinant DEK fragments... 74

3.4.1. Cloning and expression of DEK fragments ... 74

3.4.2. Far Western blotting... 77

3.4.3. South Western ... 86

3.4.4. GFP- DEK-fragments ... 90

3.4.5. Summary DEK domains... 93

3.5. DEK and DNA damage response / DNA repair ... 94

4. Discussion ... 109

4.1. DEK knock-down shows that DEK is not essential for cell-survival... 110

4.2. GFP-DEK is highly mobile but maintains chromatin microdomains over several minutes... 112

4.3. DEK does not co-localise to any of the used nuclear marker proteins ... 113

4.4. Protein interactions of DEK ... 114

4.4.1. DEK contains a multimerisation domain that is regulated by phosphorylation ... 115

4.4.2. DEK does not bind to isolated histones in the far Western blot... 117

4.4.3. Reports of an involvement of DEK in mRNA processing are due to an unspecific antibody... 118

4.5. DEK is not involved in the ATM DNA-damage response pathway ... 119

4.6. Conclusions and speculations... 124

4.6.1. DEK is unlikely to cause enhanced cell proliferation, differentiation and cancer and is not a 'proto-oncogene'... 124

4.6.2. DEK-CAN and 'genomic stability': DEK-CAN may contribute to the constitutive activation of a receptor tyrosine kinase ... 126

4.6.3. Supercoiling and four way junction binding: DEK, an 'architectural' protein? ... 128

4.6.4. Outlook... 131

5. Appendix ... 134

5.1. Abbreviations ... 134

5.2. Figures ... 135

5.3. Tables ... 136

6. Literature ... 137

(4)

Abstract

DEK was discovered in 1992 as one part of the fusion protein DEK-CAN in a patient suffering from myeloid leukemia. This has prompted interest in the cellular function of the putative 'proto-oncogene' DEK. Consequently the protein has been involved in mRNA metabolism, transcriptional control and DNA repair, but a definite function has not been found yet. DEK's prominent feature is the ability to introduce constrained positive supercoils into DNA.

In this thesis functional domains of DEK were characterised biochemically and different approaches were used to find out more about DEK's cellular function.

Biochemical characterisation confirmed that the evolutionarily conserved fragment DEK 87-187 containing the DNA-box motif SAP indeed has DNA-binding activity. The fragment acts as a 'supercoiling domain', it is sufficient to change the topology of DNA (Kappes, Scholten et al. submitted). In addition, a second DNA-binding domain has been found between amino acids 270 and 350. This region also contains a multimerisation domain, identified in a search for protein interaction partners of DEK with the yeast two-hybrid system and confirmed by far Western blotting. Both DNA- binding and multimerisation are modulated by phosphorylation in a co-ordinated manner, DNA-binding is inhibited and multimerisation is enhanced.

Although DEK is expressed in all human cell-types examined so far, a knock-down by RNA interference showed that DEK-depleted cells have no distinct phenotype. In particular, no evidence was found for the reported influence of DEK on the DNA double-strand break response pathway after knock-down or overexpression.

Immunolocalisation studies showed that DEK binds to fine granular subdomains ('microdomains') of chromatin not shared by any of the co-stained nuclear marker proteins. In particular, it was demonstrated that DEK is absent from splicing- compartments and thus is unlikely to be involved in splicing, which was reported previously. The mean residual time of the single GFP-DEK molecules on chromatin is only seconds, but DEK is shown to maintain microdomains for several minutes. DEK phosphorylation that stimulates the multimerisation activity could help to establish and sustain these dynamic structures.

It has been described that DEK changes the topology of DNA in vitro, whereas it is proposed here that its cellular function could be to act as a sensor that binds preferentially to torsionally stressed DNA, recruiting other factors such as repair proteins to these sites.

(5)

Zusammenfassung

DEK wurde 1992 als Bestandteil des Fusionsproteins DEK-CAN entdeckt, in einem Patienten der an Myeloider Leukämie erkrankt war. Dies hat das Interesse an der zellulären Funktion des möglichen 'Proto-Onkogens' DEK geweckt. Es wurden eine Beteiligung am mRNA Metabolismus, an der Transkriptionskontrolle und an der DNA-Reparatur vorgeschlagen; keiner dieser Vorschläge konnte jedoch bisher funktionell bestätigt werden. Die herausragende Fähigkeit von DEK ist es, fixierte, positive Überdrehungen ('supercoils') in DNA einführen zu können.

In dieser Arbeit wurden funktionelle Domänen von DEK biochemisch charakterisiert, außerdem wurden verschiedene experimentelle Ansätze verfolgt, um mehr über die zelluläre Funktion von DEK herauszufinden. Die biochemische Charakterisierung bestätigte, dass das evolutiv konservierte Fragment DEK 87-187, welches das DNA- Box Motiv 'SAP' trägt, tatsächlich DNA-Bindungsaktivität besitzt. Das Fragment fungiert als 'supercoiling' Domäne und reicht aus, die Topologie von DNA zu verändern (Kappes, Scholten et al., eingereicht). Eine zweite DNA-Bindedomäne wurde zwischen den Aminosäuren 270 und 350 gefunden. Diese Region enthält auch eine Multimerisierungsdomäne, die bei der Suche nach Protein-

Interaktionspartnern von DEK im Hefe Zwei-Hybrid System gefunden wurde. Mittels 'far Western' Experimenten konnte die Funktion dieser Domäne bestätigt werden.

Sowohl DNA-Bindung als auch Multimerisierung werden durch Phosphorylierung moduliert; DNA-Bindung wird inhibiert und Multimerisierung verstärkt.

Obwohl DEK in allen bis jetzt untersuchten Zelltypen im Menschen vorkommt, zeigt eine Reduktion der DEK Protein-Menge mittels RNA Interferenz auf unter 15%

keinen erkennbaren Phänotyp. Insbesondere wurden keine Hinweise für den

berichteten Einfluss von DEK auf die zelluläre Antwort auf DNA Doppelstrangbrüche gefunden, weder nach einem DEK 'knock-down', noch nach einer Überexpression.

Immunolokalisationsstudien zeigen, dass DEK an granuläre Substrukturen des Chromatins ('Mikrodomänen') bindet, an die keines der zusätzlich gefärbten nukleären Markerproteine bindet. Im Gegensatz zu früheren Berichten wurde gezeigt, dass sich DEK nicht in Spleißkompartimenten befindet und deswegen vermutlich auch nicht beim Spleißen beteiligt ist. Obwohl die durchschnittliche Aufenthaltsdauer einzelner GFP-DEK Moleküle auf dem Chromatin nur Sekunden beträgt, konnte nachgewiesen werden, dass DEK-Mikrodomänen über mehrere

(6)

Minuten stabil sind. Phosphorylierung von DEK, welche die Multimerisierung stimuliert, könnte dazu beitragen diese dynamischen Strukturen einzurichten und aufrecht zu erhalten.

Es wurde beschrieben, dass DEK die Topologie von DNA verändert. Es könnte allerdings sein, dass die zelluläre Funktion von DEK die eines Sensors ist, der bevorzugt an Orte hoher Torsionsspannungen auf der DNA bindet. Damit könnten andere Faktoren, wie beispielsweise DNA-Reparaturproteine, an die Orte des Geschehens rekrutiert werden.

(7)

1.1. Overview: DEK

DEK was found in 1992 as one part of the fusion protein DEK-CAN in a patient suffering from myeloid leukemia (AML; von Lindern et al. 1992). The fusion event was the result of a chromosomal translocation, transferring most of the can gene in frame from chromosome 9 to the last intron of the dek gene on the long arm of chromosome 6. Can is coding for a nuclear pore complex protein. Basic

characterisation of DEK followed, and it was recognised that DEK is a nuclear phosphoprotein that is bound to chromatin during the whole cell cycle (Sierakowska et al. 1993; Fornerod et al. 1995). The protein has no homology to any other protein apart from a DNA-binding domain, the 'SAP'-box (Aravind and Koonin 2000).

Alexiadis et al. (2000) and Waldmann et al. (2002, 2003) found that DEK changes the topology of chromatin or naked DNA by introducing constrained positive supercoils into DNA.

Shortly after the identification of DEK, it was recognised that auto-antibodies to DEK can be found in inflammatory autoimmune diseases such as juvenile rheumatoid arthritis (Sierakowska et al. 1993) or systemic lupus erythematosus (Dong et al.

1998). A study involving over 600 patients with various autoimmune diseases clarified that anti-DEK autoantibodies are not preferentially associated with a particular disease, but rather with a variety of inflammatory conditions with an incidence of around 40% (Dong et al. 2000).

Several theories about DEK's function were put forward in recent years: DEK was thought to be involved the ATM (ataxia telangiectasia mutated) DNA-damage response pathway (Meyn et al. 1993) or in transcriptional regulation and signal transduction (Fu et al. 1997). DNA-array studies linked DEK overexpression to various cancers different from leukemia (e.g. Kondoh et al. 1999; Kroes et al. 2000).

And finally, Le Hir et al. proposed a role of DEK in mRNA metabolism (Le Hir et al.

2000).

But despite nearly a dozen years of research the mechanism that causes leukemia in DEK-CAN rearranged cells, as well as a definite cellular function of DEK remained unknown.

(8)

1.2. Basic properties of DEK

DEK is an abundant nuclear protein found in multicellular organisms (plants, fungi and animals) as well as in some single celled protozoa such as Trypanosoma. It is absent from yeast. DEK proteins vary considerably in length, Drosophila DEK consists of over 660 amino acids while Xenopus DEK is shorter than 300 amino acids. All DEK proteins share an unique conserved region around the SAP-box, a DNA-binding motif found in chromatin-associated proteins (SAP =

SAF/Actinus/PARP, Aravind and Koonin 2000). A second conserved domain is located towards the C-terminus of DEK in some, but not all organisms (Fig. 1).

Fig. 1 Features of DEK. The protein contains 375 amino acids, with a high percentage (45%) of charged amino acids. The only domain homologous to other proteins is the DNA-binding domain SAP, which can be found in about 40 chromatin-associated proteins.

The human dek-gene is located on chromosome 6 (6; p23) and contains 11 exons.

Transcription is controlled by a housekeeping-promoter that lacks a TATA-box but contains a CCAATT-box. The zinc-finger protein Ying Yang 1 that may activate DEK transcription through binding to a YY1-box in the promoter-region (Sitwala et al.

(9)

2002). DEK mRNA contains 1.5kb 3' untranslated region (UTR), in comparison to 1.2kb coding region. Potential regulatory elements controlling mRNA stability and/or translation efficiency on the 3'UTR have not been described yet. Alternative splicing or variations in the coding region that would lead to different protein sequences are unknown.

The protein is expressed in all human and mouse tissues examined so far and contains 375 amino acids. Apart from the SAP-box other recognisable features are a bipartite nuclear localisation sequence (NLS) and four distinct acidic stretches in the overall highly charged protein (over 45% charged amino acids). The calculated isoelectric point of human DEK is 8.6, but phosphorylation shifts the isoelectric point to 6.8 and 7.3 in Hela cells (Sierakowska et al. 1993).

DEK is localised strictly nuclear at a copy number of about 1.5x10⁶ per Hela cell (Kappes et al., 2001). The protein-level of DEK does not change during the cell cycle and the protein is bound to chromatin at all times, including metaphase (Kappes et al., 2001). Casein Kinase 2 (CK2) is the enzyme responsible for most of DEK's phosphorylation, and DEK is slightly more phosphorylated in G1-phase compared to the S-phase of the cell-cycle (Kappes and Gruss submitted). Since protein-levels are constant and alternative splicing is absent, phosphorylation is the only regulatory factor found so far for the DEK protein.

1.3. DNA-binding and supercoiling

Alexiadis et al. (2000) showed that DEK changes the topology of circular chromatin templates, such as simian virus 40 (SV40) minichromosomes. Incubation of

minichromosomes with DEK and topoisomerase I results in a topoisomer ladder that can be visualised by separating the DNA on a gel after removal of the proteins. The different steps of the topoisomer ladder correspond to chemically identical DNA- molecules, which only differ in their three-dimensional conformation: On top of the natural helical turns of relaxed DNA, superhelical over- or 'under'- winding by DEK results in supercoils that are fixed by topoisomerase I (Fig. 2).

(10)

Fig. 2 The DEK-topology assay.

Supercoiled SV40 DNA was incubated with topoisomerase I, which relaxes the DNA circle (first lane). When DEK is added together with topoisomerase I (last three lanes), a topoisomer ladder can be

observed. The steps of the ladder from top to bottom correspond to increasing

numbers of supercoils in the circular SV40 DNA (modified from Kappes, Scholten et al. submitted). The reaction does not need free energy in the form of ATP. Note that Alexiadis et al. used chromatin-templates, which are negatively supercoiled after deproteination because supercoils hitherto constrained by nucleosomes are released.

Waldmann et al. (2002 and 2003) extended the findings of Alexiadis et al. by

demonstrating that the orientation of the supercoils introduced by DEK where positive (= overwinding). Second, naked DNA suffices as the target molecule, a chromatin- template and thus nucleosomal packaging is not needed for the reaction. In addition, they clarified that the positive supercoils are not free, but are constrained by the DEK and are only released upon the removal of the protein. The mechanism of introducing supercoils remains elusive, but a wrapping mechanism similar to that of nucleosomes (although with an opposite orientation) has been ruled out by electron microscopic analysis. DEK binds preferably to four way junction and supercoiled DNA (Waldmann et al., 2003), and from this structure specificity the authors suggest a role of DEK in chromatin architecture.

The group of Markovitz identified the HIV-2 promoter-sequence pets as a specific binding-site for DEK and thus considered DEK to be a sequence-specific

transcription factor (Fu et al. 1997; Faulkner et al. 2001). In contrast to this Alexiadis et al. showed that the change in topology is independent of the underlying DNA sequence. Neither G. Grosveld (Grosveld 2002) nor Waldmann et al. (2003) could find sequence-specificity. The latter recently demonstrated that recombinant DEK binds equally well to both wild type and mutant pets-site. Consequently, DEK may have structure, rather than a sequence-specificity for DNA.

(11)

1.4. Interactions with other proteins

Reported DEK interactions with other proteins can be divided into three classes: first members of the post-splicing exon-exon junction complex (EJC), then interactions with other chromatin proteins such as histones, Daxx, the transcription factor AP2 and a histone deacetylase and finally the interaction with a viral protein, LANA.

1.4.1. DEK, a member of the exon-exon junction complex?

DEK's assumed involvement in mRNA-splicing or post-splicing events such as mRNA export or nonsense mediated decay were based on DEK binding to the exon- exon junction complex (EJC), a protein complex laid down at the exon-boundaries by the spliceosome (Le Hir et al. 2000; Le Hir et al. 2001). In addition, a direct

interaction between DEK and SRm160, an established member of the exon-exon complex, has been found McGarvey et al. 2000. However, publications of at least four different groups, including the group that made the initial discovery, now reject that DEK is part of the exon-exon complex (Lykke-Andersen et al. 2001; Lejeune et al. 2002; Gatfield and Izaurralde 2002; Reichert et al. 2002). The reason for the erroneous initial findings probably was a polyclonal DEK-antibody that recognised not only DEK but also an unidentified 20kD protein of the splicing machinery (Reichert et al. 2002).

1.4.2. Association with chromatin-proteins

Three publications report an interaction between DEK and other chromatin proteins.

First, DEK binds to histones in vitro, preferentially to H2A and H2B (Alexiadis et al.

2000). It was discussed that this interaction may be necessary for DEK's ability to modify the topology of chromatin. However, Waldmann et al. (2002) subsequently showed that this is not the case, since DEK can carry out the same reaction on naked DNA.

Second, Hollenbach et al. (2002) reported that FLAG-tagged DEK was present in a complex with the transcriptional co-repressor Daxx, histone deacetylase II (HDAC II) and core histones, especially acetylated histone H4. The authors suggest that DEK may contribute to transcriptional repression by binding to Daxx.

(12)

Finally, DEK may to bind to the transcription factor AP-2α (Campillos et al. 2003).

The authors demonstrated that N-terminally truncated DEK (GST-DEK 80-375) increases the transcriptional activity of an AP-2α controlled luciferase reporter-gene in the presence of AP-2α. They hypothesised that DEK might enhance binding of AP- 2α to DNA through 'transient, activating' contacts between DEK and AP2α before DNA-binding.

1.4.3. Binding to the viral protein LANA

Krithivas as et al. showed that the viral protein LANA (latency-associated nuclear antigen) binds to two cellular proteins, the methyl CpG binding protein MeCP2 and DEK (Krithivas et al. 2002). LANA is expressed by a human virus, the Kaposi's Sarcoma-associated Herpesvirus, and is used as a transcription factor and for episomal maintenance: It tethers viral genomes to human chromosomes during mitosis to ensure virus propagation. The authors show that it does so by binding to MeCP2 and/or DEK, respectively.

1.5. The DEK-CAN proto-oncoprotein

Dek was first identified as a fusion gene in a patient with acute myeloid leukemia (von Lindern et al. 1992). In this subtype of myeloid leukemia, a piece of the long arm of chromosome 9 is transferred to the short arm of chromosome 6 and vice versa (translocation t(6;9)(p23;q34)). The break points on the chromosomes lie in introns of the genes dek (chromosome 6) and can (chromosome 9), respectively.

This creates the chimerical dek-can gene on the rearranged chromosome 6, consisting of nearly full-length DEK (apart from 25 amino acids at the C-terminus) fused to the C-terminal two-thirds of CAN. The latter was already known to be a nuclear pore protein in 1992, whereas dek was a novel gene of unknown function. It was named after the patient (initials: "DK"), whose DNA was analysed by von Lindern et al. The fusion-point on the rearranged chromosome 9 has not been examined yet.

The t(6;9) DEK-CAN subtype of myelotic leukemia is relatively rare, occurring in about 1% of adult and in 2% of childhood acute myeloid leukemiae, respectively

(13)

[Slovak, Kopeckly, … Blood 2000 + Ma et al. 1999]. One percent of all AML cases in Western counties means that two to three adults per 10 million are affected each year (Thiede et al. 2002). The t(6;9) dek-can subtype is classified as "AML-M2Baso"

which means that excess proliferation of haematopoietic precursor cells results in an surplus of mostly basophile granulocytes. The progress of myeloid differentiation is relatively advanced ("M2") and the chance of survival is intermediate (according to www.pathologyoutline.com) to poor (Hamaguchi et al. 1998).

Boer et al. (1998) addressed the question whether the fusion protein by itself is sufficient to cause malignant transformation of myeloid cells. This is necessary, since cytogenetic analysis is incomplete and it is unknown whether other genes are

affected as well, or if additional anomalies are present. The authors overexpressed DEK-CAN in U937 myeloid precursor cells under the influence of an inducible promoter. Upon induction of these cells to maturate it was shown that DEK-CAN did not interfere with myeloid differentiation. Moreover, the proliferation of these cells was slightly inhibited, both arguing against a contribution of DEK-CAN to leukemic transformation. Since U937 cells represent an intermediate state of monocytic development, the authors do not rule out that earlier myeloid precursors might be stimulated to proliferate by DEK-CAN (Boer et al. 1998).

A permanent cell line with the t(6;9) translocation from a patient suffering from AML exists (Hamaguchi et al. 1998). Leukemic blasts (= immature blood cells) were isolated from the patient and a permanent clone, FKH-1, was selected by repeated passaging of the growth factor stimulated culture. The clone was derived from an early stage, maybe even an multipotent stem cell, since it can develop into

macrophages or the various granulocytes upon stimulation.

Unpublished results of the Grosveld-group (Scientific Report 2002, St. Jude Children's Research Hospital) seems to confirm that DEK-CAN stimulates the proliferation of early haematopoietic progenitors. Retroviral transduction of dek-can into mouse bone marrow cells leads to a steady increase of the percentage of DEK- CAN-positive cells. Thus these cells must have proliferated more quickly than the others. Upon transfer to methylcellulose, which promotes the proliferation of more

(14)

mature progenitors, the percentage of DEK-CAN positive cells decreases. More important is the finding that expression of DEK-CAN alone in transgenic mice ('knock-in mice') is not sufficient to cause leukemia (Grosveld 2002). These results suggest that other factors than the DEK-CAN fusion protein might be causative for the development of leukemia.

1.6. DEK and cell proliferation / differentiation

Besides DEK-CAN, the 'proto-oncoprotein' DEK (Dong et al. 1998) has also been connected to cancer. These malignant cells do not have the (6;9) transformation and therefore do not express DEK-CAN.

Aberrantly proliferating cells and transformed cell lines have higher dek-mRNA levels compared to cells from normal tissues (according to Gene Expression Atlas,

www.gnf.org). This has also been shown for skin- (Grottke et al. 2000), liver- (Kondoh et al. 1999) and brain cancer (Kroes et al. 2000), as well as for non t(6;9) acute myeloid leukemia (Larramendy et al. 2002) using microarrays or differential display. The dek level seems to be the higher, the more the tissue is out of normal growth control since dek-levels are proportional to the histological grading of tumorous liver tissue (Kondoh et al. 1999). The authors also suggest that the expression of dek is 'growth'-regulated, since its expression was synchronous to cyclin A expression, which is S-phase specific.

The amount of dek mRNA also appears to be influenced on the differentiation status of cells in a tissue-dependent manner. Dek has been reported to be upregulated in immature ('promyelotic') HL-60 and hepatocellular carcinoma (HCC) cells (Savli et al.

2002 Kondoh et al. 1999), but downregulated in undifferentiated skin cells (Huang et al. 1999) in comparison to the respective cells induced to differentiate.

On the protein-level, Kappes et al. (2001) found no difference of DEK in Hela-cells during the cell cycle, in contrast to the findings of Kondoh et al. using mRNA

(15)

1.7. DNA-damage response

DEK may be involved in ATM (ataxia telangiectasia mutated) dependent DNA- damage response (Meyn et al. 1993). After a brief introduction to this pathway, the evidence for DEK's putative involvement in DNA-repair is given.

1.7.1. DNA double-strand break repair: the ATM pathway

DNA double-strand breaks are primarily repaired via the ATM-pathway (reviewed by Abraham 2001; Shiloh 2003). The corresponding recessive genetic disease is characterised by sensitivity to ionising radiation and abnormalities in the immuno-, nervous- (ataxia: trembling of muscles) and endocrine system (telangiectasia:

widened blood vessels in eyes and face) when both alleles of the ATM gene are affected.

ATM is a kinase, and as a response to DNA double-strand breaks ATM dimers activate themselves by reciprocal phosphorylation at their inhibitory FAT domains (Bakkenist and Kastan 2003). Active ATM kinases phosphorylate over a dozen targets, influencing cell-cycle checkpoints, the stress-response network, DNA-repair and - if necessary - induce apoptosis (Shiloh, 2003). A simplified overview (Fig. 3) shows the effect of ATM phosphorylation after DNA ds-breaks on a cell being in S- phase of the cell cycle. Only three phosphorylation-targets are shown in more detail:

the 'tumor suppressor' p53', involved in cell-cycle control and apoptosis, the checkpoint kinase CHK2 and the histone variant H2AX.

(16)

Fig. 3 The ATM pathway during S-phase of the cell cycle. Simplified overview highlighting the ATM-targets γH2AX, CHK2 and p53 (after Shiloh (2003) and Abrahams (2001)). There is extensive cross-talk between the different 'branches' leading to DNA-repair, check-point control and apoptosis;

this is only indicated for Checkpoint Kinase 2 (CHK2). Cdk2 (in a complex with cyclin E/A) drives S- phase progression, so the symbol for 'negative regulation' was chosen for 'inhibition of DNA synthesis'.

(17)

The phosphorylation status of Chk2 and H2AX can be used as markers to monitor the activity of the ATM ds-break response pathway (see chapter 3.5). The

phosphorylated form of H2AX, 'γ'H2AX, recruits DNA-repair complexes to sites of DNA ds-lesions. In S-phase, repair by homologous recombination (HR) is possible, requiring a large number of proteins, e.g. the RAD51-complex, Nijmegen Breakage Syndrome protein 1(NBS1), Breast Cancer (associated) protein 1 and 2, Bloom's syndrome helicase (BLM) and others. Checkpoint Kinase 2 (CHK2) is involved in controlling several cell-cycle checkpoints: G1→S and intra S via CDC25A (and subsequently CDK2), S→G2 by BRCA1 phosphorylation and intra G2 via CDC25C (which dephosphorylates CDK1). In addition, it influences DNA-repair and apoptosis via BRCA1 and p53, respectively.

1.7.2. DEK and DNA repair

There are three reports indicating that DEK might be involved in DNA-repair. DEK- expression is controlled by the putative tumor suppressor p33^ING1, which is activated upon DNA damage (Takahashi et al. 2002). According to the authors, this could imply a role for DEK in DNA-damage response. In addition, Aravind and Koonin (2000) analysed proteins containing the 'SAP' DNA-binding domain and conclude that "the SAP motif also consistently co-occurs with DNA-repair-associated" proteins.

Meyn et al. (1993) showed that overexpression of a carboxy-terminal fragment of DEK (amino acids 310-375) revert the malignant phenotype of ATM^-/- fibroblasts after DNA-damage. In this study, DEK 310-375 prevented hyperrecombination and re- activated apoptosis after ionising irradiation or chemical induction of DNA double- strand breaks. In addition, "radio-resistant DNA synthesis" (= G1 → S and intra S- phase checkpoint failure) after DNA-damage was stopped. Apart from DEK, a topoisomerase III fragment that acts in a dominant-negative way (Fritz et al. 1997) was also able to revert the AT phenotype. Topoisomerase III influences repair by homologous recombination (HR, e.g. Gangloff et al. 1999) through modulation of RecQ-like helicases (Bloom's and Werner's syndrome helicases in humans). The fact that topoisomerase III is a genuine DNA-damage response-factor also substantiates

(18)

the theory that DEK is involved in the ATM-pathway, since both proteins have similar effects in ATM^-/- cells.

1.8. Aims

Aim of this study is to find the cellular function of DEK. This will be done by finding interaction partners of DEK with the yeast two-hybrid system and by co-

immunolocalisations with nuclear marker proteins. In 2001, RNA interference became available as a tool to knock-down a given protein in cell-culture. The phenotype of DEK-depleted cells may give further clues to DEK's function. Another approach is to follow evidence that DEK may be involved in DNA-repair.

A second line of experiments is the biochemical characterisation of DEK using

recombinantly expressed DEK fragments. This should answer the question where the DNA-binding domain, the supercoiling activity and the putative histone-binding

domain are located on the DEK protein. It should also clarify whether there is a DEK- DEK multimerisation domain, as suggested by electron microscope studies from Alexiadis and Waldmann (Waldmann et al. 2002).

(19)

2. Materials & Methods 2.1. Reagents

Bulk chemicals and buffers were obtained from Fluka, Sigma, Riedel de Haen and Merck. Growth media was from Gibco (now part of BD Bioscience) and Sigma. Enzymes for molecular biology (restriction and other nucleases, kinases, ligase) were produced by Roche, New England Biolabs, Stratagene and BD Bioscience. Radioisotopes came from ICN. Goldbaeren were from Haribo.

2.2. Standard Techniques

Standard protein techniques like sodium-dodecylsulfate polyacrylamide gel electrophoresis (SDS- PAGE), Coomassie staining and Western blotting were performed according to "Current Protocols in Molecular Biology" (Ausubel et al. 1988). Ordinary methods used in molecular biology such as polymerase chain reaction (PCR), cloning and agarose gel electrophoresis were form "Cloning - a practical approach." (Sambrook et al. 2001).

2.3. Molecular Biology and Biochemistry 2.3.1. Cloning

His-tagged bacterial expression vectors.

Full-length dek and dek coding for amino acids 1-350 were cloned into pQE-30 (Qiagen) using Bam HI (5') and Kpn I (3') cutting-sites generated by PCR using pRSET-A DEK from Susanne Heiland

(Konstanz) as a template. Full-length dek and dek fragments (see Table 2) were then cloned into pRSET-A in a similar manner by PCR, generating Bam HI (5') and Eco RI (3') cutting-sites. The constructs were checked by sequencing.

Baculovirus system, GST-tagged DEK bacterial expression, Two-hybrid system

Dek fragments with 5' Eco RI and 3' Xho I cutting sites were generated by PCR using pQE-30 DEK as a template. A stop codon was introduced before the Xho I site and the PCR-product was cloned into pCR-Blunt II-TOPO, using Invitrogen's Blunt-end-Topo-kit. Fragments excised with Eco RI and Xho I from pCR-vectors were then subcloned into pBlueBacHis2-B cut with Eco RI and Sal I (Baculovirus system, Invitrogen), as well as in pGEX-4T-1 (GST-tag bacterial expression vector, Amersham), pEG202 and pJG4-5 (both two-hybrid vectors, gift from A. Porsche and S. Steppan, Konstanz) cut with Eco RI and Xho I. Note that the 3' cloning site of the pBlueBacHis2-B constructs consist of Xho I / Sal I hybrid-sites that cannot be recut with either enzyme. It is possible to subclone from pGEX-4T-1 into pRSET with Bam HI and Xho I, and into pQE with Bam HI and Sal I (pQE) / Xho I (pGEX).

Exceptions from this scheme were the pEG202-DEK-clones 1-350, 1-310, 87-187, 87-375, and 310- 375, which were cloned using Eco RI and Bam HI introduced by PCR. pEG202-DEK 1-350 and 1-310 have no stop-codon before the Bam HI-site, the other pEG202 clones have a stop-codon. The clones with stop-codon (DEK 87-187, 87-375 and 310-375) were subcloned into pBlueBacHis2-B using Eco RI and Xho I (pEG202) / Sal I (pBlueBacHis2-B).

The third exception is full-length dek, which was subcloned by F. Kappes from pRSET-A-DEK (I.

Scholten) into pBlueBacHis2-A (Invitrogen) using the Bam HI and Eco RI restriction sites. For cloning of the DEK-probe for far Western blotting that contains a protein kinase A (PKA) phosphorylation-site see 2.3.4. All constructs except for the pGEX-4T-1 clones were checked by sequencing.

"Tet"-off system

Four DEK fragments were subcloned from pBlueBacHis2 into the "Tet-off" vector pTre2hyg (BD Bioscience). pTre2hyg-his-DEK 1-375 contains full-length DEK including the complete 5' coding sequences from pBlueBacHis2-A with the his-tag, to facilitate protein-purification from Hela cells. With this construct it is also a possible to carry out co-purifications. his-dek was excised from

pBlueBacHis2-A-DEK 1-375 using Bsr BR I and Dra I, and cloned into pTre2hyg linearised with Pvu II.

The orientation of the insert was checked digesting with Bam HI.

pTre2hyg-DEK 1-375 expressing DEK without any additional amino acids from pBlueBacHis2-A was cloned cutting pBlueBacHis2-A-DEK 1-375 with Bam HI (5') and Dra I (3') an ligating into pTre2hyg cut

(20)

with Bam HI and Pvu II. The same strategy was used for cloning DEK 1-310 from pBlueBacHis2-B into pTre2hyg.

Finally, DEK 310-375 was cloned into pTre2hyg linearised with Bam HI. The source-vector, pBlueBacHis2-B-DEK 310-375 contains Bam HI-sites at both flanks of the insert, due to its cloning history (it was itself subcloned from the two-hybrid vector pEG202, see above). The correct orientation of DEK 310-375 in pTre2hyg was checked digesting with Hind III (cuts in vector directly after the insert) and Bgl II, which cuts at 5' end of the insert if correctly cloned.

GFP-fusion constructs

Three dek-fragments were cloned into pEGFP-N1 (BD Bioscience): dek 1-375, dek 87-375 and dek 87-310 using Eco RI and Bam HI-sites introduced by PCR. A stop-codon was not included, because the egfp-open reading-frame (ORF) is located 3' in of the insert in this vector.

To make use of the many dek-inserts cloned for the Baculovirus-system, the vector had to be switched to pEGFP-CI, because the Baculovirus-system fragments all have a stop-codon at the 3' end. pEGFP- CI expresses fusion proteins with GFP at the N-terminal end of the fusion protein, thus the stop-codon does not interfere here. First, a simian virus 40 (SV40) nuclear localisation signal (NLS; amino acid sequence: PPKKKRKVA) was cloned into pEGFP-CI, creating pEGFP-CI-[NLS], to ensure localisation of constructs to the nucleus. The following two oligonucleotides were annealed to serve as the NLS- coding insert:

Xho I ┌--- SV40-NLS ---┐ Eco RI for 5' TCG AGC T∆∆ CCT CCA AAA AAG AAG AGA AAG GTA GCT G 3' rev 3' CG A∆∆ GGA GGT TTT TTC TTC TCT TTC CAG CGA CTT AA 5'

This first insert also introduces a minus-2bp -shift ("∆∆"), bringing the sequence after the Eco-RI-site in frame with the Baculovirus-inserts. pEGFP-CI-[NLS] was digested with Eco RI and Sal I to enable it to take up the dek-fragments cut with Eco RI and Xho I. A Xho I / Sal I hybrid site is generated 3' of the insert after ligation. Successfully subcloned DEK-fragments are listed in Table 2.

His-tagged PKA-histones

First, a protein kinase A (PKA) phosphorylation-site (amino acid sequence: RRAS*V) was cloned into the bacterial expression vector pRSET-B cut with Bam HI and Xho I, using the annealed

oligonucleotides below as an insert, thus creating pRSET-B-PKA:

Bam HI ┌--- PKA-site ----┐ Xho I 5' GATCC CGT CGT GCA TCT GTT C 3' 3' G GCA GCA CGT AGA CAA GAG CT 5'

Xenopus laevis histone-cDNAs were kindly provided by Luger (Luger et al. 1997). Xho I (5') and Eco RI (3') cutting sited were introduced by PCR, and the cut PCR-products were cloned into pRSET-B- PKA.

Sequence of Histone-clones as provided by Luger (Luger et al. 1997) H2A = Xenopus laevis H2A.1 (accession number gi121966) with 3 exceptions:

• N-terminal M is missing (this is cleaved off in vivo anyway)

• G100ÆR (humans and mice have the R here, so that is probably intended by Luger et al)

• A124ÆS (Xenopus laevis H2A.2 has a S here, too; so perhaps the authors tried to create an artificial H2A “consensus” sequence)

H2B = "Chain D, 2.6A Crystal Structure Of A Nucleosome Core Particle (…)" (= database entry, accession: gi11513400). 1 exception:

• first 4 amino acids are missing in our sequence:

database: N-terminus MPEPAKSA…C-terminus. The plasmids from Luger starts with MAKSA... Here, the first M is omitted (since it is cleaved in vivo) and thus our

sequence is AKSA → first 4 amino acids are missing compared to the databank sequence.

H3 = histone H3 from X. laevis (accession-number gi64772) = Mus musculus (accession gi7305139) and other animal histone H3 proteins. 2 exceptions:

• The first amino acid is omitted (M). It is cleaved off in vivo anyway.

(21)

• G103Æ A. A103 is already present in the clone we obtained from Luger et al.

H4 = Xenopus laevis H4 (accession: gi64765), 1 exception:

• Start- methionine omitted.

Summary: We have used clones from K. Luger (Luger et al. 1997). The only difference to the provided sequences are that we omitted the start-methionines for expression in E.coli, since these are cleaved off in vertebrates. Curiously, the sequences Luger sent us as a printout are not in the database. These clones, also used in their 1997 publication, are a mixture of different histone- isoforms from one or several species (see H2A). In their publication, the authors do not comment on why they chose the described mutants.

2.3.2. Vectors and Constructs

Table 1: List of used vectors. For two-hybrid vectors see Table 4.

vector purpose tag organism company

pCR-Blunt II-TOPO 'Topo' cloning vector - Invitrogen

pQE 30 protein expression &

purification

6xhis E.coli:

- M15 - SG13009

Qiagen

pRSET A protein expression &

purification 6xhis E.coli:

- pBL-21 (Lys S/RIL) Invitrogen pGEX-4T protein expression &

purification GST E.coli:

- pBL-21 (Lys S/RIL) Pharmacia pBlueBacHis2 A/B protein expression &

purification

6xhis insect cells:

- Sf9

- Hi5 (Baculovirus system)

Invitrogen

pEGFP-N1 / C1 fluorescent labelling of proteins

GFP mammalian cells BD Bioscience

pTre2hyg inducible expression

in mammalian cells - mammalian cells transfected with 'tet' regulator vector

BD Bioscience

(22)

Table 2: Overview DEK-constructs.

two-hybrid

system GFP-

fusions bacterial expression DEK Fragment

Baculovirus expression system (pBlueBacHis2) cloned/expressed bait vector (pEG202) prey vector (pJG4-5) "tet-off" system (pTRE2hyg) pEGFP-NI pEGFP-CI- [NLS] pQE-30 (his-tagged) pRSET-A (his tagged) pGEX-4T-1 (GST-tagged)

dmDEK 1-664 + / o - - - - - - - -

DEK 1-375 (full-

length) +³ / + + + + + + + + +

DEK 1-350 + / + + + - - - + + +

DEK 1-310 + / + - + + - + - + +

DEK 1-270 + / - + - - - - - - -

DEK 1-250 + / + - + - - - - - -

DEK 1-222 + / - + + - - - - - -

DEK 1-205 - - - - - - - - -

DEK 1-187 + / + - - - - - - + -

DEK 1-87 + / - - - - - + - - -

DEK 1-57 + / - - - - - - - - -

DEK 1-87+187-

375 (=∆87-187) + / + - - - + - - + -

DEK 87-375 + / + - - - - - - + -

DEK 87-310 + / + - - - + - - + -

DEK 87-187 + / + + - - - - - + -

DEK 87-149 + / - - - - - + - - -

DEK 87-137 - - - - - - - + -

DEK 137-187 - - - - - - - + -

DEK 149-187 + / - - - - - - - - -

DEK 187-375 + / + - - - - - - - -

DEK 187-310 + / + - - - - - - - -

DEK 205-375 + / - - + - - - - - -

DEK 215-375 - - +¹ - - - - - -

DEK 229-375 - - +² - - - - - -

DEK 247-375 - - +¹ - - - - - -

DEK 250-375 + / + - - - - - - - -

DEK 270-375 + / + - + - - - - - -

DEK 270-350 + / + - - - - - - - -

DEK 270-310 + / + - - - - - - - -

DEK 310-375 + / + + + - - - - + -

DEK 1-375

(L157ÆA157) + / - - - - - - - - +

PKA-DEK 1-375 + / + - - - - - - - -

DEK 1-187 +

310-375 - - - - - - - + -

1 fished (oligo dT library)

2 fished (random-primed library)

3 cloned by F. Kappes

(23)

Table 3: Baculovirus-system expression constructs.

insert boundaries name

5' ... ... 3'

comment pBlueBacHis2-A-

dmDEK TGGGGATCCATGGAT…

(vector - BamHI - insert)

[TAA CTCGAG]

(stop - Xho - vector)

• dm = drosophila melanogaster-DEK

• 5' end sequenced up to bp700 17-07-02 (#63761)

• subcloned from clone 'K3A' (vector: pBluescript, R. Dorn, Institut für Genetik, Halle)

• aa exchanges in comparison to the databank sequence, (already in source-sequence 'K3A')

• sequence in square brackets […] not sequenced pBlueBacHis2-A-

DEK 1-375 TGGGGATCCATGTCC…

(vector - BamHI - insert)

ATTTCTTAATGAATTCGAA (insert - stop - EcoRI - vector)

• completely sequenced 05-09-02 (#239918 + #293319)

• subcloned by F. Kappes from pRSET-A-DEK (I. Scholten) pBlueBacHis2-A-

PKA-DEK 1-375 TGGGGATCCGTCGTGCAT CTGTTGGATCCATGTCC…

(vector - BamHI - PKA-site - BamHI - insert)

[ATTTCTTAATGAATTCGAA (insert - stop - EcoRI - vector)]

• protein kinase A (PKA) phosphorylation-site included for in vitro labelling with ³²P-ATP

• 5' end sequenced up to bp600 17-07-02 (#63752 + #63753)

• vector is identical to pBlueBacHis2-A-DEK1-375, except for the following insertion in the BamHI-site:

GGATCCCGTCGTGCATCTGTTGGATCC (protein kinase A (PKA) phosphorylation site)

pBlueBacHis2-B- DEK 1-375 [L157ÆA157]

ATGGAATTCATGTCC…

(vector - EcoRI - insert)

[…ATTTCTTAATCTCGACTCT]

([insert - stop - XhoI/SalI-hybrid - vector])

• DEK1-375 with Leu157ÆAla157 mutation in SAP-box for DNA- binding studies

• subcloned from sequenced pEG202 vector (two-hybrid)

• 5' end sequenced up to bp620 23-06-01 (#59427)

• sequence in square brackets […] not sequenced pBlueBacHis2-B-

DEK 1-350 ATGGAATTCATGTCC…

…AAGGTCTAATCTCGACTCT (insert - stop - XhoI/SalI-hybrid - vector)

• completely sequenced 09-08-01 (#71189 + 71190)

• originally termed "DEK 2"

(24)

pBlueBacHis2-B- DEK 1-350 -no stop-

ATGGAATTCATGTCC…

(vector - EcoRI - insert)

…AAGGTACGGGATCC GTCGACCATGGCGGCCGCTC GACTCT

(insert - pEG202-MCS: BamHI SalI 1 NcoI NotI - XhoI/SalI 2- hybrid - vector)

• initial clone without stop-codon at the 3' end

• completely sequenced 17-07-01 (#59421 + #63749)

• subcloned from pEG202-DEK1-350("DEK 2"); initially cloned into pEG202 with EcoRI-BamHI, insert cut out with EcoRI-XhoI

• due to missing stop-codon 12 amino acid insertion at the C- terminus: K349V350RDPSTMAAARLC.

• construct therefore not taken for expression!

• originally termed "DEK 2"

pBlueBacHis2-B-

…GATGAATAATCTCGACTCT (insert - stop - XhoI/SalI-hybrid - vector)

pBlueBacHis2-B- DEK 1-310 -no stop-

probably similar to

"pBlueBacHis2-B-DEK 1-350 no stop"

• 5' end sequenced up to bp400 23-06-01 (#59422)

• subcloned in the same was as " pBlueBacHis2-B-DEK 1-350 -no stop-

• originally termed "DEK 3"

pBlueBacHis2-B- DEK 215-375 ("fish")

ATGGAATTCGGCACGAGG CGGAAG…

(vector - EcoRI - adapter primer sequence - insert)

…ATTTCTTGAGATAGA…[CTC GACTCT]

(ORF insert - stop - 3'URT [- XhoI/SalI-hybrid - vector])

• completely sequenced 23-06-01 (#59428)

• subcloned from pJG4-5"fish" (1^st fished prey of two hybrid screens)

• includes complete 3' ORF

• sequence in square brackets […] not sequenced pBlueBacHis2-B-

…GCTACTTAATCTCGACTCT (insert - stop - XhoI/SalI-hybrid - vector)

• this construct (with stop-codon) taken for expression

pBlueBacHis2-B- DEK 1-270 -no stop-

…GCTACTCTCGACTCT (insert - no stop! - XhoI/SalI- hybrid - vector)

• no stop-codon, not used for expression in the Baculovirus- system

pBlueBacHis2-B- DEK 1-250

ATGGAATTCATGTCC…

…AAAGAATAATCTCGACTCT (insert - stop - XhoI/SalI-hybrid - vector)

• this construct (with stop-codon) taken for expression

(25)

pBlueBacHis2-B- DEK 1-250 (no stop!)

…AAAGAACTCGACTCT (insert - no stop! - XhoI/SalI- hybrid - vector)

• no stop-codon, not used for expression in the Baculovirus- system

pBlueBacHis2-B-

DEK 1-222 ...AAATGT CTCGAC TCT

(insert - no stop! - XhoI/SalI- hybrid - vector)

• 5' sequenced (500bp) 17-07-01 (#63757)

• no stop-codon at 3' end

ATGGAATTCATGTCC…

…CCAAAGTAACTCGACTCT (insert - stop - XhoI/SalI-hybrid - vector)

ATGGAATTCATGTCC…

…CAGAAATAACTCGACTCT (insert - stop - XhoI/SalI-hybrid - vector)

pBlueBacHis2-B-

…GGCAAGTAACTCGACTCT (insert - stop - XhoI/SalI-hybrid - vector)

pBlueBacHis2-B- DEK 1-87+187- 375 (= '∆ 87-187')

CCGGAATTCATGTCC…

…GATGAATAATCTCGAGCGG (insert - stop - XhoI - vector)

• completely sequenced 24-06-01 in pCR (shown on the left) (#48798 + #48799)

• originally termed "DEK7+8" or "DEK 7" only pBlueBacHis2-B-

DEK 87-375 CCGGAATTCATGTCC…

...ATTTTCTTAATGGATCCGCG (insert - stop – Bam HI - vector)

• completely sequenced 14-08-01 in pCR (shown on the left) (#33826 + #33827)

• subcloned into pEG202

• then subcloned into pBlueBacHis2-B with EcoRI/XhoI

• 3' end should look like pBlueBacHis2-B-DEK310-375

pBlueBacHis2-B-

DEK 87-149 ATGGAATTCAAACTT…

…ATGTTGTAACTCGACTCT (insert - stop - XhoI/SalI-hybrid - vector)

(26)

pBlueBacHis2-B-

(vector - EcoRI - insert) …CCAAAGTAATGGATCCGTC GACCATGGCGGCCGCTCGAC TCT

(insert - stop - pEG202-MCS:

BamHI SalI 1 NcoI NotI - XhoI/SalI2-hybrid - vector)

• subcloned from pEG202-DEK87-187("DEK 4"), with stop-codon

pBlueBacHis2-B-

DEK 149-187 ATGGAATTCTTGAAA…

…CCAAAGTAACTCGACTCT (insert - stop - XhoI/SalI-hybrid - vector)

pBlueBacHis2-B-

DEK 187-310 ATGGAATTCAAGCCT…

• base #870: CÆ A transversion (silent: ACC>ACA Î Thr>Thr) pBlueBacHis2-B-

DEK 187-375 ATGGAATTCAAGCCT…

…ATTTCTTAATCTCGACTCT (insert - stop - XhoI/SalI-hybrid - vector)

pBlueBacHis2-B-

DEK 205-375 ATGGAATTCAAAAAG…

pBlueBacHis2-B-

DEK 251-375 ATGGAATTCAGTGAA…

…ATTTCTTAATCTCGACTCT (insert - stop - XhoI/SalI-hybrid - vector)

ATGGAATTCTCTAAA…

(27)

pBlueBacHis2-B-

DEK 271-350 ATGGAATTCTCTAAA…

…AAGGTCTAATCTCGACTCT (insert - stop - XhoI/SalI-hybrid - vector)

ATGGAATTCTCTAAA…

pBlueBacHis2-B-

DEK 310-375 ATGGAATTCGATGAA…

…ATTTCTTAATGGATCCGTCG ACCATGGCGGCCGCTCGACT CT

(insert - stop - pEG202-MCS:

BamHI SalI 1 NcoI NotI - XhoI/SalI2-hybrid - vector)

• subcloned from pEG202-DEK310-375("DEK 5"), with stop- codon

Numbering of DNA-sequencing-reactions from GATC, Konstanz.

(28)

californica nuclear polyhedrosis virus DNA (Bac-N-Blue DNA) into Sf9 insect cells as described in the manufacturer's protocol (Invitrogen). Single virus clones were picked from plaque assays and

propagated further. Passage three virus stocks were used to infect HighFive (Hi5) cells for protein expression. Three days after infection cells were washed twice with phosphate buffered saline (PBS) and then lysed with 2ml lysis buffer per 175mm² flask (100mM Tris-Cl pH 7.5, 150mM NaCl, 5mM KCl, 0.5mM MgCl2, 1% NP40, 5mM imidazole). To disrupt DNA-protein and protein-protein interactions of DEK in the lysed cells, NaCl was added to a final concentration of 1.3M and cells were incubated for 20min at room temperature. The lysate was cleared by centrifugation at 100,000g in a Beckman ultracentrifuge. The supernatant was adjusted to 10% glycerol, diluted with lysis buffer to a final concentration of 700mM NaCl and incubated with 400µl 50% Ni-NTA-agarose beads (Qiagen) per 10 flasks (= 1 prep.). After 1h incubation at 4°C the beads were washed twice with WB-150 (100mM Tris- Cl pH 7.5, 150mM NaCl, 50mM imidazole) and transferred into a 10ml Biorad column. The beads were washed twice with WB-300 (100mM Tris-Cl pH 7.5, 300mM NaCl, 50mM imidazole) and again with WB-150. The his-tagged protein was then eluted 10x with 20µl elution buffer (100mM Tris-Cl pH 7.5, 150mM NaCl, 500mM imidazole) per 175mm² flask. All DEK-containing fractions were pooled and stored at -70°C.

2.3.4. Far Western and South Western Blotting

A protein kinase A (PKA) phosphorylation site (amino acid motif "RRAS*V") was cloned into pBlueBacHis2-A-DEK using BamHI and the following annealed oligonucleotides:

Bam HI ┌--- PKA-site ----┐ Bam HI PKA forward 5’ GATCC CGT CGT GCA TCT GTT G 3' PKA reverse 3’ G GCA GCA CGT AGA CAA CCTAG 5'

Correct orientation of the insert was checked by sequencing. After protein-expression and purification (2.3.3), 1µg of PKA-his-tagged DEK (volume: 100µl) was diluted 1/20 with wash buffer (= 1x

Complete protease inhibitor (Roche) in PBS) to reduce the imidazole concentration to 25mM and rebound to 100 µl settled Ni-NTA agarose for two hours at 4°C. The resin was washed twice with wash buffer and once with 400µl 1x PKA-phosphorylation buffer (New England Biolabs, NEB) by

centrifuging the batch for 15 seconds at maximum speed. [³²P] γ-ATP-labelling was then carried out

"on column", using 1µl of protein kinase A (NEB) in a total volume of 400 µl for 30 minutes at 37°C.

After washing three times with 1ml wash buffer, labelled DEK was removed from the Ni-NTA agarose with 3x 300 µl elution buffer (see 2.3.3). The eluates were checked by SDS-PAGE followed by Coomassie-staining and autoradiography; radioactively labelled DEK peaked in the second eluate.

His-tagged PKA-histones were purified denaturatively and eluated using a pH-step gradient.

Therefore, rebinding requires neutralising the acidic eluate. 300µl his-PKA-histone eluate (pH 4.5 or 5.9) were mixed with 100µl 1M Tris-buffer (pH 7.5-8.0) and 200µl PBS/2x Complete protease inhibitor.

After binding to 100µl settled Ni-NTA agarose, the protocol for his-PKA-DEK was followed.

Protocols:

expression/purification of DEK-fragments see 2.3.3

expression/purification of PKA-his-histones

• pRSET-B-PKA-H2A/H2B/H4 were transformed and expressed in BL-21[Lys]

• a 200ml LB culture (including ampicillin/chloramphenicol) is inoculated with 1ml ^o/n culture

• @ OD595 = 0.5-0.6 induction with 1mM IPTG (end concentration)

• harvest after 4h and purify denaturatively using 8M Urea (according to QIAGEN expressionist protocol):

• lyse in 6ml buffer B

• centrifuge @15.000g for 30 min

• sonification (if still too viscous)

• add 1ml 50% Ni-NTA-slurry (QIAGEN)