Vergleich verschiedener Immunisierungsstrategien gegen Streptococcus suis beim Schwein: Zusammenhang zwischen
humoraler Immunantwort und Protektion
INAUGURAL-DISSERTATION zur Erlangung des Grades eines Doktors der Veterinärmedizin
-Doctor medicinae veterinariae- (Dr. med. vet.)
vorgelegt von Christoph Kock
Bremen
Hannover 2009
Infektionsmedizin, Tierärztliche Hochschule Hannover
Prof. Dr. K. H. Waldmann
Klinik für kleine Klauentiere und Forensische Medizin und Ambulatorische Klinik
1. Gutachter: Prof. Dr. P. Valentin-Weigand Prof. Dr. K.-H. Waldmann
2. Gutachter: Prof. Dr. L. Haas
Tag der mündlichen Prüfung: 28.5.2009
Meiner Familie
1 Einleitung ... 7
2 Allgemeiner wissenschaftlicher Hintergrund und Zielsetzung ... 8
2.1 Einleitung zu S. suis... 8
2.1.1 Erreger und Epidemiologie... 8
2.1.2 Klinik und Pathologie... 9
2.1.3 Pathogenese ... 10
2.1.4 Diagnostischer Nachweis ... 11
2.1.5 Therapie und Prophylaxe ... 12
2.2 Virulenzfaktoren und Antigene von S. suis... 13
2.2.1 Kapsel ... 13
2.2.2 OFS... 13
2.2.3 MRP und EF... 14
2.2.4 SAO ... 14
2.2.5 Suilysin... 15
2.2.6 Andere Antigene und virulenzassoziierte Faktoren ... 15
2.3 Vakzinierung gegen S. suis... 16
2.3.1 Ganzzellvakzinen ... 16
2.3.2 Subunitvakzinen... 17
2.3.3 Lebendvakzinen ... 23
2.4 Schutzmechanismen und Immunität im Rahmen einer S.-suis-Infektion.... 23
2.5 Problemstellung und Zielsetzung der Arbeit... 24
3 Streptococcus suis bacterin and subunit vaccine induced immunogenicities and protective efficacies against serotypes 2 and 9... 26
4 Intranasal immunization with a live Streptococcus suis isogenic ofs mutant elicited suilysin-neutralization titers but failed to induce opsonizing antibodies and protection... 52
5 Diskussion ... 76
5.1 Einleitung und experimenteller Ansatz ... 76
5.2 Opsonophagozytose-Test als prognostischer Indikator... 77
°C Grad Celsius
CD engl.: cluster of differentiation EF engl.: extracellular factor
ELISA engl.: enzyme-linked immunosorbent assay
FBPS engl.: fibronectin and fibrinogen binding protein of Streptococcus suis
IFN Interferon
IgG Immunglobulin G
IL Interleukin
i.m. intramuskulär
i.n. intranasal
i.p. intraperitoneal
i.v. intravenös
k. A. keine Angabe
KBE koloniebildende Einheiten
kDa Kilodalton
OFS engl.: opacity factor of Streptococcus suis MCP engl.: monocyte chemotactic protein MHC engl.: major histocompatibility complex MRP engl.: muramidase-released protein PCR engl.: polymerase chain reaction
PRRSV engl.: porcine reproductive and respiratory syndrome virus SAO engl.: surface antigen one
s.c. subkutan
SDS engl.: sodium dodecyl sulfate
SLY Suilysin
ST Serotyp
TLR engl.: toll-like receptor
TNF Tumornekrosefaktor
1 Einleitung
Streptococcus suis ist ein bedeutsamer Erreger von Septikämien, Meningitiden, Arthritiden, Serositiden, Pneumonien und Endokarditiden beim Schwein und ist verantwortlich für hohe wirtschaftliche Verluste in der intensiven Schweinehaltung (STAATS et al. 1997). Erkrankungen treten dabei vor allem bei Absetzferkeln auf (REAMS et al. 1993). Die Tiere infizieren sich in der Regel oral oder nasal und können entweder erkranken oder den Erreger, ohne klinisch auffällig zu werden, auf den Schleimhäuten des oberen Respirationstrakts tragen (STAATS et al. 1997). Das Ausbilden einer Erkrankung wird begünstigt durch vorangehende Infektionen mit anderen Erregern (z. B. PRRSV) sowie durch Stressfaktoren, wie Absetzen, hohe Besatzdichte oder schlechte klimatische Bedingungen (CHANTER et al. 1993;
GALINA et al. 1994; STAATS et al. 1997). S. suis hat weiterhin Bedeutung als Zoonoseerreger, vor allem bei Personen, die in engem Kontakt zu Schweinen oder deren Produkten stehen, wie Schlachthofarbeiter, Tierärzte oder Landwirte (LUN et al. 2007). Bislang wurden 33 Serotypen basierend auf unterschiedlichen Kapselantigenen beschrieben (HILL et al. 2005; STAATS et al. 1997), wobei die Serotypen 2 und 9 in Europa am häufigsten mit Erkrankungen assoziiert sind (WISSELINK et al. 2000). Ein kommerzieller Impfstoff ist in Deutschland bisher nicht verfügbar. In der Praxis werden oft autogene Ganzzellvakzinen eingesetzt, diese bieten jedoch nicht immer vollständigen und auch keinen serotypübergreifenden Schutz (BENNECKE 2008; HAESEBROUCK et al. 2004). Bis auf eine Ausnahme (BENNECKE 2008) sind Impfstoffkandidaten beim Schwein lediglich auf ihre protektive Wirksamkeit gegenüber Serotyp-2-Stämmen untersucht worden. Ebenso sind die Mechanismen noch unzureichend erforscht, die zu einem Schutz vor einer S.-suis-Infektion führen. Der erste Teil der Arbeit befasste sich daher mit der näheren Charakterisierung der Immunantwort von Schweinen, die in einer vorangegangenen Dissertation (BENNECKE 2008) mit einer Ganzzell- oder Subunitvakzine immunisiert und anschließend einer homologen oder heterologen Belastung ausgesetzt worden waren. Außerdem wurde die Immunantwort auf eine Serotyp-2- Kapselkonjugatvakzine untersucht. Im zweiten Teil wurden die protektive Wirkung und die induzierte Immunantwort einer putativen S.-suis-Lebendvakzine in homologen und heterologen Belastungsexperimenten evaluiert.
2 Allgemeiner wissenschaftlicher Hintergrund und Zielsetzung 2.1 Einleitung zu S. suis
2.1.1 Erreger und Epidemiologie
Bei S. suis handelt es sich um grampositive, fakultativ anaerobe Kokken, welche einzeln, in Paaren oder in kurzen Ketten vorkommen (HIGGINS u. GOTTSCHALK 1990). Dieser Keim wächst auf Schafblutagar mit einer α-Hämolyse, auf Pferdeblutagar dagegen mit einer β-Hämolyse (STAATS et al. 1997). Basierend auf Kapselpolysaccharid-Antigenen werden zurzeit 33 verschiedene Serotypen unterschieden (HILL et al. 2005; STAATS et al. 1997).
Von diesen Serotypen wird der Serotyp 2 weltweit am häufigsten mit Erkrankungen von Schweinen und auch Menschen in Verbindung gebracht (GOTTSCHALK et al.
2007). Es gibt jedoch auch geographische Unterschiede in der Verbreitung der Serotypen von S. suis. So sind in Europa beim Schwein neben Serotyp 2 die Serotypen 9 und 1 von Bedeutung, während z. B. in Kanada die Serotypen 1/2 und 3 wichtiger sind (MESSIER et al. 2008; WISSELINK et al. 2000). In Deutschland bereiten vor allem die Serotypen 2 und 9 Probleme, insbesondere Stämme der Genotypen cps2/mrp+/epf+/sly+ und cps9/mrp*/epf-/sly+ (ALLGAIER et al. 2001;
SILVA et al. 2006). Die Bedeutung der einzelnen Serotypen variiert wahrscheinlich.
So diskutierten Wisselink et al. einen Anstieg der Prävalenz von Serotyp-9-Stämmen in Belgien, den Niederlanden und Deutschland während der neunziger Jahre (WISSELINK et al. 2000).
Baums et al. (2007) konnten die virulenten Genotypen cps2/mrp+/epf+/sly+ und cps9/mrp*/epf-/sly+ bei Wildschweinen aus dem norddeutschen Raum nicht nachweisen. Dies wurde als Hinweis gedeutet, dass die moderne Schweinehaltung diese virulenten S.-suis-Stämme selektiert haben könnte. Ca. 10% der untersuchten Wildschweine waren jedoch mit dem Genotyp cps2/mrp+/epf*/sly+ infiziert, welcher bei Hausschweinen als moderat virulent gilt und in Europa häufiger bei erkrankten Menschen isoliert werden konnte (BAUMS et al. 2007).
In Europa und Nordamerika kommen S.-suis-Infektionen beim Menschen in der
den Jahren 1998 bis 1999 und über 200 Erkrankungen im Jahre 2005. Demzufolge scheint die Bedeutung von S. suis als Zoonoseerreger zuzunehmen (LUN et al.
2007). Erkrankungen beim Menschen können fast immer auf intensiven Kontakt mit Schweinen oder Schweinefleisch zurückgeführt werden. Daher sind Landwirte, Schlachthofarbeiter, Metzger und Tierärzte am häufigsten betroffen (SEGURA 2009).
2.1.2 Klinik und Pathologie
Klinisch können bei S.-suis-Infektionen perakute, akute und chronische Verlaufsformen unterschieden werden. Perakut erkrankte Tiere verenden häufig innerhalb von Stunden nach Ausbruch der Erkrankung ohne Ausbildung klinischer Symptome (STAATS et al. 1997). Bei der akuten Verlaufsform zeigen die Tiere in Abhängigkeit von dem infizierten Organ spezifische neurologische (Seitenlage, Ruderbewegungen, Opisthotonus, Nystagmus, Apathie, Taubheit, Blindheit u. a.), respiratorische (Husten, Schniefen u. a.) oder Arthritis-Symptomatik (geschwollene Gelenke, Lahmheit u. a.) sowie unspezifische Symptome, wie Fieber, reduziertes Allgemeinbefinden und verminderte Fresslust (REAMS et al. 1994; STAATS et al.
1997). Wird der Erreger nicht eliminiert, kann die Erkrankung zum Tod der Tiere, zur Ausbildung gesunder Trägertiere oder zu chronischen Verlaufsformen führen. Der chronische Verlauf ist geprägt von Kümmern, Lahmheit sowie in einigen Fällen auch persistierender ZNS-Symptomatik (STAATS et al. 1997). Eine Otitis interna ist dabei eine häufige Folge einer S.-suis-Meningitis beim Schwein (MADSEN et al. 2001).
Bei der pathologischen Untersuchung sind makroskopische Veränderungen des ZNS nur in schweren oder fortgeschrittenen Stadien erkennbar. Sie beinhalten Ödeme und Hyperämie der Hirnhäute sowie vermehrte Ansammlung von teilweise trübem Liquor cerebrospinalis (STAATS et al. 1997; WILLIAMS u. BLAKEMORE 1990).
Pathohistologisch werden überwiegend eitrig-fibrinöse Meningitiden und Plexus- chorioiditiden vorgefunden (BEINEKE et al. 2008; REAMS et al. 1994). S.-suis- Arthritiden stellen sich vor allem durch Hyperämie der Synovia, Schwellung der Gelenke, Verdickung der Gelenkkapsel sowie eine eitrig-fibrinös veränderte Gelenksflüssigkeit dar. Mikroskopisch werden ebenfalls hauptsächlich eitrig-fibrinöse Veränderungen der Synovia vorgefunden (BEINEKE et al. 2008; STAATS et al.
1997). Makroskopisch und mikroskopisch können weiterhin eitrig-fibrinöse Serositiden, vermehrte Exsudate in den Körperhöhlen, eitrige und fibrinöse Pneumonien und vegetative Endokarditiden auftreten (BERTHELOT-HERAULT et al.
2005; REAMS et al. 1994; STAATS et al. 1997). Darüber hinaus gibt es Hinweise,
dass S. suis in den genannten Organen neben eitrigen und fibrinösen auch lymphoplasmazelluläre Entzündungen auslösen kann (BEINEKE et al. 2008).
2.1.3 Pathogenese
Ferkel können sich bereits während der Geburt mit S. suis infizieren. Weitere Übertragungswege sind enger Kontakt mit der Muttersau oder ihren Ausscheidungen, kontaminierte Stalleinrichtungen sowie den Erreger ausscheidende Geschwistertiere (GOTTSCHALK u. SEGURA 2000). Klinisch unauffällige Trägertiere beherbergen S. suis im oberen Respirationstrakt, vor allem auf den Tonsillen. Die Tonsillen werden als Eintrittspforte für den Erreger in den Organismus gesehen. Von hier aus breiten sie sich zunächst lymphogen oder über die efferenten Blutgefäße aus (MADSEN et al. 2002; STAATS et al. 1997). Das Durchbrechen der Schleimhautbarriere kann wahrscheinlich sowohl durch Adhäsion und Invasion als auch durch Zerstörung der Epithelzellen erfolgen (BENGA et al. 2004;
GOTTSCHALK u. SEGURA 2000; LALONDE et al. 2000). Im Blutkreislauf verbreiten sich die Bakterien entweder in freier Form oder durch Adhäsion an Monozyten (GOTTSCHALK u. SEGURA 2000). In Bezug auf das Durchbrechen der Blut-Hirn- Schranke im Rahmen der Pathogenese einer S.-suis-Meningitis werden mehrere Mechanismen in Betracht gezogen: Zum einen ist der Erreger zytotoxisch für Endothelzellen der Hirnhautgefäße und Epithelzellen des Plexus chorioideus (CHARLAND et al. 2000; TENENBAUM et al. 2005). Zum anderen ist S. suis in der Lage, in Zellen der Blut-Hirn-Schranke einzudringen und sie durch Transzytose zu passieren (TENENBAUM et al. 2009; VANIER et al. 2004). An porzinen Plexus- chorioideus-Epithelzellen konnte dabei ein gerichteter Transport von Erregern von der basolateralen zur apikalen Seite nachgewiesen werden (TENENBAUM et al.
2009). Außerdem werden die Endothelzellen der Hirnhautgefäße zur Bildung proinflammatorischer Zytokine angeregt, was ein Einwandern von Leukozyten und eine erhöhte Permeabilität der Blut-Hirn-Schranke zur Folge haben könnte (VADEBONCOEUR et al. 2003; VANIER et al. 2008). Darüber hinaus wurde diskutiert, dass S. suis die Blut-Hirn-Schranke mit Hilfe von Monozyten überwindet.
Dies könnte durch Phagozytose und anschließendes intrazelluläres Überleben
massiven Ausschüttung proinflammatorischer Zytokine sowie einer starken Rekrutierung von Entzündungszellen zurückgeführt (GOTTSCHALK et al. 2007). Im Mausmodell löst eine Infektion mit S. suis eine charakteristische Typ 1 Immunreaktion aus, mit hohen IFN-γ, TNF-α, IL-6, IL-12 und MCP-1 Spiegeln im Plasma (DOMINGUEZ-PUNARO et al. 2007). In einem in-vitro-System mit Vollblut vom Schwein kann bei Zugabe von S. suis ebenfalls eine Ausschüttung von TNF-α, IL-1β, IL-6, IL-8 und MCP-1 nachgewiesen werden (SEGURA et al. 2006). Eine Bildung proinflammatorischer Zytokine findet auch in Endothelzellen der Hirnhautgefäße sowie in Mikrogliazellen und Makrophagen in befallenen Hirnbereichen statt (DOMINGUEZ-PUNARO et al. 2007; VADEBONCOEUR et al.
2003; VANIER et al. 2008). In Monozyten und myeloiden Zellen im Gehirn kommt es nach Kontakt mit S. suis zu einer verstärkten Transkription der Gene, die für CD14 und TLR-2 kodieren (DOMINGUEZ-PUNARO et al. 2007; GRAVELINE et al. 2007).
Darüber hinaus konnte für humane Monozyten nachgewiesen werden, dass CD14 und TLR-2 an der Aktivierung dieser Zellen bei Kontakt mit S. suis beteiligt sind. So konnte die Ausschüttung von Zytokinen durch Monozyten nach Inkubation mit S. suis durch einem monoklonalen Antikörper gegen CD14 teilweise gehemmt werden (SEGURA et al. 2002). Außerdem konnte eine Freisetzung von Zytokinen nach Erkennen von S. suis durch den TLR-2 nachgewiesen werden. Besonders die Zellwand bewirkt dabei eine starke Ausschüttung von Chemokinen (IL-8, MCP-1) und proinflammatorischen Zytokinen (TNF-α, IL-1β, IL6). Die Polysacharidkapsel von S.
suis verursacht dagegen lediglich eine TLR-2 unabhängige Freisetzung von MCP-1.
Bekapselte Bakterien lösten eine geringere Zytokinproduktion von Monozyten aus als isogene kapsellose Mutanten. Dieser Befund wurde darauf zurückgeführt, dass die Kapsel Zellwandbestandteile maskiert (GRAVELINE et al. 2007).
2.1.4 Diagnostischer Nachweis
Der diagnostische Nachweis von S. suis erfolgt meist kulturell-biochemisch. Hierfür sind nur wenige Parameter erforderlich. Ein α-hämolysierendes Streptokokkenisolat vom Schwein, welches positiv für Amylase und negativ in der Voges-Proskauer- Reaktion ist, kann als S. suis bezeichnet werden (DEVRIESE 1991). Zur Serotypisierung stehen zahlreiche Methoden zur Wahl. Eine Möglichkeit ist der mikroskopische Nachweis der Kapsel mit einem serotypspezifischen Antiserum.
Weitere zur Verfügung stehende Verfahren sind der Koagglutinationstest oder der Kapillarpräzipitationstest (HIGGINS u. GOTTSCHALK 1990).
Mittels PCR kann die Spezies S. suis eindeutig durch den Nachweis des Gens für die Glutamatdehydrogenase (gdh) identifiziert werden (OKWUMABUA et al. 2003). Silva et al. (2006) entwickelten eine Multiplex-PCR, mit deren Hilfe verschiedene Gene von S. suis gleichzeitig detektiert werden können. Sie beinhaltet den Nachweis des gdh- Gens, der Gene der vier wichtigsten europäischen Kapseltypen cps1, cps2, cps7 und cps9, der Gene für die virulenzassoziierten Faktoren extracellular factor (EF, epf), muramidase-released protein (MRP, mrp) und Suilysin (SLY, sly) sowie des arcA-Gens, welches für die Arginindeiminase von S. suis kodiert. Dadurch ist sowohl ein eindeutiger Nachweis der Spezies S. suis als auch die Identifikation einiger Genotypen, welche mit hoher Virulenz assoziiert sind, möglich.
2.1.5 Therapie und Prophylaxe
Zur Prophylaxe von S.-suis-Erkrankungen gehören Managementfaktoren, wie das Vermeiden zu hoher Besatzdichte, gutes Stallklima, hygienische Stallbedingungen und Minimierung von Stress. Beim Auftreten von S.-suis-Symptomen können die Tiere antibiotisch behandelt werden, wobei eine vollständige Heilung erkrankter Schweine jedoch nur selten erfolgt (STAATS et al. 1997). Eine metaphylaktische Behandlung der gesamten Stalleinheit kann dabei sinnvoll sein (MACINNES u.
DESROSIERS 1999). Die in Europa vorherrschenden Serotypen sind in der Regel empfänglich für Ceftiofur, Florfenicol, Enrofloxacin und Penicillin. Wenige Resistenzen bestehen bei Gentamicin, Spectinomycin und Trimethoprim/Sulfonamid- Kombinationen. Eine hohe Anzahl von Stämmen ist dagegen resistent gegenüber Tetracyclin und Tilmicosin (WISSELINK et al. 2006). Zusätzlich zur Antibiose sollten beim Auftreten von Meningitiden Antiphlogistika gegeben werden (MACINNES u.
DESROSIERS 1999). In Beständen mit S.-suis-Problematik können autogene Ganzzellvakzinen zur Reduktion der Mortalität und Morbidität eingesetzt werden.
Dabei kommt sowohl eine Vakzinierung der Muttersauen als auch der Ferkel in Betracht (HAESEBROUCK et al. 2004). Auch kann eine kombinierte Immunisierung und antibiotische Behandlung der Sauen das Übertragungsrisiko auf die Ferkel
2.2 Virulenzfaktoren und Antigene von S. suis 2.2.1 Kapsel
Die Kapsel von S. suis Serotyp 2 ist ein Polysaccharid, bestehend aus Rhamnose, Galaktose, Glucose, N-Acetylglucosamin und N-Acetylneuraminsäure (ELLIOTT u.
TAI 1978). Sie stellt einen kritischen Virulenzfaktor dar, da kapsellose Mutanten sich im Tierexperiment als avirulent erwiesen haben (CHARLAND et al. 1998; SMITH et al. 1999). Die Bedeutung der Kapsel für die Pathogenese liegt im Schutz vor der Aufnahme durch Phagozyten (BENGA et al. 2008; CHARLAND et al. 1998; SMITH et al. 1999). Bei Makrophagen bewirkt die Kapsel dabei eine Herunterregulierung von Signalwegen, welche an der Induktion der Phagozytose beteiligt sind (SEGURA et al.
2004). Weiterhin hat die Kapsel einen hemmenden Einfluss auf die Adhäsion und Invasion von S. suis an Endothel- und Epithelzellen (BENGA et al. 2004; BENGA et al. 2005; VANIER et al. 2004). In Abhängigkeit von den Umweltbedingungen zeigt S.
suis unterschiedliche Kapseldicken. So konnten Quessy et al. (1994b) nachweisen, dass virulente Serotyp-2-Stämme in vivo eine dickere Kapsel besitzen als in vitro.
Auch die Charakterisierung einer Deletionsmutante, welche defizient für das Regulatorprotein CovR ist, lieferte Hinweise für die Regulation der Kapseldicke. Die Mutante zeigte phänotypisch eine dickere Kapsel als der Wildtyp (PAN et al. 2009).
Als Immunogen hat die Kapsel eine schwache Wirkung, so dass Tiere nur sehr niedrige Antikörpertiter gegenüber den Kapselantigenen entwickeln (CAMPO SEPULVEDA et al. 1996).
2.2.2 OFS
Der opacity factor of S. suis (OFS) ist ein weiterer Virulenzfaktor von S. suis und zeigt strukturelle Ähnlichkeit mit Proteinen der MSCRAMM-Familie (microbial surface components recognizing adhesive matrix molecules). Seine N-terminale Domäne besitzt eine hohe Homologie zum serum opacity factor (SOF), einem Virulenzfaktor von S. pyogenes. Sie zeigt, ebenso wie die N-terminale Domäne von SOF, Serumtrübungsaktivität. Über ein C-terminales LPXTG-Motif ist OFS wahrscheinlich mit der Zellwand verbunden. Darüber hinaus wurde die Oberflächenlokalisation auch anhand der Serumtrübungsaktivität von SDS-Extrakten gezeigt (BAUMS et al. 2006).
Es gibt vier allelische Varianten von ofs, von denen Typ 1 und 2 Serumtrübungsaktivität besitzen (TAKAMATSU et al. 2008). OFS wird in vitro nur in geringen Mengen exprimiert bzw. sehr schnell degradiert, so dass bis heute in S.
suis nur die mRNA und die Aktivität, nicht aber direkt das OFS-Protein nachgewiesen werden konnte (BAUMS et al. 2006). Ferner zeigten Rekonvaleszenzseren von Schweinen, welche mit einem OFS-exprimierendem S.-suis-Serotyp-2-Stamm infiziert worden waren, im ELISA und Western Blot keine OFS-spezifischen Antikörper (BAUMS 2009). Die isogene Mutante S. suis 10Δofs2/12, welche OFS nicht mehr exprimiert, wies im Infektionsversuch mit Absetzferkeln eine starke Virulenzattenuation auf, ist jedoch noch in der Lage, den oberen Respirationstrakt zu kolonisieren (BAUMS et al. 2006).
2.2.3 MRP und EF
In europäischen Serotyp-2-Stämmen gelten das muramidase-released protein (MRP) und der extracellular factor (EF) als virulenzassoziierte Faktoren (VECHT et al. 1991;
WISSELINK et al. 2000). Knockout-Mutanten, welche MRP und EF nicht mehr exprimieren, erwiesen sich beim Schwein allerdings als ebenso virulent wie der Wildtyp (SMITH et al. 1996). MRP hat eine Molekülgröße von 136 kDa, EF ist 110 kDa groß (VECHT et al. 1991). Eine hochmolekulare Variante von MRP, genannt MRP*, kommt häufig in virulenten europäischen Serotyp-9-Stämmen vor. Sie besitzt eine hohe Homologie zu MRP. Hochmolekulare EF-Varianten (EF*) findet man dagegen in schwach virulenten Serotyp-2-Stämmen (SILVA et al. 2006; SMITH et al.
1993; WISSELINK et al. 2000). Die Sortase A von S. suis verknüpft MRP über das LPXTG-Motif kovalent mit der Zellwand (OSAKI et al. 2002). EF wird von den Bakterien sezerniert (VECHT et al. 1991). Beide Proteine sind stark immunogen (WISSELINK et al. 2001), ihre Funktion ist unbekannt. In immunhistologischen Untersuchungen konnte nachgewiesen werden, dass MRP von einem hochvirulenten Serotyp-2-Stamm im Rahmen einer Infektion der Hirnhäute und des Gehirns exprimiert wird (BEINEKE et al. 2008).
2.2.4 SAO
Das surface antigen one (SAO) ist ein hochkonserviertes Oberflächenprotein, das bei den meisten S.-suis-Serotypen vorkommt. Es besitzt wie MRP und OFS ein LPXTG- Motif und ist auf der Oberfläche der Bakterien lokalisiert (LI et al. 2006). Es sind drei verschiedene allelische Varianten von SAO (SAO-L, SAO-M und SAO-S)
2.2.5 Suilysin
Suilysin gehört zu der Gruppe der Thiol-aktivierten Hämolysine, die auch als Cholesterol-abhängige Zytolysine bezeichnet werden (JACOBS et al. 1994). Diese können an cholesterolreiche Zellmembranen binden und führen über eine Porenbildung zur Lyse der Zelle (TWETEN 2005). Suilysin besitzt eine Molekülmasse von 54 kDa und wird sekretiert (JACOBS et al. 1994). Das sly-Gen kommt bei allen in Europa bedeutsamen Serotypen vor (KING et al. 2001; SILVA et al. 2006). Da Suilysin mit hoher Virulenz in Serotyp-2-Stämmen in Verbindung gebracht wird, kann es als virulenzassoziierter Faktor bezeichnet werden (GOTTSCHALK u. SEGURA 2000). Während einer Infektion von Schweinen kommt es zu einer Hochregulierung des sly-Gens (TAN et al. 2008). Isogene Suilysin-knockout-Mutanten erwiesen sich im Schwein jedoch nicht als attenuiert, ein essentieller Virulenzfaktor ist Suilysin demzufolge nicht (LUN et al. 2003). Neben seiner hämolytischen Aktivität ist Suilysin auch zytotoxisch für porzine Endothel- und Epithelzellen (LALONDE et al. 2000;
VANIER et al. 2004). Darüber hinaus bewirkt es an Epithelzellen eine verstärkte Adhäsion und Invasion von S. suis (NEIS 2008). Ferner ist es zytotoxisch für neutrophile Granulozyten und trägt zu einem besseren Überleben in Anwesenheit von Neutrophilen und Monozyten bei (BENGA et al. 2008; CHABOT-ROY et al.
2006). Es spielt daher während der Pathogenese wahrscheinlich eine Rolle bei der Invasion und dem Schutz der Bakterien vor Phagozyten. Des Weiteren löst Suilysin eine Ausschüttung proinflammatorischer Zytokine an Endothelzellen und Makrophagen aus und hat somit auch eine immunmodulatorische Wirkung (SEGURA u. GOTTSCHALK 2004; VANIER et al. 2008).
2.2.6 Andere Antigene und virulenzassoziierte Faktoren
Das fibronectin and fibrinogen binding protein of S. suis (FBPS) ist in der Lage, humanes Fibrinogen und Fibronektin zu binden und wird zu den virulenzassoziierten Faktoren gerechnet. In einem kompetitiven Belastungsexperiment beim Schwein zeigte eine FBPS-knockout-Mutante im Gegensatz zum Wildtyp keine Invasion in das ZNS oder die Gelenke. FBPS kommt bei Stämmen von fast allen Serotypen vor und ist stark immunogen (DE GREEFF et al. 2002).
Enolase ist sowohl an der Oberfläche von S. suis als auch innerhalb der Bakterienzelle lokalisiert. Es hat ebenfalls immunogene Wirkung (ESGLEAS et al.
2008; ZHANG et al. 2008). Das Gen für Enolase konnte bei allen untersuchten S.-
suis-Serotypen nachgewiesen werden (ZHANG et al. 2009). Enolase besitzt Fibronektin- und Plasminogenbindungsaktivität. Durch die Zugabe von rekombinanter Enolase oder die Inkubation mit Enolase-spezifischen Antikörpern konnte die Adhärenz von S. suis an Endothel- und Epithelzellen verringert werden. Dies legt nahe, dass Enolase die Adhärenz an diese Zellen vermitteln kann. Seine Rolle in der Pathogenese könnte daher in der Interaktion der Bakterien mit den Wirtszellen liegen (ESGLEAS et al. 2008; ZHANG et al. 2009).
Das Arginin-Deiminase-System von S. suis besteht aus einer Arginin-Deiminase (ArcA), einer Ornithin-Carbamoyl-Transferase (ArcB) und einer Carbamat-Kinase (ArcC). ArcA und ArcB sind zellwandassoziiert. Es wird induziert durch mikroaerophile und anaerobe Bedingungen, Anwesenheit von Arginin sowie bei einer Temperaturerhöhung auf 42°C. Beim Vorhandensein von Kohlenhydraten, wie Glukose, wird es reprimiert. Das Arginin-Deiminase-System spielt wahrscheinlich für das Überleben von S. suis unter Sauerstoff- und Nährstoffmangel sowie unter sauren Bedingungen, beispielsweise in Lysosomen, eine zentrale Rolle (GRÜNING et al.
2006; WINTERHOFF et al. 2002).
2.3 Vakzinierung gegen S. suis 2.3.1 Ganzzellvakzinen
Inaktivierte autogene Ganzzellvakzinen sind zurzeit die einzigen Impfstoffe, welche in Europa zur Kontrolle von S.-suis-Infektionen in Schweinebeständen eingesetzt werden können (HAESEBROUCK et al. 2004). Einige Ganzzellvakzinen wurden auch unter experimentellen Bedingungen erprobt (Tabelle 1). Holt et al. (1990) immunisierten Ferkel wiederholt mit Formalin-inaktivierten Serotyp-2-Kulturen. Dabei konnten sie bezogen auf die Mortalität eine Protektion gegenüber einer homologen Belastung hervorrufen. Bakterizidie-Tests mit Vollblut legten nahe, dass auch opsonisierende Antikörper gebildet wurden. Hitzeinaktivierte Kulturen riefen dagegen trotz solcher Hinweise auf eine Induktion von opsonisierenden Antikörpern keine Protektion hervor. Wisselink et al. (2002) stellten fest, dass eine Formalin-inaktivierte Ganzzellvakzine mit einem Wasser-in-Öl-Adjuvans bei Ferkeln einen vollständigen Schutz vor einer homologen Infektion auslöst. Eine Ganzzellvakzine, hergestellt aus
von Mortalität und klinischen Symptomen in homologen Belastungsversuchen. Mit dem Wasser-in-Öl-Adjuvans Montanide 25 oder Saponin wurde dagegen keine protektive Wirkung erzielt (PALLARES et al. 2004). Bennecke (2008) konnte mit einer Formalin-inaktivierten Serotyp-2-Ganzzellvakzine mit einem Wasser-in-Öl- Adjuvans einen Schutz vor einer homologen Infektion hervorrufen. Gegenüber einer heterologen Serotyp-9-Belastung war dagegen keine deutliche Protektion erkennbar.
Ebenso konnte mit Aluminumhydroxid als Adjuvans kein Schutz vor einer homologen Belastung induziert werden. Dies war auch in anderen unabhängigen Immunisierungsexperimenten festgestellt worden (HOLT et al. 1990; WISSELINK et al. 2001), was den Schluss nahe legt, dass Aluminiumhydroxid kein geeignetes Adjuvans für eine Ganzzellvakzine gegen S. suis ist. Zusammenfassend kann gesagt werden, dass mit Ganzzellvakzinen in Verbindung mit Wasser-in-Öl-Adjuvantien eine Protektion gegenüber homologen Stämmen erreichbar ist. Eine heterologe Schutzwirkung ist jedoch nicht zu erwarten.
2.3.2 Subunitvakzinen
Bei Subunitvakzinen wird nicht der gesamte Erreger als Impfstoff verabreicht, sondern nur ausgewählte immunogene Strukturen. Durch die Gabe in hoher Konzentration und in Kombination mit Adjuvantien soll eine starke Immunantwort ausgelöst werden (SELBITZ u. MOOS 2003). Gegen S. suis sind bislang diverse Subunitvakzinen experimentell getestet worden (Tabelle 1). Einige der Immunisierungsexperimente wurden in Mäusen durchgeführt. Dabei ist jedoch zu bedenken, dass Schweine und Mäuse und sogar Mausstämme untereinander unterschiedlich empfänglich für S. suis sind (DOMINGUEZ-PUNARO et al. 2008;
VECHT et al. 1997). Ergebnisse von Experimenten mit Mäusen sind daher nicht ohne weiteres auf das Schwein übertragbar. Mit gereinigtem Suilysin, rekombinantem SAO sowie rekombinanter Enolase konnte in Mausmodellen eine Protektion gegenüber S.-suis-Serotyp-2-Stämmen erzielt werden (JACOBS et al.
1996; ZHANG et al. 2009). Enolase und SAO schützten dabei auch vor Serotyp-7- Stämmen (ZHANG et al. 2009). Drei rekombinante Proteine (Ssuidraft 0103, 0174 und 1237), welche S. suis unter Mangel an bivalenten Kationen exprimiert, zeigten im Mäuseversuch unterschiedliche Schutzwirkungen gegenüber einer Serotyp-2- Belastung. Bei Ssuidraft 0103 konnte die deutlichste Protektion bezogen auf die Mortalität festgestellt werden (ARANDA et al. 2008).
Bei Immunisierungsversuchen mit Schweinen konnte eine vollständige Protektion gegenüber einem Serotyp-2-Stamm bisher nur durch ein rekombinantes 38 kDa großes Protein von S. suis erreicht werden. Dabei wurde allerdings die erste von zwei Immunisierungen in Kombination mit komplettem Freund-Adjuvans gegeben (OKWUMABUA u. CHINNAPAPAKKAGARI 2005). Subunitvakzinen auf Basis von gereinigtem Suilysin mit α-Tocopherol oder rekombinantem SAO mit Saponin erzeugten in Ferkeln im Gegensatz zu Mäusen nur einen unvollständigen Schutz.
Rekombinantes SAO in Kombination mit einem Wasser-in-Öl-Adjuvans war in Ferkeln nicht protektiv. Für die unterschiedliche Wirkung der SAO-Subunitvakzinen in Abhängigkeit von dem Adjuvans wurde eine Verschiebung des IgG1:IgG2- Verhältnisses zu Gunsten von IgG2 bei der Verwendung von Saponin verantwortlich gemacht (JACOBS et al. 1996; LI et al. 2006; LI et al. 2007). Eine Kombination aus gereinigtem MRP und EF mit einem Wasser-in-Öl-Adjuvans senkte die Mortalitätsrate von Ferkeln bei einer Infektion mit MRP+ EF+ Suilysin+ Serotyp-2- Stämmen. Bei alleiniger Gabe von MRP oder EF oder Verwendung von Aluminumhydroxid als Adjuvans war dagegen keine Schutzwirkung vorhanden (WISSELINK et al. 2001). Auch eine Subunitvakzine, basierend auf Murein- assoziierten Proteinen mit einem Wasser-in-Öl-Adjuvans, zeigte beim Schwein weder gegenüber einer Serotyp-2- noch einer Serotyp-9-Belastung eine protektive Wirkung (BENNECKE 2008). Elliott et al. (1980) immunisierten Schweine mit gereinigten Kapselpolysacchariden. Dabei konnten in Verbindung mit inkomplettem Freund- Adjuvans opsonisierende Antikörper gegen den entsprechenden Serotyp induziert werden. Eine alleinige Gabe von Kapselpolysacchariden bewirkte dagegen nur eine sehr schwache Immunantwort. Eine Belastung wurde in diesen Experimenten nicht durchgeführt. Zusammenfassend lässt sich festhalten, dass mit Subunitvakzinen gegen S. suis im Mausmodell teilweise gute Erfolge erzielt wurden. Beim Schwein konnte (mit Ausnahme eines 38 kDa großen Proteins bei einer Verwendung von komplettem Freund-Adjuvans) jedoch noch keine vollständige Protektion gegenüber S. suis erreicht werden.
Tabelle 1: Ergebnisse von Immunisierungsversuchen mit experimenteller Belastungsinfektion (Auswahl)
2.3.3 Lebendvakzinen
Vakzinierungen mit Lebendvakzinen haben den Vorteil, dass neben der humoralen auch die zelluläre Immunantwort stimuliert werden kann. Sie bergen jedoch auch gewisse Risiken, wie das Auslösen einer Erkrankung bei immunsupprimierten Tieren oder die Rückkehr zu einem pathogenen Phänotyp (SINGH u. O'HAGAN 2003).
Auch zur Überprüfung potentieller S.-suis-Lebendvakzinen wurden bereits einige Experimente durchgeführt (Tabelle 1). Holt et al. (1988) konnten durch die intravenöse Gabe virulenter und avirulenter Serotyp-2-Stämme in Schweinen einen vollständigen Schutz vor Infektionen mit virulenten Serotyp-2-Stämmen auslösen. In diesen Experimenten wurden jedoch mindestens fünf Immunisierungen durchgeführt.
Bei CF-1-Mäusen konnte durch eine zweimalige Immunisierung mit einem avirulenten Serotyp-2-Stamm eine vollständige Protektion gegenüber verschiedenen Serotyp-2-Stämmen hervorgerufen werden (QUESSY et al. 1994a). Bei Ferkeln war dagegen eine dreimalige intramuskuläre Vakzinierung mit demselben Stamm für eine vollständige Protektion notwendig (BUSQUE et al. 1997). Wisselink et al. (2002) immunisierten Ferkel zweimalig intramuskulär mit einer kapsellosen S.-suis-Serotyp- 2-Mutante. Dies resultierte jedoch nicht im Schutz vor einer intravenösen Infektion mit dem Wildtyp. Ebenso bewirkte die zweimalige intramuskuläre Immunisierung von Ferkeln mit einer unbekapselten Serotyp-2-Mutante, welche auxotroph für aromatische Aminosäuren ist, lediglich einen Schutz vor Mortalität sowie eine Reduktion der klinischen Symptome bei systemischer Belastung mit dem virulenten Wildtyp (FITTIPALDI et al. 2007). Zusammenfassend lässt sich also sagen, dass Experimente mit Lebendvakzinen gegen S. suis beim Schwein bisher unbefriedigende Ergebnisse geliefert haben, da entweder eine hohe und damit nicht praktikable Anzahl von Immunisierungen durchgeführt werden mußte oder keine ausreichende Protektion erreicht wurde.
2.4 Schutzmechanismen und Immunität im Rahmen einer S.-suis-Infektion Durch die wiederholte Infektion von Schweinen mit virulenten S.-suis-Serotyp-2- Stämmen konnten Holt et al. (1988) zeigen, dass Rekonvaleszenztiere eine belastbare Immunität gegenüber einer homologen S.-suis-Infektion ausbilden. Die Übertragung von Rekonvaleszenzseren auf nicht immunisierte, empfängliche Schweine löste ebenfalls eine Protektion aus. Dies lässt darauf schließen, dass ein Großteil der Immunität gegen S. suis antikörpervermittelt ist. Weiterhin zeigten
Immunisierungen von Mäusen mit lebenden thermosensitiven Mutanten verschiedener S.-suis-Serotypen und anschließende homologe oder heterologe Infektion, dass diese nur einen serotypspezifischen Schutz hervorrufen (KEBEDE et al. 1990). In einem in-vitro-System mit Vollblut vom Schwein bewirkte eine Zugabe von S.-suis-spezifischen Antikörpern ein vermindertes Wachstum von S. suis sowie eine geringere Ausschüttung von Chemokinen und proinflammatorischen Zytokinen (SEGURA et al. 2006). Experimente zum Überleben von S. suis in Anwesenheit von neutrophilen Granulozyten und Makrophagen zeigten, dass für ein effektives Abtöten der Bakterien S.-suis-spezifische Antikörper und Komplement erforderlich sind. Dabei waren neutrophile Granulozyten effektiver als Makrophagen. Dies legt den Schluss nahe, dass die antikörpervermittelte Opsonophagozytose durch neutrophile Granulozyten ein bedeutsamer Schutzmechanismus im Rahmen der erworbenen Immunität gegen S. suis ist (CHABOT-ROY et al. 2006). Des Weiteren konnten Li et al. zeigen, dass Protektion nach Immunisierungen mit rekombinantem SAO nur durch ein zu Gunsten von IgG2 verschobenes IgG1:IgG2-Verhältnis hervorgerufen werden konnte. Dies ging einher mit der Bildung opsonisierender Antikörper. Die Autoren schlussfolgerten daraus, dass ein Impfstoff, welcher vornehmlich eine Th-1 dominierte Immunantwort erzeugt, eine bessere Schutzwirkung gegenüber S. suis als bei Auslösung einer Th-2 Reaktion hat (LI et al. 2006; LI et al. 2007).
2.5 Problemstellung und Zielsetzung der Arbeit
S. suis ist ein wichtiger Erreger von Infektionen beim Schwein, der vor allem in der Ferkelaufzucht hohe wirtschaftliche Schäden verursacht. Des Weiteren besitzt er eine zunehmende Bedeutung als Zoonoseerreger.
Ein kommerzieller Impfstoff ist in Europa bislang nicht verfügbar. Autogene Ganzzellvakzinen bieten nicht immer vollständigen Schutz vor S.-suis-Infektionen.
Ferner können metaphylaktische antibiotische Behandlungen auf Grund der Rückstandsproblematik und zunehmenden Resistenzen keine dauerhafte Lösung sein. Daher ist die Entwicklung eines Impfstoffs mit serotypübergreifendem Schutz ein wichtiges Ziel für eine zukünftige, effektive Bekämpfung von S. suis. Für die Entwicklung einer solchen Vakzine ist ein gutes Verständnis der Mechanismen, die
Proteinen, und einer Kapselpolysaccharidkonjugatvakzine. Im zweiten Teil wird die protektive Wirkung einer attenuierten Lebendvakzine in einem homologen und heterologen Belastungsversuch evaluiert und die induzierte Immunantwort quantitativ und qualitativ untersucht.
3 Streptococcus suis bacterin and subunit vaccine induced immunogenicities and protective efficacies against serotypes 2 and 9
Christoph Georg Baums 1, Christoph Kock 1,3, Andreas Beineke 2, Katharina Bennecke 1, Ralph Goethe 1, Charlotte Schröder 3, Karl-Heinz Waldmann 3, and Peter Valentin-Weigand 1
Institut für Mikrobiologie, Zentrum für Infektionsmedizin, Stiftung Tierärztliche Hochschule Hannover 1, Institut für Pathologie, Stiftung Tierärztliche Hochschule Hannover 2 und Klinik für kleine Klauentiere und forensische Medizin und Ambulatorische Klinik, Stiftung Tierärztliche Hochschule Hannover 3
C. G. Baums and C. Kock contributed equally to this work.
Clinical and Vaccine Immunology, Vol. 16, No. 2, Februar 2009, S. 200-208
ABSTRACT
Streptococcus suis causes numerous diseases in pigs, most importantly, meningitis, arthritis, septicaemia and bronchopneumonia. One of the major problems in modern swine production is the lack of a vaccine protecting against more than one S. suis serotype.
The objective of this study was to determine the protective efficacy of a serotype 2 murein-associated protein fraction (MAP) subunit vaccine in comparison to that of a bacterin against experimental challenge with MRP+ EF+ SLY+ serotype 2 and MRP*
SLY+ serotype 9 strains. MAP was shown to include different surface-associated proteins such as the muramidase-released protein (MRP) and surface antigen one (SAO) expressed by both pathotypes used for challenge. The results of this study demonstrated that the serotype 2 bacterin induced protective immunity against homologous challenge. In contrast, the protective efficacy of the MAP subunit vaccine was low, though MAP immunization resulted in high serum immunoglobulin G2 titers against MRP and SAO. Importantly, immunization with bacterin but not with MAP induced opsonizing antibody titers against the serotype 2 strain, and these antibody titers were found to correlate with protection. However, after absorption with a nonencapsulated isogenic mutant, the sera from bacterin-immunized piglets failed to facilitate neutrophil killing, indicating that antibodies directed against capsule may not have been essential for opsonophagocytosis. Furthermore, induction of opsonizing antibodies against serotype 9 was not detectable in the group receiving bacterin or in the group receiving the MAP vaccine. In agreement, protection against the heterologous serotype 9 strain was low in both groups. Thus, identification of an antigen protecting against these two important S. suis pathotypes remains an important goal of future studies.
Keywords: Streptococcus suis, MRP, SAO, opsonophagocytosis, capsular polysaccharides
INTRODUCTION
S. suis ranks among the five most important health challenges of pigs worldwide (11, 12). It is associated with numerous diseases, such as meningitis, arthritis, serositis and bronchopneumonia. S. suis isolates from diseased animals express a polysaccharide capsule, which confers resistance to phagocytosis as demonstrated for serotype 2 strains (21). Strains of various serotypes have been isolated from affected tissues. In Europe, serotype 2 and 9 strains are the most prevalent types isolated from infections. The 136 kDa muramidase-released protein (MRP) and the 110 kDa extracellular factor (EF) are virulence-associated factors expressed only by virulent serotype 1 and 2 strains (22, 23). The majority of invasive serotype 9 isolates express a larger variant of MRP, termed MRP*, which shares high homology with the 136 kDa MRP protein of serotype 2 strains (20, 23).
A number of S. suis proteins have been investigated as vaccine candidates.
Wisselink et al. demonstrated that in comparison to a bacterin, immunization with MRP alone conferred little protection against challenge with serotype 2 strains (24).
Combining MRP with the extracellular factor (EF) substantially improved protective efficacy. However, many invasive isolates, including all serotype 9 strains, do not express EF. Furthermore, immunization with a different cell wall-associated protein, surface antigen one (SAO), elicited protective immunity against homologous challenge (16). Jacobs et al. used the hemolysin suilysin for immunization of piglets (13). Their results suggested that suilysin might be a protective antigen. Importantly, challenge experiments with different serotypes in pigs have not been described for any of these candidates.
The objective of this work was to evaluate the protective efficacy of a subunit vaccine based on murein-associated proteins (MAP) in comparison to a bacterin. The subunit vaccine included major surface-associated immunogens such as SAO and MRP, expressed by both pathotypes used for challenge. Therefore, MAP was regarded as a promising candidate for induction of cross-protection against these invasive serotype 2 and 9 strains, which are responsible for major economic losses in Europe.
MATERIALS AND METHODS
Bacterial strains and growth conditions. S. suis strain 10 is an MRP+ EF+ SLY+
serotype 2 strain which has been shown to be highly virulent in experimental infections of piglets (2, 21). Its isogenic mutant 10cpsΔEF is deficient in capsule production and attenuated in virulence (21). A3286/94 is an MRP* SLY+ serotype 9 S. suis strain of sequence type 99, which was originally isolated from a pig with meningitis (18, 20). Intranasal experimental infections of growers revealed that A3286/94 is only moderately virulent in comparison to the highly virulent strain 10 (3).
S. suis and Escherichia coli strains were cultured as described (2).
Preparation of the murein-associated protein subunit vaccine. In this study a S.
suis subunit vaccine was generated which consisted of murein-associated proteins (MAP). For preparation of the MAP fraction S. suis strain 10 culture (100 ml) was grown to an OD600 of 0.3 and subsequently incubated at 42°C for two hours. The temperature shift to 42°C was performed to mimic the increase in body temperature associated with S. suis infection in piglets. The bacteria were centrifuged and resuspended in 10 ml of buffer containing 30 mM Tris HCl pH 7.5, 25% (wt/vol) sucrose, 0.01 M NaEDTA and 0.2 mg/ml lysozyme. After incubation at 37°C for 45 min, the resulting protoplasts were centrifuged (15 min at 9270 x g and 4°C). The supernatant was recovered, and MAP were precipitated in 10% trichloroacetic acid (vol/vol). The pellet was washed twice with 80% (vol/vol) acetone and subsequently resuspended in 500 µl phosphate-buffered saline (PBS). The MAP-subunit vaccine contained final concentrations of 0.2 mg/ml MAP, 20% (vol/vol) emulsigen as adjuvant, and, for comparison with the bacterin, 0.04% (vol/vol) formaldehyde and 40% (vol/vol) Todd-Hewitt broth (THB, Oxoid, Wesel, Germany).
Preparation of the bacterin. The bacterin was generated with S. suis strain 10 grown overnight in THB at 37°C and inactivated in 0.1% formaldehyde. Emulsigen was added as adjuvant (20% [vol/vol]). For comparison with the MAP-subunit vaccine 40% (vol/vol) PBS were also included. Each immunization dose contained approximately 109 CFU. The mixtures were stirred for 8 hours, screened for sterility and stored at 8°C.
Cloning of sao. Standard DNA manipulations were performed as described (19). For expression of recombinant His-tagged SAO (rSAO) the plasmid pQEsao was constructed as follows. The 1559 bp PCR amplification product generated with Pfu
polymerase (Promega, Mannheim, Germany) and the primer pair saopostssBamHI
(AAAGGATCCATCATCAGCGCAAAACAAC) and saopraeanchorPstI (ACACTGCAGATTTGCTTAGCAGTTTCG) was cut with BamHI and PstI (New
England Biolabs, Frankfurt, Germany) and cloned into pQE30 (Qiagen, Hilden, Germany). Purified plasmid DNA was verified by restriction analysis.
rSAO and rMRP expression, purification and generation of poyclonal antisera.
IPTG-induced expression of rMRP and rSAO and subsequent purification by Ni2+- affinity chromatography under native conditions were carried out as described (3).
Purified proteins were controlled by Western blot analysis with monoclonal anti-Penta His antibodies (Qiagen). Polyclonal antiserum against purified rSao was raised in a New Zealand White rabbit (Charles River Laboratories, Sulzfeld, Germany) by three consecutive immunizations with 0.1 mg of purified protein and Freund`s incomplete adjuvant.
SDS-PAGE and Western Blot analysis. Proteins were separated by SDS-PAGE with stacking and separation gels of 4% and 8% acrylamide, respectively (14). Silver staining was performed as described (17). For Western Blot analysis proteins were transferred to nitrocellulose membranes (Schleicher & Schuell BioScience, Dassel, Germany). MRP, SAO and FBPS (fibronectin and fibrinogen-binding protein of S.
suis) (6) were detected with a 1:1000 dilution of specific polyclonal sera against respective recombinant proteins and an anti-rabbit IgG-peroxidase-conjugated antiserum (Amersham Biosciences, Freiburg, Germany)(3). The antiserum against FBPS was kindly provided by Astrid de Greeff (DLO-Lelystad, The Netherlands).
Animal experiments. Forty-two German Landrace piglets from a herd known to be free of sly+ mrp+ epf+ cps2+ and sly+ mrp* cps9+ strains were infected experimentally and cared for in accordance with the principles outlined in the European Convention for the Protection of Vertebrate Animals Used for Experimental and Other Scientific Purposes [European Treaty Series, no. 123:
http://conventions.coe.int/treaty/EN/Menuprincipal.htm; permit no. 33-42502-06/1063 and 1093]. The piglets were 3 to 4 weeks old on the day of transport to the experimental facility (weaned on the same day). They were randomly divided into the different groups outlined in Table 1. Piglets were injected intramuscularly twice at day
experimental infections with the serotype 2 (strain 10) and the serotype 9 (A3286/94) reference strains different routes of challenge were choosen (3). The piglets were challenged 2 weeks after the 2nd immunization either intranasally with 1.8 x 109 CFU of strain 10 or intravenously with 1 x 108 CFU of strain A3286/94. The health status of the animals was monitored every eight hours. In the case of high fever (≥ 40.5°C), apathy and anorexia as well as in all cases of clinical signs of acute polyarthritis or severe meningitis animals were euthanized for reasons of animal welfare. All surviving piglets were sacrificed 10 days post infection.
Haematologic analysis. Blood samples were collected before experimental infection (0 dpi) and on day 2, 4, 6 and 10 post infection, and prior to euthanasia. White blood cells were counted on haemocytometer chamber. Leukocytes were differentiated on classical Wright stained blood smears.
Histopathological and bacteriological screening. The histological screenings were carried out and scored with blinded experiments as described (2). All tissues screened histologically were also investigated bacteriologically through culture and PCR-based detection of the challenge strains (2, 3).
Isolation of S. suis capsular polysaccharides. Preparation of serotype 2 capsular polysaccharides was essentially done as described by Elliot and Tai (7). Briefly, S.
suis serotype 2 strain 10 was grown in 1 l THB at 37°C until late logarithmic growth phase. Bacteria were centrifuged, washed in PBS and resuspended in 100 ml 0.1 M glycine buffer (pH = 9.2) containing 10 mg lysozyme/ml. After over night incubation at 37°C, cellular debris was eliminated by centrifugation and the supernatant was lyophilized. The lyophilizate was dissolved in 20 ml 0.1 M CaCl2. Nucleic acids were removed by precipitation with 25% ethanol. Capsular polysaccharides where then precipitated by increasing the ethanol concentration to 80%. The pellet was dissolved in 20 ml 50 µM Tris-HCl buffer (pH = 7.4). Polysaccharides were further purified by RNase, DNase and proteinase-K-treatment and subsequent phenol extraction. After extensive dialysis against H2O, capsular polysaccharides were lyophilized and resuspended in PBS. Serotype 2 specific capsular polysaccharides were verified as high molecular weight smears in silver staining and Western blot analysis with polyclonal rabbit antisera raised against S. suis serotype 2. Total carbohydrate concentration was determined by the phenol-sulphuric-acid method (8).
Conjugation of capsular polysaccharides with bovine serum albumin.
Conjugation of serotype 2 capsular polysaccharide with bovine serum albumin (BSA) was essentially performed as described by Lees et al. (15). Forty-two µl of 100 mg/ml 1-cyano-4-dimethylaminopyridium tetrafluoroborate in acetonitrile (Sigma, Taufkirchen, Germany) were slowly added to 2.8 mg of serotype 2 capsular polysaccharides and mixed for 30 seconds. After addition of 42 µl of 0.2 M triethylamine (Sigma) the solution was mixed for another 2 minutes and 5.6 mg BSA were included. After end-over-end rotation for 3 hours at 37°C the reaction was quenched by addition of 1 M glycine buffer (pH = 9) to a final concentration of 0.1 M glycine and subsequent end-over-end rotation at 4°C over night. Finally, conjugates were dialysed against PBS for two days. BSA-conjugated serotype 2 capsular polysaccharide was verified by detection of band shifts in Western blot analysis with polyclonal rabbit anti-BSA antiserum (Sigma) in comparison to BSA and purified capsular polysaccharides. Hyperimmune sera against conjugated serotype 2 capsular polysaccarides were raised in four piglets by two consecutive immunizations with 0.25 mg of BSA-conjugated serotype 2 capsular polysaccaride and 10%
Emulsigen.
Detection of antibodies against MRP, SAO, murein-associated proteins and serotype 2 capsular polysaccharides. MAP-, MRP- and serotype 2 capsular polysaccharides specific total serum IgG-antibodies and SAO- and MRP-specific serum antibodies of IgG isotypes (IgG1 and IgG2) of immunized piglets were determined by ELISA. Maxisorb® plates (Nunc, Rochester, NY) were coated overnight at 8°C with 5 µg S. suis antigen (MAP, rMRP, rSAO or serotype 2 capsular polysaccharides) or BSA (background measurement) in carbonate buffer. Washing of plates between the different incubation steps was performed three times with PBS containing 0.05% Tween 20 (PBST). The plates were blocked with 5% skim milk in PBST for 2 h at 37°C. Samples were added and plates were placed for 1 h at 37°C on a rocker platform. For detection of total IgG, plates were incubated with a 1:20.000 dilution of peroxidase-conjugated goat anti-swine IgG (heavy plus light chains) antiserum (Dianova, Hamburg, Germany) for 1 h at room temperature. For detection of IgG1 and IgG2, mouse anti-porcine IgG1 and IgG2 antisera (Serotec, Kidlington,
[3-ethylbenzithiazoline sulphonate] (ABTS, Boehringer, Mannheim, Germany) and 0.002% H2O2 as substrate. Absorbance was measured at 405 nm.
Every sample and the controls were measured in a duplicate series of four (reference serum: seven) twofold dilutions in PBST (starting with 1:200). A convalescent-phase serum obtained from a piglet 20 days after experimental infection with strain 10 was used as a standard. Sera from this animal obtained before experimental infection served as negative control. For positive controls of MRP- and MAP-ELISA, sera from piglets immunized with rMRP or MAP in previous experiments (3, 4) were used, respectively. Optical densities were converted to antibody concentrations through log linear regression analysis after background subtraction. The ELISA units of each sample were defined as the mean of the calculated units for each of the four dilutions of the two series. Data were only considered if they met the following criteria:
deviation of duplicates <22% (IgG isotype specific ELISA: <15%), slope of the linear portion of the reference standard curve between 0.8 and 1.2, correlation coefficient between 0.9 and 1.0 and controls within established ranges (e. g.: 135-185 units for IgG1 specific anti-MRP control).
Opsonophagocytosis assay. Opsonophagocytic killing in the presence of 20%
(vol/vol) porcine serum was assayed essentially according to Baltimore et al. (1).
Briefly, S. suis strains 10 and A3286/94 from a logarithmic-phase broth culture were centrifuged and resuspended in PBS to give an OD600 of 0.5 and 1.0, respectively.
Ten µl of these suspensions were added to 400 µl of a neutrophil suspension (in RPMI) and 100 µl serum. Neutrophils had been isolated from freshly drawn porcine blood. Aliquots for quantitative platings were sampled immediately and after 1 hour of end-over-end rotation at 37°C. For S. suis strain 10 a starting inoculum of approximately 2x106 CFU was incubated with 2x106 neutrophils (MOI 1:1). In case of strain A3286/94 a higher bacteria/neutrophil ratio of 5.6:1 was used (4.5x106 CFU bacteria to 0.8x106 neutrophils). Strain 10cpsΔEF was included as positive control in all opsonophagocytosis assays (performed as described for strain 10). Survival factor represented the ratio of CFU at 1h to CFU at time 0.
For absorption of sera with S. suis, 2 ml of strain 10 or strain 10cpsΔEF over night cultures were centrifuged. Pelleted bacteria were resuspended in 200 µl serum and rotated for 30 min at 4°C. After centrifugation for 10 min at 10,000 g 100 µl of the supernatant were used as absorbed serum in opsonophagocytosis experiments.
Statistical analysis. Statistical analysis with the Mann-Whitney test was performed to analyze differences between the three groups of piglets used in each experiment.
The Wilcoxon test was used for comparison of different time point values within the same group. The data in the Kaplan-Meyer survival diagrams was analyzed with the logrank test. Probabilities lower than 0.05 were considered significant.
RESULTS
Characterization of a murein-associated subunit vaccine. MAP fractions of S.
suis serotype 2 strain 10 and serotype 9 strain A3286/94 were separated by PAGE and analyzed by Western blots. As demonstrated in Fig. 1, the MAP fractions of both strains showed some similarity in protein band patterns and included MRP/MRP*, SAO and FBPS. The MAP fraction of S. suis strain 10 was used as a subunit vaccine and compared to a bacterin of the same strain in homologous and heterologous challenge experiments.
Fig. 1: Murein-associated protein (MAP) fraction of S. suis serotype 2 strain 10 (A) and
Challenge of piglets with the homologous serotype 2 strain 10. One piglet in the bacterin-immunized group had to be euthanized prior to challenge because of an unrelated disease and the data for this piglet were excluded from analysis. High-dose intranasal challenge of piglets with strain 10 resulted in at least two diseased animals in every group. Morbidity and mortality levels for the bacterin-immunized group were significantly lower than those for the placebo group (Table 1 and Fig. 2A). Five of the seven bacterin-immunized piglets showed neither clinical signs of disease nor fibrinosuppurative lesions (Table 2). Elevated numbers of blood leukocytes were, however, temporarily registered in three of these animals (Table 1). In the MAP- immunized piglets morbidity and mortality after serotype 2 challenge were only slightly lower than in the placebo group (Table 1). Mean times to death were similar for the MAP- and placebo-vaccinated animals (6.1 and 5 days, respectively) but the mean time to death in the bacterin-immunized group was greater (8.9 days) (Fig.
2A).The differences in morbidity and mortality correlated with the results of the histological screening of fibrinosuppurative lesions which resulted in scores of 1.0, 3.0 and 3.8 for the bacterin-, MAP- and placebo-immunized groups, respectively (Table 2). The challenge strain was isolated from at least one inner organ of all but one diseased piglet, and the isolation was always associated with fibrinosuppurative inflammations. Isolation of the challenge strain from 3 or more different tissues was achieved for four of eight animals of the placebo group but none of those from the bacterin-immunized group. For four of five healthy piglets from the bacterin- immunized group, the challenge strain was detected in the tonsils but not in other tissues (Table 3). In conclusion, clinical, pathohistological and bacteriological screenings demonstrated protective immunity against the homologous serotype 2 strain 10 in the bacterin-vaccinated group but not in the MAP-vaccinated group.
Fig. 2: Kaplan-Meyer survival diagrams of piglets challenged with S. suis after application of a bacterin, a MAP subunit vaccine, or a placebo on the 7th and 18th day post weaning.
Challenge was performed either intranasally with 109 CFU of S. suis strain 10 (A) or intravenously with 108 CFU of MRP* SLY+ serotype 9 S. suis strain A3286/94 (B), both on the 32nd day post weaning. The P values of the comparison between the bacterin- and MAP- immunized groups with the placebo group are indicated.
Challenge of piglets with the heteorologous serotype 9 strain A3286/94.
Intravenous challenge of piglets with strain A3286/94 resulted in at least 50%
mortality in each group. Morbidity and mortality levels for the bacterin-immunized group were slightly lower than those for the placebo group (P = 0.0426 and P = 0.28, respectively), and the morbidities and mortalities of the MAP- and placebo- immunized groups were similar (Table 1). Mean times to death were 6.2, 4.5, and 3.5 days in bacterin-, MAP- and placebo-vaccinated animals, respectively (Fig. 2B). The pathohistological screening revealed only mild fibrinosuppurative lesions in animals of the bacterin group, whereas three animals of the placebo group and two animals of the MAP-vaccinated group showed moderate (MAP-vaccinated group) or severe (placebo group) fibrinosuppurative synovialitis and/or meningitis. The differences in pathohistological findings resulted in substantially different pathology scores for the three groups (Table 2). However, some pathohistological findings might have not been detected in the bacterin-immunized group as synovialitis was not diagnosed in two piglets that showed severe lameness prior to euthanasia. Bacteriological screening of A3286/94-infected animals revealed a high detection rate of the challenge strain in the placebo group in comparison to those of the bacterin and MAP-immunized groups (Table 3). In conclusion, neither the serotype 2 bacterin nor the respective MAP subunit vaccine conferred significant protection against mortality after heterologous intravenous challenge with a serotype 9 strain. However, clinical, histological and bacteriological differences suggested partial protection in the bacterin-immunized group.
Seroconversion of piglets immunized with bacterin and MAP. Immunization of piglets with either the bacterin or the MAP subunit vaccine elicited IgG titers against MAP- and MRP that were significantly higher than those in the placebo group and comparable to or higher than those in the convalescent-phase reference serum as shown for anti-MRP in Fig. 3A and B and for anti-MAP in Fig. S1A and B. Antibody titers against the MAP-fraction and against MRP were similar in bacterin- and MAP- vaccinated animals (anti-MRP; Fig. 3A and B). Differentiation of MRP-specific IgG1 and IgG2 antibodies revealed that immunization with both antigens induced an increase of both IgG isotypes, resulting in a mean IgG1:IgG2 ratio of 0.6 in bacterin-
Fig. 3: Serum IgG responses against surface-associated proteins MRP (A and B) and SAO (C) in pigs immunized with a bacterin or a murein-associated protein subunit vaccine (MAP).
The serum samples were drawn before immunization and 14 days after the 2nd immunization, prior to challenge either with strain 10 (A and C) or with strain A3286/94 (B).
Fig. S1: Serum IgG responses against murein-associated proteins (MAP) in pigs immunized with a bacterin or a murein-associated protein subunit vaccine. The serum samples were drawn before immunization and 14 days after the 2nd immunization, prior to challenge either
Fig. S2: Serum IgG responses against MRP in pigs immunized with a bacterin or a murein- associated protein subunit vaccine (MAP). The serum samples were drawn before immunization and 14 days after the 2nd immunization, prior to challenge with strain 10.
In all three groups of the homologous challenge experiment, piglets showed seroconversion against SAO prior to challenge. IgG1 and IgG2 titers against SAO were similar in the bacterin-vaccinated group and the placebo group (P = 0.9; Fig.
3C). In contrast, MAP immunized piglets developed significantly higher IgG titers against SAO than did piglets of the placebo group (P values of 0.027 for IgG1 and 0.021 for IgG2; Fig. 3C). The mean ratios of IgG1 to IgG2 were 0.64 (standard deviation, 0.3) in bacterin-immunized piglets and 0.56 (standard deviation, 0.4) in MAP-immunized piglets.
Opsonophagocytic killing mediated by bacterin- and MAP-induced antibodies.
Pre- and postimmunization sera of all piglets were investigated for their ability to promote opsonization of S. suis and subsequent killing by neutrophils in vitro. The survival factors determined for S. suis strain 10 in neutrophil killing assays were significantly lower with sera from bacterin-immunized animals than with sera from MAP- or placebo-immunized animals. In contrast to sera from MAP-immunized piglets, sera of bacterin-immunized piglets induced a significant increase in the neutrophil killing of S. suis strain 10 in comparison to the respective preimmunization sera (Fig. 4A and C). This indicated that opsonizing antibodies against strain 10 were elicited by the homologous bacterin but not by the MAP subunit vaccine. Except for one animal, the induction of opsonizing antibodies was found to correlate with the survival of piglets in the S. suis strain 10 challenge experiment (Fig. 4B).
In contrast, the survival factors of S. suis serotype 9 strain A3286/94 were similar in neutrophil killing assays with post- and preimmunization sera from piglets of all three groups (as indicated in Fig. 4C by a ratio of 1). In conclusion, neither immunization with the serotype 2 bacterin nor immunization with the MAP subunit vaccine induced opsonizing antibodies against the heterologous serotype 9 strain A3286/94 (Fig. 4C).
To determine whether antibodies against the capsule were involved in bacterin- induced opsonization of strain 10, postimmunization sera were absorbed with either strain 10 or the isogenic nonencapsulated mutant strain 10cpsΔEF and subsequently tested in the neutrophil killing assay. As demonstrated in Fig. 5B, postimmunization sera which had been absorbed with the isogenic nonencapsulated mutant failed to facilitate killing of strain 10. Comparable survival rates were observed when sera were absorbed with strain 10 or with its isogenic nonencapsulated mutant. Therefore, antibodies directed against the capsule may not have been essential for opsonophagocytosis in bacterin-immunized piglets. This was in agreement with the finding that serum IgG titers against serotype 2 capsule were very low in all piglets and that there was no difference among the three groups (Fig. 5A).
Fig. 4: Opsonophagocytic killing by porcine neutrophils in the presence of serum of piglets immunized with a bacterin or a MAP subunit vaccine. (A) The survival factors of strain 10 were determined in neutrophil killing assays with sera taken either prior to immunization (pre) or two weeks after the second immunization (post). (B) Correlation of the induction of opsonizing antibodies as determined by the ratio of postimmunization survival factors to preimmunization survival factors as shown in panel A and development of disease after homologous strain 10 challenge. Triangles and circles represent bacterin- and MAP- immunized piglets, respectively. Data for one MAP-immunized piglet (open circle) were not included in the calculation of the regression coefficient. (C) Comparison of the induction of opsonizing antibodies against serotype 9 (ST9) strain A3286/94 and serotype 2 (ST2) strain 10 as determined by the ratio of respective survival factors in the presence of postimmunization and preimmunization sera. The sera were from the piglets challenged with S. suis A3286/94.
Fig. 5: Antibody responses against serotype 2 (ST2) capsular polysaccharides in piglets immunized with a bacterin, a MAP subunit vaccine (MAP) or, for comparison, with BSA- conjugated serotype 2 capsular polysaccarides. (A) Serum IgG responses against ST2 capsular polysaccarides. (B) Opsonophagocytic killing by porcine neutrophils in the presence
DISCUSSION
In this study we designed experiments to evaluate S. suis vaccine candidates for use in porcine practice. Experiments included challenges with the two most important S.
suis pathotypes in Europe, a highly virulent homologous serotype 2 strain and a heterologous serotype 9 strain. Both have been characterized previously via experimental infections in pigs (3). A comparison with a S. suis bacterin was included, because that type of vaccines is commonly used today (10).
The results of this study demonstrate that a MAP subunit vaccine conferred less protection than a serotype 2 bacterin. This was surprising, as MAP was shown to include important surface-associated antigens, such as SAO and MRP. Li et al.
demonstrated partial protection in pigs immunized with rSAO (16). In contrast, we did not observe protection against S. suis strain 10 in MAP-immunized piglets, though these piglets had high humoral antibody titers against SAO. In this study, low antibody titers against SAO were already detected prior to immunization and in the placebo group. This finding is most likely related to other SAO-expressing S. suis strains colonizing the upper respiratory tract of all piglets used for challenge. We cannot exclude the possibility that the immune response against SAO after MAP and bacterin immunization, in particular the domination of IgG2 over IgG1, was influenced by the preimmunization status of the piglets. However, as high IgG2-dominated antibody titers against SAO were observed in both studies prior to challenge, the pre immune status is unlikely to explain the different outcome of challenge. One reasonable explanation may be that we applied the 90% lethal dose for challenge, which is 26 times higher than the dose used by Li et al. (16). Since the serotype 2 bacterin conferred significant protection against this challenge, it seems at least questionable whether a vaccine based on the antigen SAO might induce better protection than a S. suis bacterin.
In agreement with our results, Wisselink et al. found that immunization with MRP was less protective than immunization with a bacterin (24). As the authors performed only serotype 2 challenge, it was, however, not clear if MRP might induce cross protection against invasive serotype 9 strains. It has to be noted that these serotype 9 strains express an MRP variant with high homology to the serotype 2 MRP (20). On the other hand, the results of our study demonstrate that high-level antibody responses
against MRP, as developed by the MAP vaccinated animals, did not correlate with protection against serotype 2 or 9 challenge.
As antibody titers against SAO, MRP and MAP were very similar in the MAP and bacterin immunized piglets, we tried to identify qualitative differences in the antibody responses which might explain the differences in protective efficacy.
Opsonophagocytosis experiments with porcine neutrophils and sera from the immunized piglets demonstrated a significant increase in neutrophilic killing efficacy in the presence of sera from bacterin- but not from MAP-immunized piglets. The induced opsonizing activities of the different sera as determined in the neutrophil killing assay were found to be a good prognostic indicator for survival. This is in agreement with the important role of neutrophils in the pathogenesis of S. suis (5).
Therefore, it is reasonable to hypothesize that the induction of opsonizing antibodies in bacterin- but not MAP-immunized piglets was responsible for the different protective efficacy of these two vaccines.
Interestingly, high IgG2 antibody titers against SAO induced by MAP immunization did not correlate with opsonization in contrast to the results from an earlier study (16).
This might be explained by the fact that we used a much lower neutrophil/bacterium ratio (1:1) than Li et al. (500:1; 16). The lower ratio was chosen, since it is more likely to represent the in vivo situation, at least at an early stage of inflammation.
The lack of protection in MAP immunized piglets might be explained by the hypothesis that important antigens represented by the MAP subunit vaccine, in particular MRP and SAO, are in the course of S. suis infection not accessible to antibodies due to encapsulation. Gor et al. (9) found that only one of three investigated MAP of S. pneumoniae induced protection. Their results suggested that antibody accessibility of a MAP is a critical feature for its putative function as a protective antigen. Interestingly, a non-encapsulated S. suis mutant bacterin induced less protection than the respective wild type bacterin though it elicited identical antibody levels against MRP (25). The authors of the latter studie discussed the enhanced protection in wild type bacterin-immunized piglets in relation to induction of antibodies directed against capsule. However, in accordance with our findings antibody titers against the capsule were rather low. Furthermore, we demonstrated
