Zentrum für Infektionsmedizin
Characterization of the metabolic adaption of
Mycobacterium avium ssp. paratuberculosis to the host environment by studying isogenic mutants
INAUGURAL – DISSERTATION
zur Erlangung des Grades eines Doktors der Naturwissenschaften - Doctor rerum naturalium -
(Dr. rer. nat.)
vorgelegt von Thorsten Meißner
Großburgwedel
Hannover 2014
1. Gutachter: Prof. Dr. med. vet. Ralph Goethe
2. Gutachter: Prof. Dr. Hassan Y. Naim
Tag der mündlichen Prüfung: 21.05.2014
Diese Arbeit wurde gefördert durch die Deutsche Forschungsgemeinschaft (DFG), Bonn, Germany (Ge522/6-1).
“It always seems impossible until it´s done.”
Nelson Mandela
Table of content
1 Introduction ... 1
1.1 Prevalence and Epidemiology of Paratuberculosis ...1
1.2 Characteristics of Paratuberculosis ...2
1.3 Mycobacterium avium ssp. paratuberculosis ...3
1.4 Molecular pathomechanisms of MAP ...6
1.4.1 Mycobacterial metabolism ...9
1.4.2 Metal-dependent regulator and virulence ... 11
1.4.3 Iron acquisition in mycobacteria ... 13
1.4.4 Relevance of iron for MAP ... 14
1.5 Aims of the study ... 17
2 Material and Methods ...18
2.1 Material ... 18
2.1.1 Bacterial strains and media ... 18
2.1.2 Oligonucleotides ... 19
2.1.3 Plasmids, phasmids and phages ... 21
2.2 Methods ... 22
2.2.1 Media and bacterial growth conditions ... 22
2.3 Manipulation of nucleic acids ... 23
2.3.1 Genomic DNA preparation ... 23
2.3.2 Polymerase chain reaction ... 24
2.3.3 Preparation of template DNA by colony boiling for PCR ... 25
2.3.4 Purification of PCR products ... 25
2.3.5 Restriction and ligation of DNA fragments ... 25
2.4 Ligation ... 26
2.4.1 TOPO TA cloning ... 26
2.4.2 Plasmids purification ... 26
2.4.3 Nucleotide sequencing and sequence analysis ... 26
2.4.4 RNA preparation ... 27
2.4.5 DNase treatment of RNA samples ... 27
2.4.6 RNA precipitation ... 27
2.4.7 Reverse transcription (RT) PCR and complementary (c) DNA- synthesis ... 28
2.4.8 Quantitative real-time PCR (qRT-PCR) ... 28
2.5 Transformation ... 29
2.5.1 Preparation of chemo-competent E. coli... 29
2.5.2 Transformation of chemo-competent E. coli ... 29
2.5.3 Preparation of electro-competent E. coli... 30
2.5.4 Preparation of electro-competent M. smegmatis ... 30
2.5.5 Transformation of electro-competent E. coli and M. smegmatis ... 30
2.5.6 Preparation of electro-competent MAP ... 31
2.5.7 Transformation of electro-competent MAP ... 31
2.6 Construction of MAP deletion mutant by specialized transduction ... 32
2.6.1 Phage related protocols ... 32
2.6.2 Determination of phage concentration ... 32
2.6.3 Preparation of mycobacteriophage stocks from plate lysate ... 33
2.6.4 Isolation of phage DNA ... 33
2.6.5 Packaging of phage DNA in lambda phage heads ... 34
2.6.6 Construction of the allelic exchange substrate cosmid for furA deletion ... 34
2.6.7 Construction of mycobacteriophage for furA deletion ... 34
2.6.8 Specialized transduction of MAP ... 35
2.7 Deep RNA sequencing and transcriptome analysis ... 36
2.8 Lipid profiling ... 36
2.9 Detection of the metabolites of MAPwt and MAP∆mptD ... 37
2.10 Cell culture methods ... 38
2.10.1 Culture conditions of the murine macrophage cell line J744A.1 ... 38
2.10.2 Macrophage cell culture and viability assessment of intracellular mycobacteria ... 39
2.10.3 Bacterial adhesion assay and flow cytometry ... 39
2.11 Mouse infection experiments ... 40
2.11.1 Preparation of bacteria ... 40
2.11.2 Intraperitoneal infection of mice ... 40
2.11.3 DNA isolation and PCR of MAP from mice organs ... 41
2.12 Computational and statistic analysis ... 42
3 Results ...44
3.1 Phenotypic characterization of MAP∆mptD ... 44
3.1.1 MAP∆mptD indicated a hampered growth in WR medium ... 44
3.1.2 Survival of MAP∆mptD in murine J774A.1 macrophages ... 47
3.1.3 MAP∆mptD is attenuated in C57BL/6 mice ... 49
3.1.4 Transcriptome analysis revealed a differential expression profile in MAP∆mptD ... 51
3.1.5 MAP∆mptD displayed differences in the metabolomic profile ... 58
3.1.6 Lipid profiling revealed a different lipid pattern in MAP∆mptD ... 61
3.2 Characterization of a MAP∆furA deletion mutant ... 63
3.2.1 Construction and confirmation of MAP∆furA ... 63
3.2.2 Transcriptome analysis revealed a differential expression profile in MAP∆furA ... 67
3.2.3 The biological fitness of MAP∆furA is decreased in C57BL/6 mice ... 68
4 Discussion ...71
4.1 The role of MptD and FurA ... 71
4.2 MptD is necessary for the intracellular survival of MAP ... 72
4.3 FurA did not regulate genes of the 38 kb island but is crucial for survival of MAP .... 78
4.4 Conclusion ... 82
4.5 Outlook ... 83
5 Summary ...84
6 Zusammenfassung ...86
7 References ...88
8 Appendix ... 129
8.1 Differentially expressed genes in MAP∆mptD ... 129
8.2 Differentially expressed genes in MAP∆furA ... 133
8.3 Raw data of RNA sequencing of MAPwt, MAP∆mptD, and MAP∆furA ... 138
8.4 Raw data of Metabolites detection in MAPwt and MAP∆mptD ... 142
8.5 Raw data of the survival and invasion of MAPwt and MAP∆mptD ... 147
8.6 Raw data of granuloma area ... 148
8.7 Raw data of CFU detection in liver ... 149
8.8 Material and supplies ... 150
8.8.1 Chemicals and reagents ... 152
8.8.2 Kits and components... 155
8.9 List of figures ... 156
8.10 List of tables ... 156
8.11 List of abbreviations ... 158
9 Acknowledgment ... 162
Parts of the thesis have been published previously at scientific meetings and conferences:
Oral presentations
Meißner T, Jarek M, Gerlach G-F, Goethe R. “Construction and characterization of a Mycobacterium avium ssp. paratuberculosis furA mutant”, Seminar on Infection Biology, Centre for Infection Medicine, University of Veterinary Medicine Hannover, Hannover 2013
Meißner T, Basler T, Jarek M, Gerlach G-F, Nerlich A, Meens J, Goethe R.
„Characterization of mptD deletion mutant reveals a specific role of MptD in the metabolism of Mycobacterium avium ssp. paratuberculosis”, Conference of the Deutschen Veterinärmedizinische Gesellschaft (DVG), Leipzig 2012
Meißner T, Heinzmann J, Jarek M, Kühnel M, Gerlach G-F, Goethe R. “Construction and characterization of Mycobacterium avium ssp. paratuberculosis mptD mutants”, Seminar of the institute for Microbiology, Centre for Infection Medicine, University of Veterinary Medicine Hannover, Hannover 2012
Poster presentations
MeißnerT, Eckelt E, Nerlich A, Gerlach G-F Meen J, Valentin-Weigand P, Goethe R.
“Characterization of a predicted ECF-importer of Mycobacterium avium ssp.
paratuberculosis”, Society for General Microbiology, Dublin 2012
MeißnerT, MeensJ,Gerlach G-F, Goethe R. “Characterization of furA expression in Mycobacterium avium spp. paratuberculosis”, Annual Conference of the Association for General and Applied Microbiology (VAAM), Karlsruhe 2011
1 Introduction
1.1 Prevalence and Epidemiology of Paratuberculosis
The paratuberculosis, also known as Johne´s disease (JD), was first described by H. A. Johne and L. Frotingham in 1895 and is caused by Mycobacterium avium ssp.
paratuberculosis (MAP). JD displays a worldwide contagious, chronic emaciating, and fatal infection, which primarily affects the small intestine of ruminants especially in areas with a temperate and humide climate (HARRIS and BARLETTA, 2001;
KREEGER, 1991; MANNING and COLLINS, 2001; MOMOTANI, 2012; MOTIWALA et al., 2004; STEVENSON et al., 2009). But transmission and infection of MAP to other animal species like carnivore (fox, stoats), aves (crow and jackdaw), or lagomorpha such as rabbits have also been described (BEARD et al., 2001;
DANIELS et al., 2003; GREIG et al., 1999; JUDGE et al., 2005, 2006). Precise data on the global prevalence of paratuberculosis are, however, not available.
The estimated herd prevalence of MAP infections in Europe is higher than 50 % (NIELSEN and TOFT, 2009). The true herd prevalence, however, in European countries varies from 0.02-4.57 % in France (DUFOUR et al., 2004), 31-71 % in the Netherlands (MUSKENS et al., 2000), 47 % in Denmark (NIELSEN et al., 2000), and 18 % in Belgium (BOELAERT et al., 2000). In the United States (US) nearly 70 % of MAP infected cattle herds have been reported (LOMBARD et al., 2013).
Paratuberculosis is an untreatable disease and causes high financial losses for the animal meat industry and milk production due to the premature culling of infected animals and the reduced carcass value (BEAUDEAU et al., 2007; GONDA et al., 2007; HASONOVA and PAVLIK, 2006; HUTCHINSON, 1996; TIWARI et al., 2008).
In addition to the economic losses, viable MAP have also been detected in food for human consumption (ALONSO-HEARN et al., 2009; BEUMER et al., 2010;
ELLINGSON et al., 2005; ELTHOLTH et al., 2009; GILL et al., 2011;
IKONOMOPOULOS et al., 2005; MIHAJLOVIC et al., 2010). Consequently, a debate on MAPs zoonotic potential hazard for humans started, especially since MAP has been discussed to be a trigger of Crohn´s disease and diabetes type I (COLLINS,
2004; COSSU et al., 2011; GRANT, 2005; MENDOZA, 2009; WYNNE et al., 2011).
But the pathogenesis and epidemiology of MAP are still not completely understood.
1.2 Characteristics of Paratuberculosis
The contact of calves with adult cow feces is the most important risk factor for the transmission of MAP (DORÉ et al., 2012). Thus, MAP is transmitted via the fecal/oral route, but a vertical transmission via the placenta has also been described (LAMBETH et al., 2004; STREETER et al., 1995; SWEENEY, 1996; SWEENEY et al., 1992; WELLS and WAGNER, 2000; WHITTINGTON and WINDSOR, 2009).
Newborns or calves are primarily infected via ingestion of contaminated colostrums (STREETER et al., 1995; SWEENEY, 1996; WELLS and WAGNER, 2000). But infection via ingestion of manure in the birthplace environment or the udder has also been reported (CHIODINI et al., 1984; NIELSEN and TOFT, 2009; STREETER et al., 1995; SWEENEY, 1996; SWEENEY et al., 1992). Additionally, calves get infected by the ingestion of contaminated food and water due to the fact that apparently diseased animals shed a considerable high amount of MAP (CHIODINI et al., 1984; STABEL, 1998; SWEENEY, 1996). This can increase to 108 CFU per gram feces in the advanced clinical stage and results in highly contaminated field conditions (COCITO et al., 1994; GILARDONI et al., 2012; WHITTINGTON et al., 2004; WINDSOR and WHITTINGTON, 2010). The infection depends on the age of the calves. The older the calves, the lower the infection risk. Especially calves younger than four months of age are highly susceptible to infection, but infection of adults can also occur (TAYLOR, 1953; WELLS et al., 2010; WINDSOR and WHITTINGTON, 2010). The high density of animals, the poor hygienic conditions in stables, the quality of soils (acidic and wet soils), and the fact that MAP is a ubiquitous microorganism with a high tenacity in the environment, favor the transmission of MAP (CHIODINI et al., 1984; CIERKE and KÖHLER, 2009; DORÉ et al., 2012; WHITTINGTON et al., 2004).
MAP represents a mycobacterium species with a special tropism for the intestine, which was not seen in other mycobacteria, yet. In contrast to other mycobacterial diseases granuloma formation in paratuberculosis at the site of infection is diffuse
and results in granulomatous enteritis (ALLEN et al., 2011; Chacon et al., 2004;
HARRIS and BARLETTA, 2001; LUGTON, 1999; SIGURETHARDÓTTIR et al., 2004;
SWEENEY, 2011). Even at late stages of the disease no caseous necrosis or ulceration occurs. Lesions in other areas are found to be less common, confirming the intestinal region as the major site of disease (BUERGELT et al., 1978; CLARKE, 1997; SWEENEY, 2011). Within the gastrointestinal tract MAP colonizes the mucosa of the small intestine by transcytosis across microfold epithelial cells (M-cells) of the Peyer´s patches or enterocytes. Subsequently, MAP is taken up by intra- and subepithilial naïve macrophages in the intestinal and gut-associated lymphoid tissue (GALT) where it persists and induces a chronic transmural inflammatory reaction (BURRELLS et al., 1998; HARRIS and BARLETTA, 2001; MOMOTANI et al., 1988;
PONNUSAMY et al., 2013; POTT et al., 2009; SECOTT et al., 2004;
SIGURETHARDÓTTIR et al., 2004).
In macrophages, MAP inhibits the phagosome maturation (HOSTETTER et al., 2003;
KUEHNEL et al., 2001; RUMSEY et al., 2006). The bacterium multiplies until it kills the cell, spreads and consequently infects other cells nearby. Consequently, other parts of the ileum get infected and a massive colonization of the gut takes place. The gut colonization of MAP causes further recruitment of proinflammatory cells like macrophages and lymphocytes. This massive infiltration of immune cells leads to a visible thickening of the intestine. Altogether, this results in the typical clinical symptoms of paratuberculosis such as diarrhea and emaciation (BUERGELT et al., 1978; COLLINS, 2003; SWEENEY, 2011; WHITLOCK and BUERGELT, 1996).
1.3 Mycobacterium avium ssp. paratuberculosis
MAP belongs to the genus Mycobacterium, a single member of the family Mycobacteriaceae of the order Actinomycetales (EMBLEY and STACKEBRANDT, 1994; VENTURA et al., 2007). In general, the members of this genus are non-motile, non-sporing, aerobic, chemoorganotropic acid-fast rod-shaped (0.2-0.7 x 1.0-10 µm) bacteria (Fig. 1). They are divided into fast and slow growing mycobacteria with visible colonies after 2-60 days. Some Mycobacteria species are fastidious and
require supplements (e.g. MAP) or are not cultivable (e.g. Mycobacterium leprae).
Most mycobacterial species are ubiquitous in the environment but some are obligate parasites and pathogens of vertebrates (HARTMANS et al., 2006; SAVIOLA and BISHAI, 2006).
The genus Mycobacterium is subdivided in the Mycobacterium chelonae group, the Mycobacterium tuberculosis complex, the Mycobacterium avium complex (MAC), and non classified mycobacteria (www.ncbi.nlm.nih.gov, 2004). MAP belongs to the MAC, named by M. avium, which include four subspecies: M. avium ssp. avium (MAA), M.
avium ssp. silvaticum (MAS), M. avium ssp. hominissuis (MAH), and MAP (www.ncbi.nlm.nih.gov, 2004, THOREL et al., 1990; TURENNE and ALEXANDER, 2010; YOSHIMURA and GRAHAM, 1988). This classification was performed on the basis of several genomic differences of isolates predominantly recovered from humans and pigs (MAH) as well as from birds (MAA, BIET et al., 2005; MIJS et al., 2002; TURENNE et al., 2007, 2008). Additionally, the MAC includes further single species like M. chimaera, M. arosiense, M. colombiense, or M. vulneris (www.ncbi.nlm.nih.gov, 2004; TURENNE and ALEXANDER, 2010)
Figure 1: Electron microscopic picture of M. avium ssp. paratuberculosis. The picture was performed by Mark Kuehnel (Institute of Functional and Applied Anatomy, Centre for Anatomy, Hannover Medical School).
Despite the close genetic relation of all members in the M. avium complex, MAP is phenotypically very distinct from the other members since it is the only pathogenic mycobacterium with a strong gut tropism (BANNANTINE and BERMUDEZ, 2013;
VALENTIN-WEIGAND, 2002, 2004; VALENTIN-WEIGAND and GOETHE, 1999).
Alexander and colleagues suggested that the phenotypic differences might be linked to acquisition, loss, and re-arrangement of specific genetic elements. In particular, they found 16 large sequence polymorphisms (LSP) exclusive to MAP. Furthermore, six of these LSP harbored 82 open reading frames (ORFs) with most of them were not of mycobacterial origin and exhibited similarities to genes from environmental Actinomycetes. Thus, the characterization of specific genetic elements could be a suitable way to understand the fastidious nature of MAP (ALEXANDER et al., 2009;
MARRI et al., 2006).
MAP is a member of the gram-positive bacteria with a high guanine cytosine (GC) content. The genome of the MAP K-10 strain, a clinical isolated optained from feces samples of paratuberculosis infected cow (1990, WI, USA), was sequenced in 2005 and re-sequenced in 2010 (LI et al., 2005; WYNNE et al., 2010). It consists of a single circular chromosome containing 4.829781 bp with 4351 predicted ORFs, 45 transfer RNAs, and one ribosomal RNA operon (LI et al., 2005). The presence of multiple copies of the insertion elements (IS) 900 and ISMav2 in the genome are the basis for a genotypic differentiation from other M. avium subspecies in diagnostic tests (MÖBIUS et al., 2008; PLAIN et al., 2013; SALGADO et al., 2013; STING et al., 2013; STRATMANN et al., 2002; STROMMENGER et al., 2001; SUNG et al., 2004).
As a slow growing mycobacterium species, MAP has a doubling time of about 26 h (LAMBRECHT et al., 1988). It grows mycobactin-dependent in vitro, but supplementation with alternative iron sources promotes the growth of MAP (HOMUTH et al., 1998; MERKAL and CURRAN, 1974; MERKAL et al., 1968). The mycobactin auxotrophy is only present in certain media and it has been reported that after multiple passages in culture, MAP loses its mycobactin dependence (BARCLAY et al., 1985). Moreover, the mycobactin auxotrophy is used for phenotypic differentiation at the subspecies level (THOREL, 1990).
The fastidious nature of MAP was further supported by the various pheno- and genotypes within the species (ALEXANDER et al., 2009; BAUERFEIND et al., 1996;
DOHMANN et al., 2003; PAVLIK et al., 1999). The subspecies MAP includes very slow growing as well as uncultivable bacteria (MACHACKOVA et al., 2003). Further, the histopathological phenotypes range from a pluribacillary (lepromatous) type with visible MAP in the tissue, to a paucibacillary (tuberculoid) type with no MAP in the tissue and not detectable MAP in culture, but showing the typical clinical symptoms (CHIODINI et al., 1984, 2011; CLARKE and LITTLE, 1996).
1.4 Molecular pathomechanisms of MAP
The molecular pathomechanisms of MAP are not fully understood so far. But it became clear that MAP shares pathomechanisms with other pathogenic
mycobacteria such as Mycobacterium tuberculosis (MTB) and MAA, especially the ability to survive in macrophages (COUSSENS, 2001; CROWLE et al., 1991;
INDERLIED et al., 1993; KUEHNEL et al., 2001; ROWE and GRANT, 2006;
STABEL, 2007; WELIN, 2011). In general, pathogenic mycobacteria exhibit four strategies to resist the enzymatic and toxic degradation of macrophages. First, they exhibit a thick, lipid-rich cell envelope, which is mainly responsible for mycobacterial resistance and provides protection due to the efficient barrier effect. Second, the mycobacterial cell wall contains biologically active components that inhibit bactericidal functions of macrophages. Third, mycobacteria modulate the cooperation between innate and specific immunity. And fourth, they adapt their metabolism due to the nutrient starvation in macrophages (BORDBAR et al., 2010; EHRT and SCHNAPPINGER, 2009; INDERLIED et al., 1993; WAGNER et al., 2002; WEISS and SOUZA, 2008; WOO and CZUPRYNSKI, 2008). In detail, MAP as well as MTB or MAA inhibit the phagosome maturation, which in turn results in a formation of a
“mycobacterial” phagosome (HOSTETTER et al., 2003; KUEHNEL et al., 2001; LEI and HOSTETTER, 2007). For MTB, it was reported that the cell wall associated glycolipids lipoarabinomannan (LAM), phosphatidylinositol mannosides (PIM), and a- a-D-trehalose 6, 6'-dimycolate (cord factor) are involved in this process since they inhibit the fusion between endosome and lysosome (BARROW, 1997; BRENNAN, 2003; FRATTI et al., 2003; HINES et al., 1993; INDRIGO, 2003; MISHRA et al., 2011; NEILL and KLEBANOFF, 1988; SPARGO et al., 1991; VERGNE et al., 2004).
This holds also true for MAP (KUEHNEL et al., 2001; RUMSEY et al., 2006;
TESSEMA et al., 2001). Further, MAP activates the production of proinflammatory cytokines in macrophages. Unlike in MTB and MAA, however, the production of interleukin (IL)-1, IL-8, tumor necrosis factor (TNF)-α, and macrophage inflammatory protein (MIP)-1β is significantly lower in MAP (BASLER et al., 2008, 2010, 2013;
ROMANO and COLSTON, 2003). Furthermore, in contrast to MAA, MAP inhibits the antigen specific stimulation of CD4+ T cells (ZUR LAGE et al., 2003).
Despite their membership to the gram positive bacteria, the Mycobacteria are characterized by a more complex cell wall structure. This is linked to the unusual physiochemical properties of Mycobacteria with a waxy mixture of lipids and
polysaccharides on their surface (BRENNAN, 2003; LEMASSU and DAFFÉ, 1994;
NIEDERWEIS et al., 2010; SONG et al., 2008). The cell wall consists of four layers:
the plasma membrane, the electron-dense layer, the electron-transparent layer, and the outer layer (Fig.2, BARROW, 1997; CHATTERJEE et al., 1992; COOK et al., 2009; FALLER et al., 2004; HOFFMANN et al., 2008; NIEDERWEIS et al., 2010).
Figure 2: Schematic illustration of the mycobacterial cell wall.
The plasma membrane is formed by a lipid bilayer. The electron-dense layer consists of the peptidoglycan backbone which is covalently linked to a branched chain of arabinogalactan by a diglycosylphoshoryl bridge (CRICK et al., 2001; KAUR et al., 2009). The electron-transparent layer mainly consists of a characteristic fatty acid – the mycolic acid. Mycolic acids are β-hydroxy-α-alkyl branched structures of high molecular weight esterified to the arabinogalactan. Furthermore, they are the largest
known natural fatty acids (DAFFÉ and DRAPER, 1998). The surface outer layer consists of serovare-specific glycolipids (CHATTERJEE and KHOO, 2001;
ECKSTEIN et al., 2003; SCHOREY and SWEET, 2008). Overall, the mycobacterial cell wall contains about 60 % of lipids which result in acid fastness, hydrophobicity, and increased resistance to chemicals and physical processes (ALDERWICK et al., 2007; BHATT et al., 2007; BRENNAN, 2003; JARLIER and NIKAIDO, 1994; ROWE and GRANT, 2006). Thus, the complex cell wall structure is one reason for the high tenacity of MAP (COCITO et al., 1994).
1.4.1 Mycobacterial metabolism
In the recent years it became clear that the metabolic adaption after phagocytosis and in the phagosomal environment is the major determinant for mycobacterial survival in the host (EOH and RHEE, 2013; FANG et al., 2010, 2012; GRIFFIN et al., 2012; SINGHAL et al., 2013; WEIGOLDT et al., 2013). Mycobacteria adapt their metabolism to the nutrient availability in the host niche (EISENREICH et al., 2010;
SCHNAPPINGER et al., 2003). The knowledge about MAP´s metabolic adaption in its natural host is limited, but it was demonstrated in MTB that the carbon metabolism is the key factor for this adaption. MTB strains defective in the pyruvate dehydrogenase complex, the glyoxylate shunt, or the gluconeogenic enzyme phosphoenolpyruvate carboxykinase were attenuated during the chronic phase of infection in a murine model of pulmonary tuberculosis (MARRERO et al., 2010, 2013;
MCKINNEY et al., 2000; MUÑOZ-ELÍAS and MCKINNEY, 2006; RHEE et al., 2011;
SHI and EHRT, 2006; TIAN et al., 2005a, 2005b). Unlike other bacteria, MTB showed a compartmentalized co-catabolism of carbon substrates and this compartmentalization was also associated with a separated metabolism of each carbon source (DE CARVALHO et al., 2010). The simultaneous use of multiple carbon sources resulted in a growth enhancement. Moreover, MTB seemed to metabolize individual carbon sources in the same pathway concurrently but in opposite directions (DE CARVALHO et al., 2010; RHEE et al., 2011).
Transcription analysis from MTB obtained from macrophages in vitro as well as from lungs of mice and humans indicated an adaption in the intermediary metabolisms (TALAAT et al., 2004; TIMM et al., 2003). Under in vitro conditions, glucose and glycerol formed the primary carbon sources for energy and carbon metabolism (BLOCH and SEGAL, 1956; MERKAL and CURRAN, 1974; SASSETTI et al., 2003;
SCHNAPPINGER et al., 2003). In the in vivo situation, however, MTB rather utilized host-derived lipids within the phagosome such as the sterol cholesterol, which is an important component of the eukaryotic plasma membrane (MUÑOZ-ELÍAS and MCKINNEY, 2006; RAMPRASAD et al., 2007; RUSSELL et al., 2010;
SCHNAPPINGER et al., 2003; STOKES and WADDELL, 2009; VAN DER GEIZE et al., 2007). This preference results in an upregulation of genes involved in ß-oxidation.
The degradation of the cholesterol side chains to one acetyl-CoA and two propionyl- CoAs is catalyzed via an intracellular growth (igr) operon, which is upregulated in MTB obtained from the early phagosome. (CHANG et al., 2009; MINER et al., 2009;
ROHDE et al., 2012; THOMAS et al., 2011; YANG et al., 2011). The propionyl-CoAs can be catabolized via a vitamin B12 dependent reaction of the methylmalonyl-CoA cycle (MMC) to succinyl-CoA which is used in the tricarboxylic acid (TCA) cycle (SAVVI et al., 2008). Moreover, the propionyl-CoAs display precursors for uneven fatty acid synthesis via the MMC. In line with this, MTB accumulates triglycerol in the cytosol as an energy and carbon source during infection of macrophages (DANIEL et al., 2011; ELAMIN et al., 2011). Additionally, propionyl-CoA could also be catabolized via the methylcitrate cycle (MCC) to pyruvate (SAVVI et al., 2008; WARNER et al., 2007).
Recent protein profile studies from in vivo clinical MAP strains and their isolates indicated that cholesterol is used as a carbon source in the bovine intestinal mucosa (WEIGOLDT et al., 2013). It appears that the central metabolism is driven by an enhanced ß-oxidation of alternative lipid sources from the host, e.g. cholesterol, to produce acetyl-CoA. Further, the metabolic adaption of MAP responds to the antimicrobial host reactions by increased expression of oxidative stress response proteins. It seems that MAP compensates the energy loss for this process by enhanced activity of the pentose phosphate pathway (PPP) and adenosine
triphosphate (ATP) generation via oxidative phosphorylation. Therefore, a similar metabolic adaption like in MTB is suggested in MAP (WEIGOLDT et al., 2013).
1.4.2 Metal-dependent regulator and virulence
Especially enzymes of metabolic pathways require metal ions like iron for their biological activity (PENNELLA and GIEDROC, 2005). For instance, in MTB iron is an obligate cofactor for at least 40 enzymes (DE VOSS et al., 1999). Despite the importance of iron, its abundance causes cytotoxic effects due to its wide redox potential. Unbound iron is very reactive and results in the generation of reactive oxygen species (ROS) via the Fenton reaction (BOSSMANN et al., 2004).
Consequently, in the host iron is bound to proteins such as transferritin, lactoferritin, or ferritin and therefore it is not available for mycobacteria (RODRIGUEZ and SMITH, 2003). As a consequence, bacteria including MAP have to adapt their gene transcripton to circumvent iron limitation in the host. Thus, mycobacteria such as MAP exhibits iron dependent transcription regulators to overcome the iron starvation (BANERJEE et al., 2011; GOLD et al., 2001; JANAGAMA et al., 2009; LUCARELLI et al., 2008; RODRIGUEZ, 2006).
Altogether, two iron dependent families are described in bacteria, the diphtheria toxin repressor (DtxR) and the ferric uptake regulator (Fur) family. Both families regulate a large variety of genes involved in e.g. iron uptake, oxidative stress response, signal transduction, or cell development in gram-positive and -negative bacteria (ANDREWS et al., 2003; ERNST et al., 2005; HAHN et al., 2000a, 2000b; HANTKE, 2001; LOVE et al., 2004; MILANO et al., 2001; OCHSNER et al., 1995; VAN VLIET et al., 1998; ZOYSA et al., 2005). Despite their iron dependence, both families do not share any significant sequence motifs and bind to different DNA target sequences, so called boxes, in the promoter region of iron regulated genes (HANTKE, 2001). In general, metal binding with the regulator protein initiates homodimer formation. This homodimer binds to the box followed by a transcriptional repression or activation of the downstream located genes. The box is often a non-perfect palindromic sequence which contains A+T rich bases and has a length of about 19-23 bps (CARPENTER et
al., 2009; LUCARELLI et al., 2008; ORAM et al., 2004; RATLEDGE and DOVER, 2000; WISEDCHAISRI et al., 2004).
In the genome of MAP, four iron dependent regulator proteins have been found (LI et al., 2005). The iron dependent regulator (IdeR) and the staphylococcal iron regulator repressor (SirR) belong to DtxR family (COLE et al., 1998; GUPTA and CHATTERJI, 2005; LI et al., 2005; NEWTON-FOOT and GEY VAN PITTIUS, 2012). SirR, however, is incomplete and non-functional in MAP (MARRI et al., 2006). The IdeR has been identified as the main regulator of the iron metabolism in mycobacteria (JANAGAMA et al., 2009, 2010; RODRIGUEZ et al., 2002; SCHMITT et al., 1995).
For the IdeR in MTB, it was further reported that it additionally controls genes encoding for putative transporters, transcriptional regulators, as well as proteins involved in general metabolism and signal transduction including members of the mycobacterial conserved PE/PPE family or virulence determinants like MmpL4 (RODRIGUEZ and SMITH, 2003).
Other iron dependent regulators are the ferric uptake regulators A and B (FurA/B), which belong to the fur family (LI et al., 2005; LUCARELLI et al., 2008). The precise role of FurA in mycobacteria is not really understood, but it has been reported that Fur proteins in other bacteria act also as a transcriptional activator or repressor.
Thereby, most of the regulated genes are involved in various cellular functions including the primary metabolic pathways such as TCA cycle and glycolysis, as well as iron homeostasis and expression of virulence associated genes (VASIL and OCHSNER, 1999; WONG et al., 1999). In MTB, FurA needs intracellular Fe2+ as a co-repressor for binding to a 23 bp operator sequence – Fur box – (AGTCTTGACTGATTCCAGA) upstream of the FurA-regulated genes, after Fe2+
initiated the homodimer formation (CARPENTER et al., 2009; LUCARELLI et al., 2008; SALA et al., 2003). FurA regulates its own expression and is co-transcribed with a catalase-peroxidase (KatG, SALA et al., 2003, 2008; ZAHRT et al., 2001).
KatG is induced upon oxidative stress and displays a major virulence factor for MTB since it counteracts the phagocyte oxidative burst (MILANO, 2001; PAGÁN-RAMOS et al., 1998; PYM et al., 2001; VINCENT et al., 2004). Consequently, it was suggested that FurA plays an important role in the oxidative stress response, which
in turn is involved in the intracellular survival and persistence of pathogenic mycobacteria in the host (LUCARELLI et al., 2008; MILANO et al., 2001; PAGÁN- RAMOS et al., 1998; PYM et al., 2001). In MAP, a similar genetic organization of FurA and a strong homology to the FurA of MTB suggested a similar function (SANTOS et al., 2008). However, no characterization of FurA in MAP was performed, so far.
Another Fur-like regulator is the FurB, which is still not well defined in mycobacteria.
Previously, it was reported that FurB possesses a strong affinity to zinc (Zn) suggesting the involvement of FurB in the control of Zn-sensitive genes (CANNEVA et al., 2005; LUCARELLI et al., 2008; MACIAG et al., 2007; MILANO et al., 2004).
1.4.3 Iron acquisition in mycobacteria
The regulation of the balance between benefit and harm of iron is one of the most fundamental key-steps of the mycobacterial survival within the host. It was reported that MAP is not able to multiply within macrophages without iron supplementation of the cell culture medium (KUEHNEL et al., 2001). Thus, the availability of iron seems to play a pivotal role for the pathogenicity of MAP.
In general, the structure of the bacterial cell envelope prevents an uncontrolled passage of iron in and out of the cytosol. To overcome the iron starvation in the host, mycobacteria as other bacteria have developed a system for iron acquisition via producing small, high-affinity iron chelating compounds, called siderophore (ANDREWS et al., 2003; BANERJEE et al., 2011; RODRIGUEZ, 2006; RODRIGUEZ and SMITH, 2003). The excreted siderophore bind extracellular ferric Fe3+. This binding leads to a siderophore-ferric complex formation which interacts with specific receptor proteins on the bacterial cell surface to activate an ATP binding cassette (ABC) transporter of the iron-loaded siderophore in the cytosol. Complexed Fe3+ is released by the reduction to Fe2+ (ferrous iron) and loaded on iron storage or transport proteins, such as bacterioferritin, to avoid toxicity (ANDREWS et al., 2003;
BANERJEE et al., 2011).
Four types of structurally distinct molecules involved in iron acquisition are expressed in mycobacteria (DE VOSS et al., 1999). Salicylic acid and citric acid are small molecules with a low affinity to iron which can be used for the iron uptake (MESSENGER and RATLEDGE, 1982; RATLEDGE and STANFORD, 1982).
Furthermore, two types of siderophores – exochelin and mycobactin – are known in mycobacteria. Mycobactin is derived from a phenyloxazolidine ring and is associated with salicylate (RODRIGUEZ, 2006; DE VOSS et al., 2000). Two forms of mycobactin are produced, which differ in polarity and solubility due to the length of substituted alkyls. Carboxymycobactin, the more polar and soluble form, is secreted into the medium where it removes iron that is bound to iron-binding proteins of the host (GOBIN and HORWITZ, 1996; LANE et al., 1995; RATLEDGE and EWING, 1996;
DE VOSS et al., 1999). Mycobactin, the less polar form, remains cell associated and takes iron from carboxymycobactin (RATLEDGE and EWING, 1996; RATLEDGE et al., 1982; DE VOSS et al., 2000). Disruption of mycobactin biosynthesis leads to an attenuation of MTB in growth and virulence (REDDY et al., 2013; DE VOSS et al., 2000). Another strategy of MTB is the direct uptake of carboxymycobactin via the ABC transporters irtA and irtB (RODRIGUEZ and SMITH, 2006). These ABC transporters as well as the mycobactin biosynthesis are important for the virulence of MTB (LUO et al., 2005; REDDY et al., 2013). In contrast, non-virulent mycobacteria such as M. smegmatis produce mainly mycobactin and exochelin, but a carboxymycobactin production in a lower level than the exochelin production was reported (LANE et al., 1998; MACHAM et al., 1975; RATLEDGE and EWING, 1978;
DE VOSS et al., 1999). Exochelin is a peptidic siderophore with an association to ornithine-derived hydroxamates (SHARMAN et al., 1995a, 1995b; ZHU et al., 1998).
1.4.4 Relevance of iron for MAP
MAP cannot produce mycobactin, due to the fact that 200 bp are truncated in the mycobactin A (mbtA) gene, the first gene of the mycobactin synthesis operon (BARCLAY et al., 1985; LI et al., 2005). However, an exochelin production of MAP has been reported, but the genomic region of exochelin synthesis and consequently
the mechanism of iron uptake are yet unknown (BARCLAY and RATLEDGE, 1983;
SNOW, 1970). The lack of mycobactin synthesis, and the synthesis of exochelins suggested an alternative iron uptake mechanism in MAP. Stratmann and colleagues reported a MAP-specific putative pathogenicity island harboring mostly genes which encode proteins with predicted functions in iron metabolism (STRATMANN et al., 2004). This pathogenicity island is located on the MAP-specific element LSP14, the largest LSP (65.1 kb), and harbors gene classes predicted to mediate metal and siderophore transport (ALEXANDER et al., 2009). Three putative operons are located on this pathogenicity island. The ferric enterochelin operon (fepB-D and tauD, MAP3726 to MAP3729) encodes genes for intracellular siderophore transport- and modifications. The siderophore synthesis operon (sidA-F, MAP3740 to MAP3746) encodes genes for siderophore synthesis (STRATMANN et al., 2004) and was previously reported as downregulated in MAP obtain from the ileum of infected cows (JANAGAMA et al., 2010). An in vitro assay, however, displayed that a gene of this operon, the MAP3744, is upregulated in MAP during infection of bovine monocyte derived macrophages (JANAGAMA et al., 2010). The last operon on the pathogenicity island, the Mycobacterium paratuberculosis transporter operon (mptA- F, MAP3731c to MAP3736c) is predicted as an ABC-transporter of an alternative iron uptake system (STRATMANN et al., 2004). It was shown that genes of this operon are transcripted from a single polycistronic mRNA (HEINZMANN et al., 2008) and are downregulated in MAP obtain from the ileum of infected cows (JANAGAMA et al., 2010). Furthermore, it was suggested that the mpt operon encodes for two parts – the mptA-C (MAP3736c-34c) and the mptD-F (MAP3733c-31c, ECKELT et al., 2012, www.ncbi.nlm.nih.gov/gene, 2004). Interestingly, a recent study demonstrated that mptA-C is related to the irtAB operon of MTB and functions as a carboxymycobactin transporter system for iron assimilation within the host linked to oxidative stress.
MptB (MAP3735c) and MptC (MAP3734c) form a dimer and export non-ferrated carboxymycobactin, whereas MptA imports ferrated carboxymycobactin (LAMONT et al., 2013). It was further reported that the MptC is upregulated in MAP after hydrogen peroxide treatment as well as in MAP obtained from paratuberculosis positive cow feces (WU et al., 2007). Moreover, the iron transport system is suggested to be
activated by the PPE protein (MAP3737), which senses nitric oxide (NO) production in macrophages (LAMONT et al., 2013). The mptD-F cluster was predicted as an energy coupling factor (ECF)-transporter (ECKELT et al., 2012;
www.ncbi.nlm.nih.gov/gene, 2004). ECF transporters display a novel class of ABC-importers, which are involved in metallic cation, iron-siderophore, or vitamin B12 transport (RODIONOV et al., 2009; ZHANG et al., 2010).
The mptA contains two putative Fur boxes in its promoter region. Hence, it was suggested that the inorganic metal uptake operon is regulated by FurA (STRATMANN et al., 2004). The putative pathogenicity island represents therefore an alternative system for the uptake of iron in MAP. The role of the MptD-F is unknown, so far. But the MptD-F is of special interest since one of the proteins, the MptD (MAP3733c), has been shown to be surface exposed and virulence associated (SHIN et al., 2006; STRATMANN et al., 2004). Furthermore, it was reported that MptD is downregulated after hexadecylpyridinium chloride or hydrochloric acid treatment and upregulated in MAP obtained from paratuberculosis positive cow feces. Moreover, the MptD is not present in any other mycobacterial species sequenced until now (COSSU et al., 2011). Additionally, Cossu and colleagues detected antibodies against MptD in sera of type I diabetes mellitus patients suggesting a possible role of MptD in the pathogenicity of MAP (COSSU et al., 2011).
1.5 Aims of the study
MAP exhibits different phenotypic features not found in other mycobacteria, which might contribute to its particular gut tropism. MAP-specific LSPs are suggested to be relevant for MAP´s distinctive features. In particular, the LSP14 contains genes assigned to metal acquisition, which are proposed to overcome MAP´s inability to produce its own mycobactin and to contribute to the iron homeostasis. Nevertheless, its precise role for MAP is unclear. The putative pathogenic 38 kb island harbors three clusters involved in siderophore synthesis, modulation, and transport. The mpt operon encodes for a carboxymycobactin transporter system (MptA-C) involved in metal or siderophore transport, but the role of the MptD-F is yet unknown. MptD is of special interest since it is surface exposed and virulence associated. Moreover, recent studies reported serum reactivity against MptD in diabetes type I patients.
Thus, an important role of MptD in the virulence of MAP is suggested. Noteworthy, two putative fur boxes have been found in the promotor region of mptA, which presume that the mpt operon might be regulated by the FurA protein. Moreover, FurA is described as a stress dependent regulator due to the co-transcription as well as stress dependent regulation with KatG. The role of FurA in mycobacteria, however, is not fully understood, so far.
The aim of the presented study was to characterize the MAP-specific MptA-F operon by analysing a MAP∆mptD and MAP∆furA strain.
2 Material and Methods 2.1 Material
If not stated otherwise, all materials were purchased from Sigma Aldrich (München, Germany) or Carl Roth (Karlsruhe, Germany). All used chemicals, kits, and equipments are listed in the appendix (Tab. 19-21 in appendix 10.8)
2.1.1 Bacterial strains and media
If not stated otherwise, all bacteria were treated according to risk group classification complying with the regulations of the Federal Institute for Occupational Safety and Health (BAuA), Germany. All Escherichia coli strains were classified to risk group 1 and all mycobacteria strains were classified to risk group 2. Bacterial strains used in this thesis are listed in table 1.
Table 1: Bacterial strains
Strain Characteristics Source / reference
E. coli HB101 K-12 derivative, supE44, hsd20, r
BmB, recA13, ara-14, proA2, lacY1, galK2, rpsL20, xyl-5, mtl-1
(BOYER and
ROULLAND-DUSSOIX, 1969)
E. coli Top 10F´ F’, mcrA, ∆(mrr-hsdRMS-mcrBC), Φ80lacZ∆M15, ∆lacX74, recA1,
deoR,araD139, ∆(araleu)7697, galU, galK, rpsL, (Str
r
) endA1, nupG
TOPO TA Cloning
®
, Invitrogen GmbH, Karlsruhe, Germany M. avium ssp. para-
tuberculosis DSM44135
Clinical isolate of a decontaminated dung sample of a paratuberculosis infected cow, DSM44135
University of Veterinary Medicine Hannover, Foundation, Germany (JARK et al., 1997) M. smegmatis mc
2
155 Transformable strain of the isolate M. smegmatis ATCC 607
Moredun Research Institute, Edinburgh, UK (SNAPPER et al., 1990) M. avium ssp.
paratuberculosis ∆mptD
mptD deletion mutant of M. avium ssp.
paratuberculosis DSM44135
(HEINZMANN, 2008) M. avium ssp.
paratuberculosis ∆furA
furA deletion mutant of M. avium ssp.
paratuberculosis DSM44135
Present thesis
2.1.2 Oligonucleotides
All Oligonucleotides used in this thesis were purchased from biomers.net GmbH (Ulm, Germany) and are listed in table 2.
Table 2: Oligonucleotides
Oligonucleotide Primer position Sequence (5’ to 3’)
oRTSidEfw Forward, 4179597-4179616b CGTTCACGCTGACGAGATTA oRTSidErev Reverse, 4179766-4179785b AAGGGGTAGACAACGTGCAG oRTMptDfw Forward, 4154903-4154922b AGATTGCGTACGCCAGTACA oRTMptDrev Reverse, 4155041-4155060b GACGGTGTTTGCGATTATCA oMAP2606cfw Forward, 2938900-2938918b GAGCTCTTGGACAGCGAGT oMAP2606crev Reverse, 2939108-2939127b GGCGCTGTACTACCTGAACT oMAP2607rev Forward, 2939710-2939728b AGAAGTCGGCGTTGATCTG oMAP2607fw Reverse, 2939893-2939912b CTGTGTCGACATCAAGGACA oMAP2962crev Forward, 3297144-3297162b GTAGACGCTGCCCATTTTC oMAP2962cfw Forward, 3297144-3297162b GTAGACGCTGCCCATTTTC oMAP2962crev Reverse, 3297325-3297343b ACGGACAGATCGTGGAGAT oMAP2961crev Forward, 3294817-3294836b CATATTCGGTGAACAGCAGA oMAP2961cfw Reverse, 3295251-3295268b GGCCGATCTCGAGCTGAT oMAP2192fw Forward, 2435718-2435737b CATCAACAACCTCTCCAACC oMAP2192rev Reverse, 2435900-2435919b TTCGGCGTAGATGATTTTTC oGapDHfw # Forward, 1221936-1221954b ATCGGGCGCAACTTCTACC oGapDHrev # Reverse, 1222038-1222058b GTCGAATTTCAGCAGGTGAGC oHKGgrpEfw Forward, 4297449-4297466b CGGAACAGGTGACGGTTA oHKGgrpErev Reverse, 4297718-4297735b CTCCAAATCGTCGAGCAC oHKGsecAfw Forward, 3724679-3724698b TGTCGTAGAGCCGGAAGTAG oHKGsecArev Reverse, 3724898-3724917b GGTCAGCTACCTCAACAACG
Oligonucleotide Primer position Sequence (5’ to 3’)
oMAP2186cfw Forward, 2428058-2428077b TTCAACTCCCCAATCGACAT oMAP2186crev Reverse, 2428462-2428481b TGAAGTTGGCCGAAGAACAC ohsp18_1fw Forward, 1856283-1856302b TGTGGTTGTGGTTGATCTCG ohsp18_1rev Reverse, 1856667-1856686b TCATGGTGTTGATGCGTACA oMAP2583cfw Forward, 2906989-2907008b TAGCGCAGTACCGACAACAC oMAP2583crev Reverse, 2907433-2907452b GACACGATCAAGCGAATCCT oMAP2582cfw Forward, 2904853-2904872b CACCCACACTTCTTCCTCGT oMAP2582crev Reverse, 2905262-2905281b GAGAACTTCGGGCTGGACTA oMAPltp2_2fw Forward, 2914091-2914110b AGCTACTACCGCGACGACAT oMAPltp2_2rev Reverse, 2914308-2914327b GTTGGTGTTGATCGGGAACT ofadE26_2fw Forward, 2909762-2909781b ATGGCCCAAAGAGTATGGTG ofadE26_2rev Reverse, 2910217-2910236b CACGTCGTCGTAGAACGTGT oMAP2586fw Forward, 2910796-2910815b ACCGACTCAGAAACCGTCAG oMAP2586rev Reverse, 2911252-2911271b GTGTAGGTCGTCAGCCAGGT oMAP2584fw Forward, 2909069-2909088b CTCAACTTCGCCTTTCTGCT oMAP2584rev Reverse, 2909465-2909484b AGCAGCTCCTCGAAGAACAC oFurA1a Forward, 1824956-1824975b,
containing an AflII restriction site
GCATCTTAAGCGGCACCGATGGTGTTGAGA
oFurA2a Reverse, 1823961-1823980b, containing an XbaI restriction site
GCATTCTAGACAACCTGTCCGCGTAATCGG
oFurA3a Forward, 1823529-1823548b, containing an XhoI restriction site
GCATCTCGAGAGCCCGATTCACCCACCCTC
oFurA4a Reverse, 1822455-1822474b, containing an SpeI restriction site
GCATACTAGTCTTGGTCAGCTCCCACTCGT
oTKfurAKatGfw Forward, 2387541-2387560b GAAGGGATTGCTGGGTTTTC oRTlppsrev Reverse, 2386542-2386561b GTCTACACCGTGCTCGACAA
Oligonucleotide Primer position Sequence (5’ to 3’)
oRTlppSfw Forward, 238654-2386561b GTCTACACCGTGCTCGACAA oTKfurAKatGrev Reverse, 2387541-2387560b GAAGGGATTGCTGGGTTTTC oIS900fw ## Forward, 1313076-1313097b TTCTTGAAGGGTGTTCGGGGCC oIS900rev ## Reverse, 1312538-1312559b GCGATGATCGCAGCGTCTTTGG a The position numbers given relate to GenBank accession no. AF419325
b The position numbers given relate to GenBank accession no. AE016958
# (GRANGER et al., 2004)
## (DORAN et al., 1997)
2.1.3 Plasmids, phasmids and phages
The used plasmids and phages as well as their derivates are listed in table 3.
Table 3: Plasmids and phages
Plasmid/ Phasmid/
Phage
Description
pYUB854 # cosmid vector containing a λ cos site and a PacI site
phAE87 # conditionally replicating shuttle phasmid-derivative of TM4 carrying a resident cosmid pYUB328 flanked by PacI sites
pMFur920 PCR product obtained using primers oFurA1a and oFurA2a cloned into the pCR2.1® TOPO vector
pMFur930 PCR product obtained using primers oFurA3a and oFurA4a cloned into the pCR2.1® TOPO vector
pMFur1501 XhoI/SpeI fragment of pMP930 ligated into pYUB854 pMFur1510 AflII/XbaI fragment of pMP920 ligated into pMFur1501
phAE115 PacI restricted and self-ligated phAE111 concatamer ligated into pMFur1510
# (BARDAROV et al., 1997)
2.2 Methods
2.2.1 Media and bacterial growth conditions
If not stated otherwise, the bacteria were cultured as follows. The E. coli DH5α, the HB101, Top10F´, and the M. smegmatis mc2 155 strain were cultured in Luria-Bertani (LB) broth or on LB agar plates containing antibiotics in appropriate concentrations (ampicillin and kanamycin [100 µg/ml], hygromycin B [50 µg/ml]). The bacteria were cultured in an incubator (Memmert GmbH & Co, KG, Schwalbach, Germany) or a shaking incubator (Incubator shaker Series 25, New Brunswick Scientific Co, Inc., Edison, NJ, USA) at 37°C.
MAP was grown in Middlebrook (MB) 7H9 broth or on MB 7H10 (BD Difco GmbH, Heidelberg, Germany) agar containing 3.6 mM NaCl, 1.89 x 10-2 mM albumin fraction V, 2.8 mM glucose, 0.03 g catalase, 5 mM oleic acid (OADC), 1.09 x 10-3 mM mycobactin J (Allied Monitor, Fayette, MO, USA), and 0.2 mM Tween® 80 (Merck, Darmstadt, Germany). If necessary, antibiotics were supplemented in appropriate concentrations (kanamycin 100 µg/ ml or hygromycin B 50 or 75 µg/ ml, Roche GmbH, Mannheim, Germany). The liquid cultures were incubated in tightly closed screw cap bottles with stirring on a magnetic stirrer (Variomag, Daytona Beach, FL, USA) at 150 rpm and 37°C. MB 7H10 agar plates were lagged with parafilm, sealed in plastic bags to avoid dehydration, and incubated at 37°C. In table 4 the recipes of the media for the bacterial culturing are listed.
For growth experiments bacteria were grown in MB 7H9 media with OADC enrichment in a 1 l bottle at 150 rpm and 37°C until an OD600 of 1. Bacteria were singularized during centrifugation of the bacteria culture at 8.000 x g for 15 min.
Afterwards, the bacterial cultures were washed twice with 15 ml sterile phosphate buffered saline (PBS; 8.0 g NaCl, 0.2 g KCl, 1.43 g Na2HPO4.
x 2 H2O, 0.2 g KH2PO4
add 1 l ddH2O, adjusted to pH 7 with HCl, autoclaved, and stored at 4°C). Then, bacteria were vortexed with 30 sterile glass beads (2-3 mm) at RT for 20 min and centrifuged at 400 x g for 10 min. The culture was chilled ice for 20 min to drop the bacteria aggregates by gravity.
Table 4: Media
Medium Characteristics
LB broth 10 g Bacto®tryptone, 5 g yeast extract, 5 g NaCl, add distilled water to 1 l, autoclave for 10 min.
LB agar LB broth with 2 % agar [w/v], autoclave and pour in 10 cm agar plates.
MB 7H9 4.7 g 7H9 broth, 2.5 % glycerol [v/v] and 2 mg mycobactin J (Allied Monitor, Fayette, Missouri, U.S.A), add distilled water to 900 ml, autoclave for 10 min, cool to 55 C, add 100 ml OADC enrichment and add 0.05 % [v/v]
Tween® 80 to avoid clumping of bacteria.
MB7H10 19 g MB 7H10 agar, 0.5% glycerol [v/v] and 2 mg mycobactin J, add distilled water to 900 ml, autoclave for 10 min, cool to 55 °C, add 100 ml OADC enrichment.
Watson Reid 5 g L-asparagine, 2 g di-ammoniumcitrate, 75 mg ferric-ammoniumcitrate, 2 g NaCl, 2 g KH2PO4, 4 mM MgSO4, 35 µM ZnSO4, 0.14 mM CaCl2, 2 mg CoCl2, 2 µg ml-1 and 63 ml glycerol, add distilled water, adjust pH value to 6.0 with NaOH, and add distilled water to 900 ml, autoclave for 10 min, cool and add 2 g sodium pyruvate and 10 g D-glucose to a 1 l volume.
Middlebrook phage (MBP) agar
20 g MB7H10 agar, 1 g NaCl, 7.5 g glucose, autoclave and add sterile 10 mM MgSO4, 2 mM CaCl2 and 60 µl oleic acid.
Glycerol/ yeast extract/
tryptone/ Tween (GYTT) medium
10 % [v/v] glycerol, 0.125 % [w/v] yeast extract, 0.25%[w/v] Bacto® tryptone, 0.02 % [v/v] Tween
®
80.
2.3 Manipulation of nucleic acids
If not stated otherwise, all methods were performed in accordance to Molecular Cloning I–III: A Laboratory Manual (SAMBROOK et al., 1989).
2.3.1 Genomic DNA preparation
This method was performed according to Mycobacteria protocols with some modifications (PARISH and BROWN, 2009; PARISH and STOKER, 1998). Bacteria were cultivated in MB 7H9 medium supplemented with OADC to an OD600 of 1. One milliliter of the bacteria culture were centrifugated at 8.000 x g and washed twice with 1x PBS. The bacteria were resuspended in 500 µl TEN-buffer (0.05 M Tris HCl
(pH 8), 0.001 M EDTA (pH 8), 0.08 M NaCl, and 1 mg Lysozyme) in a 2 ml reaction tube containing 3 glass beads (1-1.25mm) and vortexed for 10 s. Afterwards, 10 µl of RNase A (10 mg/ ml; Boehringer Ingelheim Pharma GmbH, Ingelheim, Germany) were added and the samples were incubated for 2 h at 37°C. Subsequently, 15 µl of 20 % sodium dodecyl sulfate (SDS) and 10 µl Proteinase K (20 mg/ ml) were added, mixed, and incubated for another hour at 37°C. Then, 125 µl of 4 M NaCl and 80 µl of 50°C pre-heated 3 % cetyl-trimethyl-ammonium-bromide (CTAB) were added and incubated for 10 min at 65°C in a water bath. Following, 780 µl chloroform/ isoamylalkohol (24:1 [v/v]) were added, the samples were gently mixed by inversion and centrifuged at 10.000 x g for 15 min at room temperature (RT) for phase separation. The supernatant was transferred in a new 2 ml reaction tube and 780 µl phenol/ chloroform/ isoamylalkohol (25:24:1 [v/v/v]) were added, mixed as described above and centrifuged at 10.000 x g for 5 min and RT. The supernatant was again transferred in another 2 ml reaction tube and mixed with 500 µl ice-cold isopropanol. After 30 min incubation at -20°C, the sample was centrifuged for 30 min at 10.000 x g and RT. The pellet was washed twice with 80 % [v/v] and 96 % [v/v]
ethanol and centrifuged for 5 min at 10.000 x g and RT. Finally, the pellet was dried on air for 20 min and the DNA pellet was solved in 50 µl ddH2O.
2.3.2 Polymerase chain reaction
If not stated otherwise, PCR (MULLIS and FALOONA, 1987) was performed in 25 µl volume reactions with the Hotstar polymerase Kit (Qiagen, Hilden Germany) in a thermal cycler (Eppendorf Mastercycler, Eppendorf AG, Hamburg, Germany). The reaction mixtures were prepared on ice by adding 10x PCR buffer, 5x Q-solution, 200 µM of each dNTPs, 0.5 µM of each oligonucleotide, 2.5 units of Hotstar-Taq polymerase, 50-100 ng template, and filled up with ddH2O to a total volume of 25 µl.
The PCR starts with 10 min denaturation at 95°C followed by 30-35 cycles as follows:
95°C for 1 min, 58°C for 35 s, 72°C for 1 min; and ends with the final elongation for 10 min at 72°C.
PCR products were analyzed on a 0.8 or 2 % [w/v] Tris base, borate, ethylene- diaminetetraacetic acid (EDTA, TBE; 10 x TBE buffer: 10 mM EDTA (pH 8) 1 M Tris- borate) agarose gel with 0.5x TBE buffer in an agarose gel electrophoresis chamber (PeqLab Biotechnologies GMBH, Erlangen, Germany) at 180 volt for 1-2 h.
2.3.3 Preparation of template DNA by colony boiling for PCR
Mycobacteria single colonies were picked and resuspended in 100 µl ddH2O.
Mycobacteria samples were boiled in a microwave oven at 90 W for 20 min.
Subsequently, 5 µl of the denatured mycobacteria DNA were used as template for the PCR analysis.
2.3.4 Purification of PCR products
PCR products were purified by a 0.6 % [w/v] Tris base, acetic acid EDTA (TAE) agarose gel electrophoresis with 1x TAE buffer (50 x TAE buffer: 2 M Tris-HCl (pH 8), 50 mM EDTA (pH 8), 1 M acetic acid) in an agarose gel electrophoresis chamber (PeqLab Biotechnologies GMBH, Erlangen, Germany) at 180 volt for 1-2 h. PCR products were cut out of the gel and cleaned up using a NucleoSpin® Extract II Kit (Macherey and Nagel GmbH, Düren, Germany) according to the manufacture´s manual.
2.3.5 Restriction and ligation of DNA fragments
The reactions for restriction enzyme treatment of DNA constructions were 1x Carlos buffer (33 mM Tris-acetate, 66 mM potassium acetate, 10 mM magnesium acetate, 3 mM mono-amino-propyl-putrescin (spermidin), and 0.005 µM albumin fraction V, pH 7.9), 10 mM di-thiothreitol (DTT) solution, 1 µg for plasmid or phage DNA, and 10 U of the respective restriction enzyme. If not stated otherwise, all restriction enzymes were purchased from New England Biolabs GmbH (Frankfurt, Germany).
After incubating at 37°C for 4 h, the reaction was stopped by denaturizing the protein at 65°C for 30 min. Finally, the restriction was confirmed by agarose gel electrophoresis.
2.4 Ligation
The ligation was performed in a 20 µl reaction mix. For ligation of DNA fragments, vectors and inserts were mixed in a molar ratio of 1 to 10 for the phages-cosmid ligation and 1 to 3 for the plasmid-PCR-products ligation. The ligation reaction mix was performed according to the New England Biolabs T4 DNA Ligation protocol.
After incubation at 16°C overnight the ligation was confirmed by transformation and/or agarose gel electrophoresis.
2.4.1 TOPO TA cloning
The TOPO TA cloning of PCR-products was performed in accordance to the manufacture´s manual (TOPO TA cloning® Kit, Invitrogen GmbH, Karlsruhe, Germany).
2.4.2 Plasmids purification
Plasmid purification was performed using the NucleoBond® AX kit (Macherey and Nagel GmbH, Düren, Germany) according to the manufacturer´s protocol.
2.4.3 Nucleotide sequencing and sequence analysis
Nucleotide sequencing was performed by SEQLAB (Göttingen, Germany). Sequence analysis was performed using the Basic Local Alignment Search Tool (BLAST/http://www.ncbi.nlm.nih.gov/blast/Blast.cgi, 2008; (ALTSCHUL et al., 1990, 1997) or the Clone Manager Basic 9.0 (Scientific & Educational Software, NC, USA).
2.4.4 RNA preparation
RNA preparation was performed according to Mycobacterial protocols with some modifications (PARISH and STOKER, 1998). For total RNA extraction, MAPwt and MAP∆mptD strains were grown to a middle log phase of OD600 of 0.8 and harvested.
Subsequently, 100 mg of bacteria pellet were resuspended in 1 mL TRIzol® reagent (Invitrogen GmbH, Karlsruhe, Germany). Bacteria were transferred in Fastprep tubes and disrupted in a FastPrep® instrument (FastPrep® FP120, Bio101 Thermo Savant, Qbiogene, Heidelberg, Germany) at an intensity of 6.5 for 45 sec. The treatment was repeated four times with intermediated cooling on ice. Afterwards, chloroform, chloroform/ isoamylalcohol (49:1 v/v) separation was performed followed by a 2-propanol precipitation at -20°C for 1 hour. Thereafter, the sample was centrifuged at 10.000 x g and 4°C for 30 min. Finally, the RNA pellet was dried on air for 20 min, dissolved in 30 µl ddH2O (Sigma Aldrich GmbH, Deisenhofen, Germany), and the concentration was spectrophotometrically measured with the Epoch Micro-Volume Spectrophotometer system (BioTek, Bad Friedrichshall, Germany). RNA was stored at -80°C for further analysis.
2.4.5 DNase treatment of RNA samples
The RNeasy Kit® (Qiagen, Hilden, Germany) was used to purify RNA from genomic DNA contamination. The DNase treatment was performed in a volume of 50 µl in a 1.5 ml reaction tube with 10x DNase buffer, 10 U DNase I (Roche GmbH, Mannheim, Germany) and incubated for 45 min at 37°C. The purification of RNA was performed according to the manufacturer’s manual of the RNeasy Kit®. The RNA was eluted in 30 µl RNase free water and stored at -80°C.
2.4.6 RNA precipitation
The RNA precipitation was performed in 1.5 ml reaction tubes. For this, RNA samples were filled up to a volume of 224 µl with RNase free water and mixed with
25 µl Na-Acetat (3 M, pH 5.2), 1 µl glycogen, and 625 µl ethanol (96 %). Afterwards, the samples were incubated at -80°C overnight. Subsequently, the samples were centrifuged at 10.000 x g and 4°C for 30 min. The pellet was washed twice with 80 % [v/v] and 96 % [v/v] ethanol, respectively. Finally, the RNA was dried on air for 15 min and resuspended in 30 µl of RNase free water.
2.4.7 Reverse transcription (RT) PCR and complementary (c) DNA- synthesis
The first-strand cDNA synthesis was performed by the random primer method and reverse transcription using M-MLV reverse transcriptase from Promega according to the manufacturer´s protocol (Promega GmbH, Mannheim, Germany). Therefore, 10 µl random-primer mixes (Promega GmbH, Mannheim, Germany) were incubated for 10 min at 70°C with 4 µg of DNA purified RNA. Subsequently, the samples were cooled on ice for 5 min and mixed with 5x RT buffer, 10 mM of each dNTPs, and 200 U of reverse transcriptase in a final volume of 25 µl. The mix was incubated for 1 h at 42°C with following incubation for 5 min at 85°C. The cDNA libraries were diluted with 180 µl ddH2O and stored at -20°C for further analysis.
2.4.8 Quantitative real-time PCR (qRT-PCR)
The transcription level of mRNA was analyzed by qRT-PCR using the Mx3005P qPCR System (Agilent Technologies, Waldbronn, Germany). Two µl of cDNA libraries were mixed with 10 µl SybrGreen (Qiagen, Hilden, Germany), 10 µM of each oligonucleotide, and were filled up with ddH20 (Sigma Aldrich GmbH, Deisenhofen, Germany) to a volume of 20 µl. For 40 cycles, the qRT-PCR settings and conditions were 95°C for 20 min, 95°C for 45 sec, 58°C for 45 sec, and 72°C for 1 min followed by melting curves of the PCR products as control. Data were normalized to the non- regulated housekeeping genes, secA or gap. The relative transcription level was calculated by the ∆∆Ct method (LIVAK and SCHMITTGEN, 2001).
