FurA and FurB – the impact of two transcriptional metalloregulators on Mycobacterium avium ssp. paratuberculosis stress response and metal homeostasis

(1)

University of Veterinary Medicine Hannover

Institute for Microbiology Department of Infectious Diseases

FurA and FurB – the impact of two transcriptional metalloregulators on Mycobacterium avium ssp.

paratuberculosis stress response and metal homeostasis

Thesis

Submitted in partial fulfilment of the requirements for the degree - Doctor rerum naturalium -

(Dr. rer. nat.)

awarded by the University of Veterinary Medicine Hannover

by Elke Eckelt Minden, Westf.

Hannover, Germany 2014

(2)

Supervisor: Prof. Dr. med. vet. Ralph Goethe Supervision Group: Prof. Dr. med. vet. Gerald-F. Gerlach

Prof. Dr. med. vet. Paul Becher

1st Evaluation: Prof. Dr. med. vet. Ralph Goethe Institute for Microbiology

Department of Infectious Diseases

University of Veterinary Medicine Hannover Prof. Dr. med. vet. Gerald-F. Gerlach

Innovative Veterinary Diagnostics (IVD) Laboratory Hannover

Prof. Dr. med. vet. Paul Becher Institute for Virology

Department of Infectious Diseases

University of Veterinary Medicine Hannover

2nd Evaluation: Prof. Dr. rer. nat. Ulrich E. Schaible Cellular Microbiology

Research Center Borstel

Date of final exam: 5. November 2014

This work was financially supported by the Deutsche Forschungsgemeinschaft (DFG, Ge522/6-1), Bonn, Germany

(3)

“Everyone deserves the chance to fly”

Stephen Schwartz

(4)

(5)

Parts of the thesis have been published previously at scientific meetings, conferences or journals:

Oral presentation

Eckelt E, Jarek M, Laarmann K, Meissner T, Meens J, Gerlach G-F, Goethe R.

“Metal-dependent regulation of a Mycobacterium avium ssp. paratuberculosis specific pathogenecity island”, Seminar on Infection Biology, Centre for Infection Medicine, University of Veterinary Medicine Hannover, Hannover 2013

Eckelt E, Meissner T, Meens J, Laarmann K, Nerlich A, Jarek M, Gerlach G-F, Goethe R. "FurA contributes to the oxidative stress response regulation of Mycobacterium avium ssp. paratuberculosis", 12th International Colloquium on Paratuberculosis, International Association for Paratuberculosis, Parma 2014

Poster presentations

Eckelt E, Meissner T, Meens J, Goethe R. "Heterologous expression of predicted Mycobacterium avium subsp. paratuberculosis transporter proteins", Graduate School Day of the University for Veterinary Medicine Hannover, Bad Salzdethfurth 2011

Eckelt E, Meissner T, Meens J, Goethe R. "Characterization of predicted Mycobacterium avium subsp. paratuberculosis transporter proteins", Annual Conference of the Association for General and Applied Microbiology (VAAM), Tübingen 2012

Eckelt E, Meissner T, Meens J, Goethe R. "Analysis of predicted ECF- and ABC- transporter of Mycobacterium avium subsp. paratuberculosis", 112th General Meeting of the American Society for Microbiology (ASM), San Francisco 2012

(6)

Publications (manuscripts see Results part I+II)

Eckelt E, MeissnerT, Meens J, Laarmann K, NerlichA, JarekM, Weiss S, Gerlach G-Fand Goethe R. "FurA contributes to the oxidative stress response regulation of Mycobacterium avium ssp. paratuberculosis", submitted

Eckelt E, Jarek M, Meens J, Goethe R. „Identification of a lineage specific zinc responsive genomic island in Mycobacterium avium ssp. paratuberculosis“, BMC Genomics, accepted

Contributions to other publications

Roderfeld R, Koc A, Rath T, Blöcher S, Tschuschner A, Akineden Ö, Fischer M, von Gerlach S, Goethe R, Eckelt E, Meens J, Bülte M, Basler T, Roeb E (2012).

"Induction of matrix metalloproteinases and TLR2 and 6 in murine colon after oral exposure to Mycobacterium avium subsp. paratuberculosis", Microbes and Infection Vol. 14(6): 545-53. doi: 10.1016/j.micinf.2012.01.004

Meissner T, Eckelt E, Basler T, Meens J, Heinzmann J, Suwandi A, Oelemann MWR, Trenkamp S, Holst O, Weiss S, Bunk B, Spöer C, Gerlach G-F, Goethe R (2014). "The Mycobacterium avium ssp. paratuberculosis specific mptD gene contributes to lipid metabolism and is essential for full virulence in mouse infections", Frontiers in Cellular and Infection Microbiology 4:110. doi:10.3389/fcimb.2014.00110

(7)

Table of content

Chapter 1 General Introduction ... 17

1.1 Mycobacterium avium ssp. paratuberculosis (MAP) ... 18

1.1.1 MAP genetics ... 19

1.2 Paratuberculosis ... 20

1.2.1 Course of infection and clinical symptoms... 20

1.2.2 Pathogenesis of paratuberculosis ... 20

1.3 Host cell defence mechanisms against invading bacteria ... 21

1.3.1 Macrophages – phagosome-lysosome fusion ... 21

1.3.2 Pathomechanisms and intracellular survival of MAP in macrophages ... 22

1.4 Metal homeostasis at the host-pathogen interface ... 24

1.5 Bacterial strategies counteracting nutritional immunity ... 26

1.6 Relevance of iron and zinc in the host ... 27

1.7 Relevance of iron and zinc in virulence and pathogenesis of bacteria ... 28

1.8 Metal transport and -storage in gram positive bacteria ... 29

1.9 Regulation of metal homeostasis in bacteria and mycobacteria ... 31

1.9.1 Regulators of iron and zinc homeostasis ... 32

1.9.2 Ferric uptake family (FUR) regulators ... 32

1.10 Aims of the study ... 34

Chapter 2 Materials and Methods ... 35

2.1 Materials ... 36

2.2 Bacterial strains and growth conditions ... 41

2.2.1 Escherichia coli ... 41

2.2.2 Mycobacterium avium ssp. paratuberculosis ... 41

2.2.3 Mycobacterium smegmatis ... 42

2.3 Construction of mutant strains ... 43

2.3.1 Construction of a M. avium ssp. paratuberculosis∆furA deletion strain and complementation of the mutant strain ... 43

(8)

2.3.2 Construction and selection of a M. smegmatis∆furB mutant ... 43

2.4 Cell culture and animal experiments ... 44

2.4.1 Cell culture of macrophages and survival assay of intracellular mycobacteria ... 44

2.4.2 Determination of reactive oxygen species in macrophage infection experiments ... 45

2.4.3 Determination of adhesion and invasion by immunofluorescence and confocal microscopy ... 45

2.4.4 Mouse infection experiments ... 46

2.5 Molecular methods ... 47

2.5.1 Extraction of nucleic acids ... 47

2.5.2 cDNA synthesis and quantitative real-time PCR (qRT-PCR) ... 47

2.5.3 Rapid amplification of 5‟-cDNA ends (5‟RACE^®) ... 48

2.5.4 Inverse site directed mutagenesis PCR ... 48

2.5.5 Construction of plasmids for β-galactosidase activity assays ... 49

2.5.6 β-galactosidase activity assay ... 49

2.6 RNA deep sequencing and analysis ... 50

2.7 Bioinformatics and statistics ... 51

2.7.1 Protein analysis ... 51

2.7.2 Analysis of Fur binding sites ... 51

2.7.3 Cluster analysis ... 52

2.7.4 Statistical tests ... 52

Chapter 3 Results part I: FurA contributes to the oxidative stress response regulation of Mycobacterium avium ssp. paratuberculosis ... 53

Chapter 4 Results part II: Identification of a lineage specific zinc responsive genomic island in Mycobacterium avium ssp. paratuberculosis ... 79

(9)

Chapter 5 General discussion ... 107

5.1 Mycobacterial evolution and adaptation ... 108

5.2 Struggle for nutrients at the host-pathogen interface ... 109

5.3 The complex nature of FurA regulation ... 110

5.4 The impact of FurA in stress response and survival ... 112

5.5 The impact of FurB in MAP zinc homeostasis and host adaptation ... 113

5.6 Conclusion ... 116

Chapter 6 Summary ... 119

Chapter 7 Zusammenfassung ... 123

Chapter 8 References ... 127

(10)

List of Figures

Figure 1: Characterization of a MAP∆furA mutant. ... 60 Figure 2: Functional complementation of FurA regulated genes. ... 66 Figure 3: Iron- and stress dependent expression of furA and FurA regulated

genes. ... 67 Figure 4: Induction of oxidative burst in macrophages and survival of MAP

strains in macrophages. ... 71 Figure 5: Biological fitness of MAP and MAP∆furA in infected mice. ... 72 Figure 6: Putative regulatory mechanisms of FurA in MAP. ... 75 Figure 7: Metal dependent regulation of a M. avium ssp. paratuberculosis

specific gene locus. ... 86 Figure 8: TPEN-Zn titration experiment. ... 86 Figure 9: Organisation and FurB dependent regulation of a MAP specific ABC

transporter. ... 89 Figure 10: Analysis of mptA regulation by FurB after heterologous expression in

M. smegmatis∆furB (MSMEG∆furB). ... 92 Figure 11: Organisation of a M. avium ssp. paratuberculosis specific zinc

responsive genomic island (ZnGI). ... 101 Figure 12: Regulation model of mptABC by FurB in MAP. ... 103

(11)

List of Tables

Table 1: Bacterial strains used in this study... 36

Table 2: Oligonucleotides used in this study... 36

Table 3: Plasmids and phages used in this study ... 39

Table 4: Genes higher expressed in MAP∆furA compared to MAPwt ... 62

Table 5: Genes lower expressed in MAP∆furA compared to MAPwt ... 63

Table 6: Zinc dependent differentially expressed genes ... 95

Table 7: Zur boxes of the MAP zinc regulon as predicted by FIMO analyses ... 99

Table 8: Data of β-galactosidase assays. ... 152

Table 9: Raw data of RNA-Sequencing MAP∆furA/MAPwt. ... 153

Table 10: Raw data of RNA-Sequencing MAPwt TPEN/control. ... 153

Table 11: Raw data of survival of MAPwt, MAP∆furA and MAP∆furA^Cafter macrophage infection in colony forming units [Cfu]. ... 153

Table 12: Raw data of survival of MAPwt, MAP∆furA and MAP∆furA^Cafter mouse infection. ... 153

Table 13: Sequences used to generate a FurA consenus sequence. ... 153

Table 14: Sequences used to generate a FurB consenus sequence ... 154

Table 15: Predicted binding sites FurA (Fur boxes) obtained by FIMO analysis. ... 154

Table 16: Predicted binding sites FurB (Zur boxes) obtained by FIMO analysis. ... 157

Table 17: Homologue zinc responsive genes in mycobacteria. ... 158

(12)

List of Abbreviations

α Alpha

β Beta

∆ Delta

γ Gamma

% Percent

Ahp/ahp Alkyl hydroperoxide reductase ANOVA Analysis Of Variance

ABC ATP binding cassette approx. Approximately

ATP AdenosinTriPhosphate

bp Base pair(s)

°C Degree Celsius

CD Crohn‟s disease

Cfu Colony forming units

Cu Cuprum

Da Dalton

DIP 2,2-dipyridyl

DMEM Dulbecco‟s Modified Eagle‟s Medium DNA DeoxyriboNucleic Acid

dNTP Deoxynucleotide triphosphates

DPBS Dulbecco‟s Phosphate-Buffered Saline DtxR Diphtheria toxin repressor

e.g. Exampli gratia

ESX Early secretory antigenic target 6 system et al. Et alii

Fe Ferrum

fep Ferric enterochelin protein

Fig. Figure

Fur Ferric uptake regulator

GC Guanine Cytosine

GTP GuanosinTriPhosphate H2O2 Hydrogen peroxide

(13)

HE Hematoxylin and Eosin staining IdeR Iron dependent regulator

IL Interleukine

IFN Interferone

i.p. Intraperitoneal

IrtA/B Iron responsive transporter A/B

JD Johne‟s disease

Kat/kat Catalase peroxidase kb Kilo base pair(s)

LB Luria Bertani

LSP Large sequence polymorphism

LSP^P Large sequence polymorphism present LSP^A Large sequence polymorphism absent MAV M. avium ssp. avium

MAC M. avium complex

MAH M. avium ssp. hominissuis MAP M. avium ssp. paratuberculosis MAS M. avium ssp. silvaticum

MB Middlebrook

Mb Mega base pair(s)

mbt Mycobactin

M-cells Microfold epithelial cells

Mn Manganese

Mø Macrophage

MOI Multiplicity of infection mpt Mycobacterium transporter MSMEG Mycobacterium smegmatis MTB Mycobacterium tuberculosis

MTBC Mycobacterium tuberculosis complex

NADPH Nicotinamide Adenine Dinucleotide Phosphate NaCl Natrium Chloride

NCBI National Centre for Biotechnology Information

NO Nitric Oxide

NOS Nitric Oxide Synthase

(14)

NRAMP Natural resistance associated membrane protein NTA Nitrilotriacetic acid trisodium salt

O2- Superoxide anion

OH^- Hydroxyl anion

OADC Oleic acid, Albumin fraction V, Dextrose, Catalase ODxxx Optical density at xxx nanometers

ORF Open reading frame

OxyR Oxygen dependent regulator PBS Phosphate buffered saline PCR Polymerase Chain Reaction

PE Prolin-Glutamin

PerR Peroxide dependent Regulator

pH Power of Hydrogen

PPE Prolin-Prolin-Glutamin qRT-PCR quantitative Realtime PCR

RACE Rapid amplification of cDNA ends RBS Ribosome binding site

RNA RiboNucleic Acid

RNS Reactive Nitrogen Species ROS Reactive Oxygen Species

rpm Rounds per minute

® Registered trademark

SDS Sodium Dodecyl Sulfate SEM Standard error of the mean

sid Siderophore

Sod/sod Superoxide dismutase TLR Toll Like Receptor TLS Translation start TNF Tumor necrosis factor

TPEN N,N,N',N'-tetrakis (2-pyridylmethyl) ethylenediamine TSS Transcription start

U Unit

UTR Untranslated region

(15)

wt wildtype

Zn Zinc

ZnGI Zinc responsive genomic island ZnuABC Zinc uptake transporter A/B/C Zur Zinc uptake regulator

(16)

(17)

General Introduction Chapter 1

17 Chapter 1

General Introduction

(18)

Chapter 1 General Introduction

18

1.1 Mycobacterium avium ssp. paratuberculosis (MAP)

Mycobacterium avium ssp. paratuberculosis (MAP) belongs to the genus Mycobacterium of the family Mycobacteriaceae, the phylum Actinobacteria and the order Actinomycetales [1]. Systematically MAP is classified as a member of the M. avium complex (MAC), which comprises of 9 different slow growing species: M.

intracellulare, M. colombiense, M. chimaera, M. marseillense, M. timonense, M.

boucherdurhonense, M. vulneris, M. arosiense and M. avium [2]. M. avium is divided in four subspecies, including MAP and the closely related species M. avium ssp.

hominissuis (MAH), M. avium ssp. avium (MAV) and M. avium ssp. silvaticum (MAS) [3].

MAP was first isolated and suggested as the causative agent of paratuberculosis in ruminants in 1912 by Twort and Ingram [4]. MAP is an acid-fast, aerobic, gram positive rod shaped bacillus, nonmotile and nonsporing. The acid-fast phenotype derives from a thick, waxy cell wall, which is typical to all mycobacteria [5-7] and protects them from host cell mediated microbial killing and antimicrobial treatments (e.g. low pH, antibiotics, host cell defence mechanisms). MAP belongs to the group of slow growing mycobacteria, which encompasses the majority of pathogenic mycobacteria, e.g. M. tuberculosis (MTB) and M. leprae. This characteristic separates pathogenic from nonpathogenic fast growing species. MAP exhibits an extremely slow growth with a generation time of 24-48 h [8]. Moreover, in contrast to the other members of MAC, MAP is fastidious in culture and requires specific media and supplements, such as the iron loaded mycobactin when grown on egg yolk containing media [9]. Mycobactin dependence is exclusively found in MAP strains but lost after several passages in laboratory media, due to adequate iron concentrations [10].

In the host, MAP shows an exceptional tropism to the gastrointestinal tract [11-14].

This is in contrast to other pathogenic mycobacteria such as species of the MTB complex (MTBC) and the remaining members of the MAC. They primarily infect the respiratory tract but may also cause infection of the intestinal tract with consecutive dissemination and systemic infection. However, MAP infection is local for long times, suggesting that MAP executes a completely different strategy of infection.

(19)

19 1.1.1 MAP genetics

Mycobacteria are microorganisms with a high content of guanine (G) and cytosine (C). The MAP genome has a size of 4.83 Mb, displays a GC-content of 69.3% and contains 4,350 open reading frames (ORF) [3,15]. MAV with a genome size of 5.48 Mb is the most closely related subspecies to MAP. Both genomes share 98 to 99%

identity when comparing gene homologies [3]. However, despite the close phylogenetic resemblance the M. avium subspecies (MAV, MAH, MAS and MAP) display important genetic differences. Recombination, deletion and re-arrangement events during evolution of the different subspecies resulted in the presence or absence of genomic islands, which might explain phenotypical differences as well as differences in pathogenesis and host tropism [16,17]. Until now, 25 characteristic inter- and intrasubspecies large sequence polymorphisms (LSPs) were discovered in M. avium ssp. [17-20]. Sixteen of these LSPs are lineage specific for MAP. Of these, 8 are present (LSP^P) or absent (LSP^A) in all tested MAP isolates and thus constitute the core LSPs. LSP^A8, present in other M. avium ssp., was lost in MAP, whereas LSP^P2, 4, 11, 12, 14, 15, 16 (insertions) are exclusively found in MAP. LSP^P14 and LSP^P15 are predicted to be involved in metal dependent regulation, transport and homeostasis. LSP^P14 (map3725-3764) includes an earlier identified 38kb pathogenicity island [19], comprised of three gene clusters: fepABCD (map3726- 3729) for siderophore uptake, mptABCDEF (mycobacterium paratuberculosis transporter map3731c-3736c) encoding for two putative ABC-transporters (mptABC, mptDEF) and sidABCDEFG which shows homologies to proteins for siderophore biosynthesis (map3739c-45). Some of the genes were very recently shown to be associated to virulence [21,22]. In addition, mptABC was proposed to represent an iron-uptake transporter similar to the iron transporter IrtAB in MTB [23].

Furthermore, MAP exhibits a subspecies specific genetic diversity, which is partly displayed by the presence and absence of the remaining 8 MAP specific insertions LSPÂ9-I, LSPÂ4-II, MAV-14, LSPÂ18, LSPÂ20, LSP^P9, VA15 and LSPÂ11 [17]. In addition, different MAP subtypes have been described, depending on their host preference. Hence, they have been classified as type S (sheep / type I), type C (cattle / type II), type B (bison) and an intermediate type III [24,25]. Strains of the sheep lineage (type S) are missing LSPÂ20 and LSP^P9, whereas MAV-14, LSPÂ18, LSPÂ4-II and LSPÂ9-I are absent from cattle strains (type C) [17].

(20)

20

1.2 Paratuberculosis

1.2.1 Course of infection and clinical symptoms

MAP is the causative agent of paratuberculosis - or Johne‟s disease (JD) - first described by Johne & Frontingham in 1895 [26]. Infection leads to a chronic, incurable granulomatous enteritis, primarily affecting the distal jejunum of the small intestine of domestic and wildlife ruminants, with cattle, sheep and deer being the most common hosts [27-29]. However, the host spectrum has recently been extended to omnivores, carnivores, aves [30], rodents [31], camelides [32] and non- human primates [33]. In addition to that, MAP was proposed to be involved in the development of unclear immunological disorders in humans, such as Crohn's disease (CD) [34-36]), diabetes type I [37,38], multiple sclerosis [39] and autoimmune thyroiditis [40].

In cattle, MAP infection occurs in neonates or typically during the first 6 month of life.

Young calves are highly susceptible to infection, due to their incompletely developed immune system [14,41]. The disease is then characterized by different stages. A long subclinical phase of approx. 2-5 years is subdivided in a silent infection without bacterial shedding, followed by intermitting bacterial shedding by inapparent carriers.

Leading symptoms of the following clinical phase are weight loss and intermittent diarrhoea with high bacterial load. The advanced state of disease is characterized by ceaseless diarrhoea, rapid weight loss, decreased milk production and general wasting. Pathological changes such as a thickened gut wall [42] and non-caeseous granulomatous inflammation in the submucosal tissue are found preferentially in the terminal part of the small intestine [43]. Since there is no effective treatment available, infected animals finally decease from cachexia or dehydration [44-46].

1.2.2 Pathogenesis of paratuberculosis

Infection with MAP occurs typically via the fecal-oral route, mainly during the neonatal period by MAP contaminated milk, water or pasture [45]. Also, horizontal transmission has been suggested [47,48]. After ingestion, MAP passes the gastric tract. During the passage, expression of surface proteins such as fibronectin attachment protein (FAP) is activated [49], allowing opsonization of MAP by

(21)

21

fibronectin and, upon arrival at the intestinal target tissue, subsequent binding to fibronectin receptors (integrins) of the host cell [50]. MAP then enters the epithelium by invasion of enterocytes or of microfold M-cells in the Peyer‟s Patches [51-54].

More recently, the entry of MAP via goblet cells was suggested [55]. After breaching the enterocyte layer the bacterium is taken up by phagocytes, in particular naïve subepithelial macrophages, in which MAP is able to persist and replicate inside the phagosome [56]. Later in infection MAP spreads through the mucosal tissue and causes inflammation which leads to the typical picture of a diffuse granulomatous inflammation with high numbers of infected macrophages and giant cells [27].

1.3 Host cell defence mechanisms against invading bacteria

1.3.1 Macrophages – phagosome-lysosome fusion

Invading bacteria constitute a potential thread to the host as they might cause infection. Thus, the immediate recognition and elimination of bacilli by the innate immune system is of major importance. Professional phagocytes such as neutrophils, macrophages and dendritic cells represent the first line of defence. They recognize foreign microbial structures (pathogen-associated molecular patterns [PAMP], microbial-associated molecular patterns [MAMP]) such as cell wall proteins, lipoproteins, carbohydrates (e.g. mannose) or bacterial DNA by either surface exposed or intracellular receptors, collectively referred to as pattern recognition receptors (PRR) and promote phagocytosis or activate downstream signaling processes [57-59].

Usually, bacilli recognized and internalized by resident macrophages (amongst others) are enclosed in a phagosome which matures to the phagolysosome. During the maturing process from early to late phagosome and lastly phagolysosome, the phagosomal microenvironment is drastically altered. A continuous acidification is generated by the vacuolar-type V-ATPase. Surface exposed molecules such as small Rab GTPases, regulators of distinct steps in membrane traffic pathways [60], and lipid second messengers are acquired or lost in the stepwise fusion process with endosomal compartments. The phagolysosome is then enriched with various antimicrobial effectors such as degrading enzymes and toxic peptides as well as hydrolases, which are activated at low pH and lead to degradation of the pathogen

(22)

22

[61-63]. Peptide fragments are then presented on the host cell surface to T-cells and B-cells which in turn increase the humoral and cellular immune response by secreting cytokines such as interferones (IFN), interleukins (IL) or antibodies [64].

These signals result in the recruitment of periphery macrophages and other immune cells and amplification of the immune response.

In addition to the above described processes, the contemporarily production of toxic reactive nitrogen (RNS) or oxygen species (ROS, oxidative burst) [65] is another major strategy of macrophages and other phagocytes to combat intracellular bacteria. RNS and ROS are comprised of highly reactive molecules such as nitric oxide NO, superoxide anion O2- and the hydroxyl radical OH^- as well as more stable oxidants like hydrogen peroxide (H2O2). Products of both groups (RNS/ROS) are normally generated during metabolism and play an important role in homeostasis and cell signaling [66-68]. However, enriched in the phagosome they represent effective anti-microbial measures [69]. Upon infection, macrophages exhibit elevated levels of RNS and ROS. This is achieved by enzymes such as nitric oxide synthase 2 (NOS2/iNOS) and NADPH oxidase 2 (NOX2), located in the phagosomal membrane [70] or by the NADPH-dependent NOX2 phagocyte oxidase complex [71]. Expression of these enzymes is further enhanced by various growth factors or cytokines such as IFN-γ, tumor necrosis factors TNFα/β and/or bacterial compounds [67,72,73].

Intracellularly, O2- is in general rapidly converted to H2O2 or reacts with NO to peroxinitride, which is highly toxic to bacteria.

Toxicity derives e.g. from inactivation of enzymes via oxidation of iron sulfur clusters [4Fe–4S] or structural iron which may then lead to crucial impairment of biological processes. Moreover, H2O2 can damage DNA as it also reacts with loosely associated free ferrous iron (Fe²⁺) [74]. Overall, macrophages display a variety of mechanisms to fight invading bacteria and especially RNS and ROS can cause severe damage in bacteria if they are not equipped with appropriate defence mechanisms.

1.3.2 Pathomechanisms and intracellular survival of MAP in macrophages

Mycobacteria are taken up by subepithelial macrophages and intracellular persistence is a major characteristic of all pathogenic mycobacteria. Thus, they are

(23)

23

able to circumvent microbial killing mechanisms of phagocytic cells. The mechanisms behind this ability have been extensively analysed in MTB and MAV [75-80].

However, they are not completely resolved and only some of these evasion mechanisms have been investigated in MAP [81,82]. Nevertheless, it can be assumed, that these evasion mechanisms can be transferred to MAP.

The uptake of mycobacteria by macrophages is mediated by different ways. They are internalized after binding to receptors such as immunoglobulin receptors (FcR), mannose receptors, scavenger receptors or complement receptors CR1, CR3, CR4 [83,84]. Depending on the route of entry, different immune response patterns are activated. For instance, the uptake of bacteria by CR3 results in a reduced macrophage activation, including a reduced production of reactive nitrogen (RNS) and oxygen (ROX) species [85-87]. It has been shown, that mycobacteria preferentially enter macrophages by the complement receptor CR3 [88,89].

Consequently, favouring this type of entry seems to enhance mycobacterial and thus MAP survival in macrophages, possibly by the prevention of high RNS/ROX production.

The oxidative burst in macrophages is also inducible by IFN-γ. However, IFN-γ induced stimulation of MAP infected macrophages is strongly impaired by so far not completely resolved mechanisms [90] and thus also contributes to intracellular survival of MAP. A possible mechanism was described for MAH: infection of macrophages caused down-regulation of the IFN-γ receptor and thereby impaired STAT (Signal Transducer and Activator of Transcription) signaling pathways and downstream gene transcription [91].

However, even if exposed to RNS and ROX, mycobacteria are equipped with defence systems that prevent damage. Oxidative DNA damage in MTB is supposed to be avoided by the histone like protein Lsr2 by binding to the DNA and acting as a physical barrier by reducing the accessibility of DNA to RNS/ROX [92]. As neutralizing components against oxygen intermediates, MTB and MAP express two superoxide dismutase proteins (SodA/C), as well as catalase peroxidase KatG, alkyl hydroperoxid reductases AhpC/D and the thioredoxin proteins TrxA/B [93-97].

SodA/C, KatG and AhpC/D are metal dependent, either on structural level or the expression of the corresponding genes is controlled by metal dependent regulatory proteins such as the ferric uptake regulator (FUR) family members FurA and PerR as well as the LysR-family regulator OxyR [98-100]. A more detailed picture of stress

(24)

24

response regulators is given in the introduction of Chapter 3. In addition, mycobacteria produce mycothiol, which is oxidized and prevents oxidation of other molecules [101].

Mycobacteria are able to arrest phagosome maturation [102-107]. They are able to circumvent acidification, indicated by the lack of recruitment of V-ATPases to the phagosome. Furthermore, the arrest of phagosomal maturation is indicated by prevention of the acquisition of important phagosome-lysosome fusion markers such as lysosome-associated membrane protein LAMP2 [56] and decreased levels of LAMP1 [108]. Moreover, it was found that pathogenic mycobacteria inhibited phagosome-lysosome maturation by secretion of a eukaryotic-like serine/threonine protein kinase (PknG) by a yet unknown mechanism [109,110]. Also, the mycobacteria specific cell wall component lipoarrabinomannan (LAM) was proposed to inhibit calcium and Rab dependent recruitment of the phosphatidylinositol 3-kinase (PI3-kinase) and subsequent activation of the phosphatidylinositol 3-phosphate (PI3P). Both proteins are essential for the formation of phagolysosomes [111-113].

Interestingly, inhibition of the proinflammatory response and arrest of phagosome maturation is supposed to be zinc dependent in MTB, as the lack of the zinc dependent metalloprotease Zmt1 resulted in increased phagosome maturation [114].

Furthermore, Kelley and Schorey (2003) demonstrated that an adequate intraphagosomal iron concentration is required for mycobacteria to maintain the block of phagosome maturation [115]. Thus, the availability of intracellular iron or zinc is crucial in mycobacterial pathogenicity.

1.4 Metal homeostasis at the host-pathogen interface

Metabolic adaptation to nutrients provided by the host is an essential skill for pathogenic microorganisms. Therefore, limitation and accumulation of nutrients by the host are decisive processes in host-pathogen interaction and successful infection. Hence, pathogenic bacteria are equipped with systems to either acquire necessary nutrients or to counteract intoxication.

The process of active limitation or accumulation of important cellular or intracellular nutrients as a host cell defence mechanism is referred to as nutritional immunity.

Initially, this term was only used for iron starvation [116] but following it was further

(25)

25

extended for zinc (Zn²⁺), manganese (Mn²⁺) [117] and other transition metals as well as other nutrients [118-121].

Nutritional immunity is best established for iron. Thus in the host, extracellular iron is depleted by sequestration to host cell proteins such as haem, the cofactor of haemoglobin, transferrin or lactoferrin [122] (see section 1.6). Depletion is triggered after host infection by a cascade of signals, e.g. IL-6 secretion in response to infection. IL-6 activates immune effector cells and leads to increased expression of hepatocytic acute phase proteins, such as the hormone hepcidin [123,124]. IL-6 triggers induction of STAT3 (signal transducer and activator of transcription 3), which subsequently binds to the promoter region of hepcidin and induces its transcription.

Hepcidin in turn reduces the expression of the iron exporter ferroportin-1 (Fpn-1) [125], commonly found in the cell membrane, causing withdrawal of iron from extracellular bacteria. In addition, bacterial iron scavenging mechanisms, such as the high affinity iron chelating siderophores (see section 1.8), are antagonised by the host cell protein lipocalin-2 which can bind different types of siderophores [126,127].

Intracellularly, iron can be bound by the storage protein ferritin [128].

Intraphagosomal depletion of iron and other metals is achieved by natural resistance associated membrane protein NRAMP1 transporters [118]. Furthermore, the afore mentioned transporter Fpn-1 was also found to be induced and translocated to the phagosomal membrane upon mycobacterial infection [129], thus diminishing intraphagosomal iron concentration.

Zinc restriction has been observed in infected host cells and it is now clear, that this mechanism adds to nutritional immunity. However, only few mechanisms are known.

The antimicrobial protein calprotectin is produced mainly by neutrophils and able to extracellularly bind Zn²⁺ and Mn²⁺ upon dimerization [130,131]. It was found to create metal starvation during infection, thereby controlling bacterial survival and replication [117]. Intraphagosomal zinc depletion is supposed to be mediated by the increased expression of transporter ZIP8, which transports zinc from the phagosome to the cytosol [132,133]. Recently, an active zinc shuttle from the phagosome to the Golgi- apparatus upon macrophage infection with Histoplasma capsulatum was observed. It was linked to downstream regulation of NADPH, which resulted in an increased production of ROS and thus acidification of the phagosome [134].

Apart from metal restriction, intoxication of intracellular bacteria is the other strategy of nutritional immunity, an intriguingly new field of host cell defence which has

(26)

26

emerged only recently. Accumulation of phagosomal metal ions is mediated either by transporters such as copper transport 1 (CTR1) [135] or by mobilization of storage proteins. In this context, the role of NRAMP1 was extended by an importer function, thereby contributing to an increased intraphagosomal metal concentration [136]. In the case of Zn²⁺, importers of the ZnT-family are proposed to support the toxification of microorganisms [137].

The consequences of higher metal ion concentrations are tremendous for the bacterial cell. Increased levels of reactive transition metals such as iron or copper bear a great toxic potential. Superoxide anions (O2-), which are released during the oxidative burst, are rapidly converted to H2O2 by superoxide dismutases (Sod). H2O2

then can further react with ferrous iron (Fe²⁺) or copper (Cu⁺) to even more toxic radicals ^·HO + OH⁻ by the Fenton and Haber-Weiss reaction [138]. Zinc per se is not as reactive as Fe²⁺ or Cu²⁺; however, it can be highly toxic at elevated concentrations, as it tends to interact with thiols, perturbs enzyme function and thus inhibits pivotal biological reactions [139]. Toxicity can also be mediated by competitive binding of transition metals to proteins. For instance, Cu²⁺ possesses, according to Irving and Williams, the highest binding affinity to proteins [140]. Excess of this metal and also Zn²⁺ and Mn²⁺ [118,141] leads to inappropriate binding, associated with nonfunctional proteins and finally perturbation to bacterial physiology.

Therefore, bacteria have developed mechanisms to counteract nutritional immunity.

1.5 Bacterial strategies counteracting nutritional immunity

Examples for counteracting nutritional immunity within intraphagosomal persisting mycobacteria was shown for MAP [142,143], MTB and MAV [144]. Weigoldt and colleagues identified the adaptation of MAP to the host cell nutritional environment by an altered metabolism. Wagner et al. found, that iron, zinc and other transition metals were depleted from the phagosome early during infection [144,145]. In fact, pathogenic mycobacteria have evolved several mechanisms to maintain a balanced metal concentration and overcome nutritional immunity. In contrast, non-pathogenic mycobacteria are not able to restore homeostasis in macrophages, as shown for M. smegmatis (MSMEG) [144]. Mechanisms to counteract nutritional immunity are for instance manipulation of host cell gene expression, e.g. of the divalent metal

(27)

27

transporter-1 (DMT-1/NRAMP2), which increases the availability of intracellular metal ions [146]. In addition to the manipulation of host cell iron acquisition systems, mycobacteria are able to utilize iron bound to host cell proteins lactoferrin [147], cytoplasmatic iron pools [148], haemoglobin [149,150] and intraphagosomal transferrin [151,152]. Moreover, they express own metal importer and systems to counteract starvation or intoxification [153,154], as described in section 1.8.

Especially during starvation events, inducible specific metal transporters and scavenging systems such as high-affinity chelators, which are tightly regulated by metal sensing proteins, are utilized [155,156]. The mechanisms concerning intracellular metal concentration are addressed in section 1.8 and 1.9.

1.6 Relevance of iron and zinc in the host

Iron and zinc are the most abundant and most important transition metals in the cell [157,158]. Both ions are essential for many fundamental biological processes such as enzymatic reactions, respiration, gene expression, oxygen transport and synthesis of nucleic acids (DNA/RNA). Therefore, they are crucial for survival of both, the host cell and the invading bacterium and therefore for successful infection [159,160].

Two chemical conditions are common for iron; it occurs either in the reduced ferrous (Fe²⁺) or oxidized ferric (Fe³⁺) form. The biological active Fe²⁺ is, due to its reactive potential, unstable under aerobic conditions. Therefore, free cytosolic iron can be highly toxic, as it can catalyze the formation of ROS via the Fenton and Haber-Weiss reaction [161]. For this reason, iron is mainly sequestered into host proteins. Fe²⁺ can be sequestered extracellularly by haem. However, the majority of Fe²⁺ molecules is oxidized at physiological pH to Fe³⁺ and bound extracellularly by transferrin, lactoferrin and intracellularly by the storage protein ferritin [128]. Sequestration reduces the accessibility of iron in the host to a minimum. To make use of the iron sequestered in extracellular proteins, cells have developed receptors and uptake systems. For instance macrophages express the transferrin receptor-1 (TfR1) to bind, internalize and intracellularly utilize transferrin [162].

Zinc (Zn²⁺) is an exceptional transition metal, as it, other than iron, manganese, copper or nickel, is redox stable and does not prone to reactivity. Therefore, it is a structural component in numerous proteins and a cofactor for catalytic and regulatory mechanisms. Approximately 8.8% of the eukaryotic proteins contain Zn²⁺ binding

(28)

28

sites [163]. Of these, approx. 50% constitute Zn²⁺ containing enzymes and approx.

44% Zn²⁺ dependent transcription factors [164]. This high number of important Zn²⁺

dependent proteins illustrates the essentiality of this particular ion. However, Zn²⁺

exhibits a high tendency to build complexes and bind proteins with a very strong affinity. Referred to Irving and Williams, this affinity is only exceeded by Cu²⁺ [140].

Thus, to prevent inappropriate binding, the intracellular pool of free Zn²⁺ is maintained particularly low. Several studies demonstrated free levels of Zn²⁺ in a nano- to picomolar range, even though the total concentration of Zn²⁺in eukaryotic and prokaryotic cells is in the submillimolar range [165]. Similar to iron binding proteins, Zn²⁺ can also be sequestered by host derived proteins such as the earlier mentioned calprotectin. In addition, the presence of zinc storage vesicles was proposed and designated as “zincosomes” [166,167].

1.7 Relevance of iron and zinc in virulence and pathogenesis of bacteria

As stated above, iron and zinc are essential for pathogenic bacteria to survive in the host [159,160,168,169].

Iron is important in many fundamental bacterial metabolic processes such as enzymatic reactions, respiration, gene expression, oxygen transport and synthesis of nucleic acids (DNA/RNA). Also important virulence associated enzymes such as SodA, KatG, AhpC and TrxA/B of MTB and MAP for the detoxification of radicals released during oxidative burst (see above section 1.3) are iron dependent.

Also for bacteria zinc is an essential cofactor of a large number of proteins. For instance >3% of the E. coli proteome contains Zn²⁺ [170] and 5% of all bacterial proteins harbour Zn²⁺ binding sites [163]. Many bacterial enzymes are metalloenzymes which either contain metals as structural components or catalyze reactions as metal cofactors. Interestingly, the Zn²⁺ associated proteome of prokaryotes consists of approx. 80% Zn²⁺dependent enzymes, which by far exceeds the number of Zn²⁺dependent enzymes in the host [164]. Thus, in comparison to eukaryotes, the role of Zn²⁺ in prokaryotic gene regulation seems to be considerably lower but more important in enzymatic reactions.

(29)

29

Moreover, Zn²⁺ in bacteria is involved in several other crucial processes, such as oxidative stress response, antibiotic resistance and DNA repair [171-173]. For instance, detoxification of ROS and ROX released during oxidative burst is not only mediated by iron dependent enzymes but also by a Cu²⁺/Zn²⁺dependent superoxide dismutase (SodC), important in the neutralization of superoxide anions in E. coli and MTB [94,174].

These mechanisms point out the relevance of iron and zinc in microbial survival. In consequence, pathogenic bacteria had to develop mechanisms to control and regulate metal homeostasis.

1.8 Metal transport and -storage in gram positive bacteria

As stated above, during infection bacteria are confronted with a hostile environment.

Due to its toxic and reactive nature, free iron in host cells is exceptionally rare and also zinc is mainly incorporated in proteins to avoid inappropriate binding by competitive effects. Moreover, during bacterial infection the concentration of available ions is even lower, as host cells actively alter metal homeostasis, thereby creating nutritional immunity [117-121]. On the other hand, also metal excess has to be prevented. Hence, especially pathogenic bacteria have developed mechanisms to efficiently regulate metal homeostasis, to overcome metal starvation, to maintain continuous supply [175] or to avoid toxification.

To facilitate iron uptake especially in times of starvation, most bacteria are able to produce at least one type of low molecular weight molecules (200 – 2,000 Da), termed siderophores [176]. Even though identified in environmental and pathogenic microorganisms, siderophores were found to contribute to virulence in several bacterial species [177]. The chemical structures of siderophores are greatly different;

however, almost all components are soluble and exhibit an extremely high affinity for Fe³⁺ with a stability constant of approx. 10³⁰ M^-1[178]. The most prominent candidate is the enterobactin of Enterobacteriaceae [179]. Other examples for siderophores are desferroxamines, which are also applied for therapy of several diseases, e.g. iron intoxication, and coelibactins of Streptomyces spp. [180].

Three types of siderophores are described for mycobacteria: the lipophilic and cell wall associated mycobactins, as well as the soluble carboxymycobactin (released by pathogenic mycobacteria) and exochelins (released by non-pathogenic

(30)

30

mycobacteria) [181,182]. Carboxymycobactin captures free iron or iron from host cell proteins and is directly taken up by the transporter IrtA/B or transferred to mycobactin [183]. In addition, the mycobacterial typeVII-secretion system ESX-3 is proposed to be important in mycobactin depenent iron acquisition [184].

Maximum biosynthesis of mycobactins in MTB occurs by induction of the corresponding gene cluster mbt1 and mbt2 under iron deprived conditions [15].

Proteins encoded by mbt1 (mbtA-J) are involved in siderophore synthesis, whereas mbt2 encodes for enzymes for siderophore modification and transport [185].

Recently, the presence of monodeoxy forms was discovered by Madigan et al. 2012 and the role of mbtG was proposed to contribute to converting deoxymycobactins to mycobactin [186]. Mycobactins were found to be essential for full virulence and intracellular growth of MTB [156,187,188] as they allow accessibility of iron bound to host cell proteins such as transferrin and lactoferrin [189]. This iron scavenging mechanism is however not applicable for MAP (see Introduction Chapter 3).

Other transporters involved in mycobacterial iron uptake are Fe-transporting ATP binding cassette (ABC) complexes FecB and FecB2 [190] as well as Mramp, a protein similar to NRAMP1 in host cells [191].

To control iron excess, mycobacteria generally utilize storage proteins such as bacterioferritin like proteins (bfrA/B) [128]. In addition, siderophore export by mycobacterial membrane protein MmpS4/5, the earlier mentioned IrtA/B and Rv2895c in MTB [188,192] has been described and might contribute to detoxification during infection.

Zinc homeostasis is maintained by a variety of different transporter systems, including importers, exporters and permeases. Passive zinc uptake is mediated mainly by unspecific channels, but can also be an active process by constitutively expressed low affinity membrane potential-dependent transporters of the zinc importer (ZIP)-family [173,193], supported by ZupT and P-type ATPases [154]. In addition to these unspecific and unregulated permeases, starvation inducible high affinity Zn²⁺ importers are expressed by many bacteria. The best characterized Zn²⁺

importer is the ZnuABC transporter. This ABC-transporter was first described for E.

coli (Patzer and Hantke 1998) and later also for cyanobacteria and streptococci [194]. ZnuABC is an important virulence factor in E. coli [195], Salmonella enterica [196], Acinetobacter baumanii [197] and Campylobacter jejuni [198] and others [199].

(31)

31

The ABC-transporter TroABCD of Treponema palladium [200] is another example for a high affinity Zn²⁺ uptake system in pathogenic bacteria. Maçiag et al. 2007 reported the presence of homologues to the low-affinity zinc transporter YciC, ZnuAB and TroA [201] and their regulation by the FUR-like regulator Zur (FurB) in MTB. In addition, recently the ESX-3 system important in iron homeostasis was also found to be necessary in zinc uptake in MTB [202].

Similar to siderophores for iron uptake, the presence of zinc scavenging systems was described for Candida albicans and S. coelicolor. Other than siderophores these

“zincophores” are complex proteins that are able to bind Zn²⁺ with a high specificity and affinity [199,203]. However, to date no additional zincophore was identified. Due to the importance of zinc in bacterial survival and the low availability, it is likely that other bacteria utilize so far unknown molecules for zinc scavenging.

Proteins for zinc storage have been described for only very few species, e.g. the metallothionein SmtA in cyanobacteria [204]. Obviously, an excess of cytosolic zinc is rather counteracted by the expression of exporter systems. Zinc exporters expressed by bacteria are subdivided in three categories: the cation diffusion facilitators (CDF) family, the superfamily of resistance–nodulation–cell division (HME- RND) and the P-type ATPase family [154]. The P1-type ATPase ZntA of E. coli was found to be critical for zinc tolerance [205]. In mycobacteria, so far only few zinc transporter systems have been described. However, several P-type ATPases including CtpC, metallothioneins and the zinc exporter ZnT1 of MTB were found to be induced upon infection [141,206] and contribute to circumvent Zn²⁺ intoxification.

ZitA, a CDF member in MSMEG [207] was found to be crucial in zinc resistance and induced at elevated zinc concentrations in MTB [208].

1.9 Regulation of metal homeostasis in bacteria and mycobacteria

The expression of high affinity metal systems such as transporters or scavenging systems is generally tightly regulated by metal sensing proteins, so called metalloregulators - proteins which bind metal cofactors to regulate gene expression [209,210].

(32)

32

1.9.1 Regulators of iron and zinc homeostasis

Regulation of iron homeostasis in bacteria is maintained by family members of different metalloregulators; such as DtxR (Diphteria toxin Repressor), SirR (Staphylococcal iron regulatory Repressor) or the FUR (Ferric Uptake Regulator) family [211]. Zinc homeostasis is mainly controlled by MerR-like (Metal responsive Regulator) such as ZntR of E. coli [212] and ZccR of Bordetella pertussis [213], ArsR-like repressors (Arsenite sensitive Regulator) such as SmtB and CzrA [214] or by another member of the FUR family. Detailed information about the latter regulator family is given in the section below.

In mycobacteria IdeR as a member of the DtxR family [215] seems to be of major importance as it is essential for mycobacterial survival [216]. IdeR is a global iron dependent regulator involved in iron metabolism but also in metabolic processes. It controls the expression of genes encoding for metal uptake (IrtA/B, mbt) and storage proteins (bfr) as well as genes for biosynthesis of cell wall components (acpP, murB) [217], virulence (Esx-5, antigen-85) and ribosomal genes [218]. In addition, it has been shown to be involved in virulence and oxidative stress [219]. The role of a mycobacterial homologue to the SirR regulator, which controls an iron-uptake transporter in Staphylococcus epidermidis [220], is unknown. At present, two different FUR-like proteins are described for mycobacteria, FurA and FurB (see section 1.9.2).

1.9.2 Ferric uptake family (FUR) regulators

Proteins of the ferric uptake regulator (FUR) family are distributed in more than 4000 bacterial species [221]. The best characterized FUR-like regulator is the iron dependent Fur, which was first described in E. coli [222] as a regulator of approx.

100 genes involved in iron homeostasis, general metabolism [211,223] and which possibly operates mechanisms beyond regulation [221]. In addition to Fur, other members of this family have been identified in recent years. They include Mur (manganese uptake), Nur (nickel uptake), Irr (haem-dependent iron responsive regulator), PerR (peroxide stress response) and Zur, which is involved in regulation of zinc uptake.

All FUR-like proteins share a similar size of 120 amino acids in average and are characterized by a common histidine-rich motif. Moreover, all FUR-like proteins

(33)

33

exhibit a similarity in folding and two to three metal binding sites with either structural or regulatory character [221]. Each FUR monomer consists of a winged-helix DNA binding domain (DB) at the N-terminus, a dimerization (D) domain at the C-terminus and a hinge loop in between. Dimerization is a characteristic of FUR family members, as shown in crystallization experiments [224-226], and is mediated by the structural metals. Binding of homodimers to the DNA occurs by interaction with a certain metal at the regulatory binding site and triggers regulatory mechanisms (see below).

Despite these similarities among FUR-like proteins, the associated metal cofactors for regulation, as well as the regulated genes are different. Fur (in many cases) requires Fe²⁺ for functional binding [227], Mur is activated by Mn²⁺ [228], whereas Nur requires Ni²⁺ as a cofactor [229]. The iron responsive regulator Irr is common in α-proteobacteria and interacts with haem rather than Fe²⁺[230]. PerR was first described in B. subtilis and is an iron dependent sensor of peroxides [231]. Finally, Zur is a Zn²⁺ dependent regulator in many bacteria, important in zinc homeostasis (see also Introduction of Chapter 4). Apart from the regulatory function in Zur, Zn²⁺ is the metal which is used as a structural component in many FUR-like proteins. For instance, Fur in E. coli and Vibrio cholera and PerR in B. subtilis require one structural zinc atom per monomer [226,232,233]. Zur in MTB, B. subtilis and S. coelicolor possesses two structural zinc binding sites in addition to the regulatory zinc atom [225,234,235].

As stated above, the regulatory metal cofactor is required for protein-DNA interaction, even though DNA binding of apoforms has been described. It has been shown, that the presence of the metal ion causes conformational changes of the protein, allowing dimer formation and binding to the DNA. DNA-binding sites have been identified for FurA, Zur and PerR [201,236-238]. In general these binding sites are palindromic sequences which can vary between species. For instance, the Fur box of E. coli is a 19-bp consensus sequence GATAATGATAATCATTATC [239] which is different to the 15-bp Fur binding site of B. subtilis TGATAATNATTATCA [236,237]. However, DNA binding sites of different FUR-like proteins in one species are often conserved and show only small but sufficient differences, as shown for B. subtilis Fur, PerR and Zur [237].

Several modes of action have been described for FUR regulators. The classical mechanism is repression of gene transcription upon binding of a FUR dimer to a conserved motive in the operator regions of target genes, thereby blocking RNA-

(34)

34

polymerase binding [238,240]. However, also activation of gene transcription by FUR-like regulators has been described, e.g. for V. cholerae or Neisseria meningitidis [241,242]. Furthermore, recently it has been found that not only metal loaded proteins but also apo-proteins can fulfill both ways of regulatory function, activation or repression [243,244]. Interestingly, also an indirect regulation of genes by FUR-like regulators has been described. Hence, activation of genes can be mediated by a small untranslated RNA (sRNA), which is directly repressed by Fur and post-transcriptionally controls the expression of proteins by binding to and degradation of target messenger RNA (mRNA). An example for this is the sRNA rhyB in E. coli, which controls the expression of proteins involved in metabolism [245].

As mentioned earlier, the mycobacterial genome harbours two genes for FUR homologues, namely FurA and FurB. The role of the FurB is clearly defined. In MTB, FurB (Zur) was shown to be responsible for the control of zinc homeostasis in concert with the cotranscribed regulator SmtB. Both regulators are zinc dependent, act antagonistically and regulate the expression of zinc transporters [201,208,221,246-249]. Moreover, a conserved consensus sequence for Zur binding was identified [201]. However, the role of FurA in mycobacteria is unclear. Yet, the co-transcription of furA with katG implies a possible role in oxidative stress response.

Nevertheless, no evidence for this hypothesis was given so far (see Introduction Chapter 3).

1.10 Aims of the study

As stated above, two FUR-like proteins are present in mycobacteria. FurA and FurB share only 25% sequence identity and seem to execute completely different functions. FurB in MTB was identified as the major regulator in zinc homeostasis. In contrast, the role of FurA in mycobacteria has not yet been identified. A role in stress response is suggested. At present, no studies on the role of these two regulators in MAP have been conducted. Since maintenance of physiological metal concentration is a crucial step in bacterial survival and virulence, the aim of this thesis was to clarify the impact of FurA and FurB on MAP stress response and metal homeostasis.

(35)

Material and Methods Chapter 2

35 Chapter 2

Materials and Methods

(36)

Chapter 2 Materials and Methods

36

2.1 Materials

All chemicals were purchased from Sigma-Aldrich (Munich, Germany) if not stated otherwise. Bacterial strains, oligonucleotides (Eurofins Genomics, Ebersberg, Germany), plasmids and phages are listed in Tables 1-3.

Table 1: Bacterial strains used in this study

Bacterial strains Description Source/

reference E. coli DH5aF' F'/endA1 hsdR17 (rk- mk- supE44 thi-1 recA1

gyrA (Nalr relA1 D(lacZYA-argF)U169 deoR [f80dlacD(lacZ)M15]

[250]

E. coli HB101 K-12 derivative, supE44, hsd20, rBmB, recA13,

ara-14, proA2, lacY1, galK2, rpsL20, xyl-5, mtl-1 [251]

M. smegmatis mc²155 Transformable strain of the isolate

M. smegmatis ATCC 607 [252]

M. smegmatis∆furB markerless furB (msmeg4487^c) deletion mutant

of M. smegmatis mc²155 this work

M. avium ssp. paratuberculosis

DSM44135 clinical isolate of a decontaminated dung sample

of a paratuberculosis infected cow, DSM44135 [253]

ΔfurA furA (map1669c^a) deletion mutant of

M.avium ssp.paratuberculosis DSM44135 Eckelt et al.

subm.

ΔfurA/pMAP-furA1101 furA (map1669c^a) deletion mutant of

M.avium ssp.paratuberculosis DSM44135 with integrated pMAP-furA1101

Eckelt et al.

subm.

Table 2: Oligonucleotides used in this study

Oligonucleotides Description or sequence (5’ to 3’) Source/

reference

oFurA1 AGTCTTAAGCCGCAACTACACGCTGACGA

(forward primer situated at position 1824986-1825005^a, AflII restriction site underlined)

[254]

oFurA2 AATTCTAGAGTCGATGACACCGCACCAGA

(reverse primer situated at position 1823983-1824002^a, XbaI restriction site underlined)

[254]

oFurA3 AGTCTCGAGGCTCGACGGCAGGTTCTTGA

(forward primer situated at position 1823553-1823572^a, XhoI restriction site underlined)

[254]

oFurA4 ATTACTAGTGTACAGGGTCTCCAGGAAGG

(reverse primer situated at position 1822479-1822498^a, SpeI restriction site underlined)

[254]

(37)

Material and Methods Chapter 2

37

Oligonucleotides Description or sequence (5’ to 3’) Source/

reference

oMAP-furA K1 GATCAAGCTTGTGACGCAGCTCATTGGACATCCG

(reverse primer situated at position 1824058-1824081^a, HindIII restriction site underlined)

[254]

oMAP-furA K2 TCGATCTAGATCAAGAACCTGCCGTCGAGCAC

(reverse primer situated at position 1823553-1823574^a, XbaI restriction site underlined)

[254]

oGapDHfw ATCGGGCGCAACTTCTACC

(forward primer situated at position 1221936-1221954^c)

[255]

oGapDHrev GTCGAATTTCAGCAGGTGAGC

(reverse primer situated at position 1222038-1222058^c) [255]

oTKfurAKatGfw GAAGGGATTGCTGGGTTTTC

(forward primer situated at position 1823428-1823447^a)

[254]

oRTlppsrev GTCTACACCGTGCTCGACAA

(reverse primer situated at position 1824427-1824446^a) [254]

oRTmbtB fw GCCGGTAGGTGTAGCTCAGT

(forward primer situated at position 2420653-2420672^a) [254]

oRTmbtB rev CAAATCGCACCAGCAACTC

(reverse primer situated at position 2420825-2420843^a) [254]

oRTmap1588c fw CCAATCTCGGTGAGTACCTG

(forward primer situated at position 1746822-1746841^a) This work oRTmap1588c rev TCGAGAATCTCAAGGAAGCA

(reverse primer situated at position 1746962-1746981^a)

This work

oRTmap1589c fw GAACTGGATCTCGTTGTTCG

This work

oRTmap1589c rev ACAGCGAGTTCGTCCACTT

This work

oRTmap0847 fw GGCAGAACCCAATACATGAG

This work

oRTmap0847 rev GGTAGATGTAGCCGTCGTTG

This work

oRTmap0047c fw GCATTCGACGAGTAGATGCT

This work

oRTmap0047c rev GGAATTCCTGCAGTCCAAG

This work

oRTfurA1 fw GCACAGGCCCCAGTAGAT

This work

oRTfurA1 rev AATCACCACCACGTCGTCT

This work