Conditional expression of Pim1 and c-Myc in murine B lineage cells and their functional consequences

Volltext

(1)Conditional Expression of Pim1 and c-Myc in Murine B Lineage Cells and their Functional Consequences. { Inauguraldissertation. zur Erlangung der Wurde eines Doktors der Philosophie vorgelegt der Philosophisch-Naturwissenschaftlichen Fakultat der Universitat Basel. von Corinne Bouquet. aus Rougemont, Waadtland (CH). Berlin 2012. Originaldokument gespeichert auf dem Dokumentenserver der Universitat Basel edoc.unibas.ch. Dieses Werk ist unter dem Vertrag "Creative Commons Namensnennung-Keine kommerzielle Nutzung-Keine Bearbeitung 2.5 Schweiz" lizenziert. Die vollstandige Lizenz kann unter creativecommons.org/licences/by-nc-nd/2.5/ch eingesehen werden..

(2) Genehmigt von der Philosophisch-Naturwissenschaftlichen Fakultat auf Antrag von Prof. Dr. Daniela Finke, Prof. Dr. Fritz Melchers & Prof. Dr. Antonius Rolink Basel, den 30.3.2010 Dekan: Prof. Dr. Eberhard Parlow.

(3) Acknowledgements. This thesis was done at the Max-Planck Institute for Infection Biology in Berlin under the supervision of Prof. Dr. Fritz Melchers. I want to thank him for a good time in Basel, and a great opportunity to go to Berlin and join his group. Thanks for a great time in and outside the lab and lots of fruitful discussions. Also many thanks to Prof. Dr. Antonius Rolink and Prof. Dr. Daniela Finke for being members of the PhD committee and for helpful advice. Many thanks to our technicians Patricia Vegh, Jana Winckler, Nicole Dittberner and Conny Liebers for assistance and a nice atmosphere in the lab. I also want to thank my lab-colleagues Marko Knoll, Katharina Seiler, Szandor Simmons, Julia Tornack, Inge Wolf and Ozan Guezelbey for helpful advice and helping out with reagents, cells and other stu . I am also grateful to Dr. Motokazu \Tsune" Tsuneto for helpful advice and thrilling discussions with scienti c and also philosophical background. Many thanks to Dr. Anja Hauser and Britta Laube for showing me how to do cryosections and immuno uorescence stainings. Thanks also to Toralf Kaiser and his crew from the FACS sorting facility, to Ida Wagner from the Core Facilty for doing my RNA-Chips, to Dr. Christian Busse, Dr. Hedda Wardemann and Dr. Marc Ehlers for helpful advice. Thanks to the \basement" crew from the instiute, i.e. Sven Dombrowski, Mario Schmidt, and the others who took care of the institute and technical problems. My gratitude also goes to the IT-members, Susanne Pfa enbrot, Ralf Trager and Oliver Friedrichs, who always provided quick and friendly help as soon as one of the computers or the infamous \problem printer" did not want to cooperate anymore. Also many thanks to the sta from the animal facility, especially to Ines Neumann. A bunch of roses for Birgit Grett, the invaluable lab-fairy, who always took great care for our lab and cleaned tons of glassware and beakers. Special thanks to Sarah Kuck, who always had an open ear and helpful advice if I had questions concerning administrative issues; thanks to Nicole Salvisberg, PA of Antonius Rolink in Basel for coordinating the PhD application and administrative things in Basel, and to Marianne Hess from the dean's oce in Basel for willingly answering lots of questions. I also want to thank the members of the \co ee party" for a cool time, i.e. Patricia, Jana, David Manntz, Dominique Khalil, Chris Dimmler, Isabella Gravenstein and others. A special bunch of roses goes to Patrick, Chris & Jean-Paul, Doreen & Stefan, Biggi & Denis and other family members and friends for relaxing times and support. And, last but not least, I want to thank to Willie, Freddie, Bennie, Millie, Winnie and all the other mice who gave their lifes (not quite willingly) for this thesis.. Corinne Bouquet, MPI for Infection Biology, Chariteplatz 1, 10117 Berlin, Germany: PhD Thesis, March 23, 2012. 1.

(4) Contents Contents. Abbreviations. 5. 1 Abstract. 8. 2 Introduction. 11. 3 Materials. 20. 2.1 B-Cells: Development and Function . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.1.1 B-Cell Development in the Mouse . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.1.2 B-cell Subsets and their Characterisation . . . . . . . . . . . . . . . . . . . . . . . 2.1.3 Activation of B Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.1.4 Growth Factors and Stimulants for B-Cells . . . . . . . . . . . . . . . . . . . . . . 2.1.5 In vitro Culture of B-Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.2 Myc and Pim1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.2.1 Structure of Myc . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.2.2 Regulation of Myc . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.2.3 Function of Myc . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.2.4 Myc and Cancer . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.2.5 Myc and B-Cell Development . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.2.6 The Pim Kinase Family . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.2.7 Structure and Function of Pim1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.2.8 Pim1 in B-Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.2.9 Pim and Tumours - Pim-p my Myc! . . . . . . . . . . . . . . . . . . . . . . . . . . 2.3 Thesis Objectives . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 3.1 3.2 3.3 3.4 3.5 3.6 3.7 3.8 3.9 3.10 3.11 3.12. 2. Machines . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Software . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Kits . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Labware . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Antibodies for FACS Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Antibodies for ELISA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Antibodies for Western Blotting . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . DNA Primers . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Enzymes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Tissue Culture Media and Addititves . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Chemicals . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Molecular- and Cell-Biology Reagents . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 11 11 12 13 15 16 16 16 17 17 18 18 18 18 18 19 19. 20 20 21 21 22 22 22 23 23 23 24 25.

(5) Contents 3.13 3.14 3.15 3.16 3.17. Bu ers and Solutions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Plasmid Vectors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Bacteria . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Cell Lines . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Mouse Strains . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. 4 Methods. 4.1 Molecular Biology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.1.1 Cultivation of E. coli . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.1.2 Preparation of Electrocompetent Bacteria . . . . . . . . . . . . . . . . . . . . . . . 4.1.3 Electroporation of Bacteria . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.1.4 Restriction Endonuclease Digests . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.1.5 DNA Gel Electrophoresis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.1.6 Gel Extraction of DNA Fragments . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.1.7 Primer Design for PCR and RT-PCR . . . . . . . . . . . . . . . . . . . . . . . . . 4.1.8 PCR with Taq Polymerase . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.1.9 PCR with PFU Polymerase . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.1.10 Preparation of messenger RNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.1.11 Preparation of c-DNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.1.12 Real Time PCR . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.1.13 Oligo Linker Annealing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.1.14 Addition of Adenine-Overhangs to blunt-ended PCR Products for TOPO-TA Cloning 4.1.15 Dephosphorylation of DNA Fragments . . . . . . . . . . . . . . . . . . . . . . . . . 4.1.16 DNA Ligation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.1.17 Topo-TA Cloning . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.1.18 SDS Page . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.1.19 ELISA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.2 Cell Biology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.2.1 Coupling of anti-IgM Antibodies to CNBr-Activated Sepharose . . . . . . . . . . . 4.2.2 FACS Staining . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.2.3 FACS Sorting of B-Cells and B-Cell Precursors . . . . . . . . . . . . . . . . . . . . 4.2.4 Cell Cycle Analysis by PI Staining . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.2.5 CFSE Staining of B Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.3 Cell Culture . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.3.1 Cell Culture Media . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.3.2 Preparation of Insulin Stock Solution 5 mg/ml . . . . . . . . . . . . . . . . . . . . 4.3.3 Cultivation Conditions of Cell Lines . . . . . . . . . . . . . . . . . . . . . . . . . .. Corinne Bouquet, MPI for Infection Biology, Chariteplatz 1, 10117 Berlin, Germany: PhD Thesis, March 23, 2012. 25 26 26 26 27 29. 29 29 29 29 29 29 30 30 30 30 30 30 31 31 31 31 31 32 32 33 33 33 34 34 34 35 35 35 36 36 3.

(6) Contents 4.3.4 Preparation of Cytokine Supernatants and Stock Solutions . . . . . . . . . . . . . 4.3.5 Cryopreservation of Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.3.6 Reactivation of Cryopreserved Cells . . . . . . . . . . . . . . . . . . . . . . . . . . 4.3.7 Counting of Living Cells by Trypan Blue Exclusion . . . . . . . . . . . . . . . . . . 4.3.8 Cultivation of PreB-I Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.3.9 Cultivation of Hematopoietic Progenitors from the Bone Marrow . . . . . . . . . . 4.3.10 Trypsinization of Adherent Cell Lines . . . . . . . . . . . . . . . . . . . . . . . . . 4.3.11 Cultivation of Adherent Cell Lines . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.3.12 Transient Transfection of Phoenix-Eco & Plat-E Cells . . . . . . . . . . . . . . . . 4.3.13 Retroviral Transduction of B-Cell Precursors . . . . . . . . . . . . . . . . . . . . . 4.3.14 Selection of Retrovirus-Containing Cells by Treatment with Antibiotics . . . . . . 4.3.15 Limiting Dilution . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.3.16 In vitro Di erentiation of B-Cell Progenitors . . . . . . . . . . . . . . . . . . . . . 4.3.17 Preparation of Thymic T-Cells for Co-Transplantation with B-Cells . . . . . . . . 4.3.18 Depletion of CD19+ B-Cells with Miltenyi MACS Beads . . . . . . . . . . . . . . . 4.3.19 Enrichment of ex vivo CD19+ B-Cells using Miltenyi MACS Beads . . . . . . . . . 4.4 Animal Work . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.4.1 Preparation of Bone Marrow Progenitor Cells . . . . . . . . . . . . . . . . . . . . . 4.4.2 Cell Preparation of Spleen and Peritoneal Cavity . . . . . . . . . . . . . . . . . . . 4.4.3 Transplantation of PreB-I Cells into the Tail Vein of Mice . . . . . . . . . . . . . . 4.4.4 Immunisation of Mice . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.4.5 Bleeding of Mice . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.4.6 Feeding of Doxycycline in the Drinking Water . . . . . . . . . . . . . . . . . . . . . 5 Results. 5.1 Vector Design . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5.2 Con rmation of Inducible Transcription and Translation of Transgenes . . . . . . . . . . . 5.2.1 Detection of EGFP Protein in TetOn-egfp Transgenic PreB-I Cells by FACS . . . . 5.2.2 Detection of Upregulated Myc and Pim1 mRNA by RT-PCR . . . . . . . . . . . . 5.2.3 Detection of Transgenic Myc by Western Blot . . . . . . . . . . . . . . . . . . . . . 5.2.4 Degree of Leakiness of the TetOn Vector-Mediated Gene Expression . . . . . . . . 5.2.5 Stability of Doxycycline in Cultivation Medium at 37 C . . . . . . . . . . . . . . . 5.3 E ect of Pim1+Myc-Overexpression on Transgenic PreB-Cells in vitro . . . . . . . . . . . 5.3.1 in vitro Di erentiation of Normal PreB-I Cells . . . . . . . . . . . . . . . . . . . . 5.3.2 in vitro Growth Behaviour of FL PreB-I Derived Cells Overexpressing Pim1 and/or Myc . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5.3.3 Limiting Dilution Analysis of Clonable, Pim1+Myc-Induced PreB-I Cells . . . . .. 4. 36 37 37 37 37 38 38 38 38 38 39 39 39 40 40 40 41 41 41 41 41 42 42 43. 43 47 47 49 50 50 50 51 51 52 54.

(7) Contents 5.3.4 Cell Cycle Analysis of PreB-cells Overexpressing Pim1 and/or Myc . . . . . . . . . 5.4 Overexpression of Pim1 and Myc in Immature and Mature B-Cells ex vivo and in vivo . . 5.4.1 Phenotype of Transplanted FL preB-I-Cells in Di erent Murine Organs . . . . . . 5.4.2 E ect of Overexpression of Myc only in B-Cells in vivo . . . . . . . . . . . . . . . 5.4.3 In vivo Expansion of B-Cells Overexpressing Pim1 together with Myc . . . . . . . 5.4.4 Increased Cell Size of B-Cells Overexpressing Myc in vivo . . . . . . . . . . . . . . 5.4.5 Ex vivo Proliferation of Donor-Derived Splenic B-Cells 4 Months after Transplantation 5.4.6 In vitro Culture of Transplanted Splenic, Bone Marrow and Peritoneal B-Cells one Month after Transplantation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5.4.7 Detection of in vitro Proliferation of B-Cells by CFSE Staining . . . . . . . . . . . 5.5 Overexpression of Pim1 and Myc in Activated B-Cells in vivo . . . . . . . . . . . . . . . . 5.5.1 B- and T-Cell Compartments of RAG1 = Mice Transplanted with FL-preB-I Cells and Thymocytes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5.5.2 Overexpression of Myc and Pim1 in Activated B-Cells in vivo in the Presence of T-Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5.5.3 Does a T-cell Dependent Antigen also Elicit B-Cell Immune Responses in the Absence of T-Cells? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6 Discussion. 6.1 Establishing the System for Overexpression of Transgenes . . . . . . . . . . . . . . . . . . 6.1.1 Conditional Overexpression of Proto-Oncogenes in Murine B-Cells Using a Retroviral TetON System . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6.1.2 The Pros and Cons of Using a Retroviral TetON System in B-Cells . . . . . . . . . 6.1.3 Con rmation of Inducible Transcription and Translation of Transgenes . . . . . . . 6.1.4 Reversibility of Induced Overexpression of Transgenes . . . . . . . . . . . . . . . . 6.1.5 Leakyness of the Doxycycline-Inducible Expression System . . . . . . . . . . . . . 6.1.6 The Use of Fetal Liver-Derived preB-I-Cells versus Bone Marrow-Derived preB-ICells for the Generation of B-Cells in vitro and in vivo . . . . . . . . . . . . . . . . 6.2 In vitro and in vivo Maturation of Fetal Liver PreB-I Cells . . . . . . . . . . . . . . . . . 6.3 Overexpession of Pim1 and Myc in B-Cells at Di erent Stages of Development . . . . . . 6.3.1 Overexpression of a Single Transgene, Pim1 or Myc, in PreB-I-Cells . . . . . . . . 6.3.2 Overexpression of Pim1 and Myc together in PreB-I-Cells in vitro . . . . . . . . . 6.3.3 Overexpression of Pim1 and Myc in IgM+ Cells in vitro . . . . . . . . . . . . . . . 6.3.4 Limiting Dilution Analysis of Clonable, Pim1+Myc-Induced PreB-I-Cells . . . . . 6.3.5 Transplantation of PreB-I Cells Overexpressing Myc and/or Pim1 into RAG KO Mice . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6.3.6 Mature B-Cells and Pim1+Myc Overexpression . . . . . . . . . . . . . . . . . . . .. 7 Conclusion and Outlook Corinne Bouquet, MPI for Infection Biology, Chariteplatz 1, 10117 Berlin, Germany: PhD Thesis, March 23, 2012. 56 58 58 59 60 63 63 65 67 71 71 72 75 77. 77. 77 77 79 80 80 81 82 82 82 83 84 85 85 86 88. 5.

(8) List of Figures List of Tables. 1 2 3 4 5. Limiting Dilution: Pim1 +Myc transgenic cells . . . . . . . . . . . . . . . . . . . . . . . . Limiting Dilution of Pim1 +Myc transgenic cells: regrowth on IL-7 . . . . . . . . . . . . . B-cell numbers in preB-I-cell-transplanted mice over time . . . . . . . . . . . . . . . . . . Serum levels of WT mice and FL preB-I-cell-transplanted mice over time . . . . . . . . . T-cell numbers in preB/thymocyte-cotransplanted RAG KO mice . . . . . . . . . . . . . .. 55 56 58 59 71. List of Figures. 2.1 2.2 2.3 2.4 4.1 5.1 5.2 5.3 5.4 5.5 5.6 5.7 5.8 5.9 5.10 5.11 5.12 5.13 5.14 5.15 5.16 5.17 5.18 5.19 5.20 5.21 5.22 6. Development of B-lymphocytes in the bone marrow . . . . . . . . . . . . . . . . . . . . . . Receptors on B-cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T-cell dependent B-cell activation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Structure of Myc . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . modi ed 50 ml tube for coupling of antibodies . . . . . . . . . . . . . . . . . . . . . . . . ERt vector map . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Important elements in retroviral vectors . . . . . . . . . . . . . . . . . . . . . . . . . . . . Reverse transcription of retroviral RNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . TetON system . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . rtTA-TetOn-vector . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Retroviral vector with doxycycline-inducible transgenes . . . . . . . . . . . . . . . . . . . Protein sequence of Myc . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Validation of the TetON vectors with inducible EGFP expression . . . . . . . . . . . . . . Validation of the TetON vectors (mRNA) . . . . . . . . . . . . . . . . . . . . . . . . . . . Validation of the TetON vectors (Leakyness) . . . . . . . . . . . . . . . . . . . . . . . . . Maturation of preB-I cells textitin vitro: phenotype, survival . . . . . . . . . . . . . . . . Growth Curve of preB-cells expressing Pim1 or Myc . . . . . . . . . . . . . . . . . . . . . Growth Curve of preB-cells expressing Pim1 and Myc . . . . . . . . . . . . . . . . . . . . Changing phenotype of preB-cells expressing Pim1 and Myc . . . . . . . . . . . . . . . . . Growth Curve of IgM+ cells expressing Pim1 and Myc . . . . . . . . . . . . . . . . . . . . Estimation of Pim1+Myc-responsive preB-I cells . . . . . . . . . . . . . . . . . . . . . . . PI-staining: plot . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Cell cycle analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B-cell phenotype of WT mice and preB-cell transplanted RAG KO mice . . . . . . . . . . Numbers of Myc -transgenic CD19+ cells in host mice with and without doxycycline . . . B-cell subsets in host mice transplanted with Myc -transgenic preB-I cells . . . . . . . . . In vivo expansion of Pim1 +Myc -transgenic B-cells . . . . . . . . . . . . . . . . . . . . . .. 11 14 15 16 33 43 44 45 46 46 47 48 49 49 51 52 53 53 54 54 55 57 57 58 60 61 61.

(9) List of Figures 5.23 Phenotype of in vivo expanded Pim1 +Myc -transgenic B-cells . . . . . . . . . . . . . . . . 5.24 Myc in uences cell size . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5.25 Ex vivo splenic B-cell cultures . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5.26 Ex vivo splenic B-cell cultures II . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5.27 Ex vivo CFSE-staining of splenic and BM B-cells: percentage of B-cells . . . . . . . . . . 5.28 Ex vivo CFSE-staining of BM B-cells: numbers of divisions . . . . . . . . . . . . . . . . . 5.29 Ex vivo CFSE-staining of splenic and BM B-cells: cell cycle entry . . . . . . . . . . . . . . 5.30 Ex vivo CFSE-staining of splenic and BM B-cells: numbers of divisions. . . . . . . . . . . 5.31 T- and B-cell compartment of RAG KO mice cotransplanted with preB-cells and thymocytes (FACS plots) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5.32 Experimental setup: E ect of Pim1 and Myc on activated B-cells in vivo . . . . . . . . . . 5.33 ELISA (IgM) of sera of transplanted, immunised mice . . . . . . . . . . . . . . . . . . . . 5.34 ELISA (IgG) of sera of transplanted, immunised mice . . . . . . . . . . . . . . . . . . . . 5.35 Control immunisations in the absence of T-cells: Outline . . . . . . . . . . . . . . . . . . . 5.36 Control immunisations in the absence of T-cells: ELISA . . . . . . . . . . . . . . . . . . . 6.1 Possible patterns of Myc- and Pim1-overexpression by the TetON expression vectors. . . . 6.2 Causes for leaky expression of transgenes . . . . . . . . . . . . . . . . . . . . . . . . . . . 7.1 Model: Myc balances proliferation and apoptosis . . . . . . . . . . . . . . . . . . . . . . . 7.2 Model: How PIM outmaneuvers the Myc apoptosis program . . . . . . . . . . . . . . . . .. Corinne Bouquet, MPI for Infection Biology, Chariteplatz 1, 10117 Berlin, Germany: PhD Thesis, March 23, 2012. 62 64 65 66 67 68 69 70 71 72 73 74 75 76 79 81 88 89. 7.

(10) 1 Abstract 1. Abstract. This thesis was aimed at identifying proto-oncogenes that contribute to cell cycle entry, proliferation and survival of mouse B-lymphocytes at di erent stages of their development, i.e. in preB-I, preB-II, immature B-cells, mature resting and mature activated B-cells. A central notion of tumour development of the B-lymphocyte cell lineages is that the activation of a single proto-oncogene, or the loss of a single tumour suppressor gene, is not sucient to transform cells to full malignancy. One such example with which this cooperation of oncogenes has been studied is E-myc induced lymphomagenesis. Transgenic E-myc mice express the c-myc gene under the control of the IgH -chain gene enhancer in B-lineage cells. B-cell lymphomas are generated in these mice within several weeks. Retroviral insertional mutagenesis has identi ed pim1 as cooperating oncogene which accelerates lymphomagenesis in vivo. Hence, I have chosen myc and pim1 to introduce them into B-cell progenitors by retroviral transduction, to test their e ects alone or together on preB-I, preB-II, immature and mature B-cells in vitro and, upon transplantation into recipient mice, in vivo. As target cells for retroviral transduction, mouse fetal liver-derived preB-I-cells were chosen, since they proliferate long term in vitro on stromal cells in the presence of IL7. I used inducible forms of these genes to turn on and o their expression in the transfected cells at di erent times for di erent time periods. After initial tests with the inducible estrogen-receptor system, the TetON inducible expression system was chosen which allows the expression of inducible transgenes upon addition of doxycycline. In the here presented work show that overexpression of Myc alone in pre-BI cells in vitro enhances cell cycle entry without impairing apoptotis of pre-BI cells induced by the removal of IL-7 from the culture. Pim1 overexpression alone did not show any e ect. However, in cooperation with Myc, Pim1 led to growth-factor-independent long term in vitro proliferation of pre-BI cells deprived of IL-7. This induction of proliferation could be reversed when doxycycline was removed again from the culture. During long term proliferation of these cells, di erentiation to pre-BII and immature B-cells was slowed down but not completely blocked in vitro. The di erentiated pre-BII and IgM+ immature B-cells also were induced to growth factor-independent proliferation by Pim1 plus Myc. Transplantation of Myc-overexpressing pre-BI cells into sublethally irradiated Rag KO mice did not increase the numbers of B cells developing in the transplanted mice compared with mice transplanted with doxycycline-non-induced pre-BI cells. On the other hand, transplantation of pre-BI cells overexpressing Pim1 and Myc together expanded the immature IgM (pre-B) cell compartment 100 fold and the immature IgM+ B-cell compartment 6 fold in the spleen within 1 month. Upon removal of doxycycline from the drinking water, the expanded numbers of B-cells reverted to almost normal levels, i.e. to the levels of B cell numbers of doxycycline-uninduced mice. Hence, overexpression of the proto-oncogenes Pim1 and Myc is able to induce growth-factor-independent proliferation of pre-B cells and immature IgM+ cells, in vitro and in vivo. By contrast, mature B cells overexpressing Myc and Pim1 together, isolated from the spleens of pre-BI cell-transplanted mice, were not induced to cytokine-independent proliferation in vitro. Even the stimulation by LPS, IL-5, IL-4 + CD40, and anti-Ig in vitro did not induce prolonged proliferation beyond the normal stimulation observed with non-transgenic, or with transgenic B cells in the absence of doxycycline. Likewise, in vivo antigenic stimulation with KLH of mice transplanted with Myc and Pim1-overexpressing pre-BI cells in the presence or absence of co-transplanted T-cells did not result in expanded, KLH-speci c, class-switched antibody responses. Hence, while pre-BI, pre-BII and immature 8.

(11) B cells expand cytokine-independently in vitro and in vivo when Pim1 and Myc are overexpressed together, mature B cells generated from these transplanted pre-B cells in vivo do not manifest deregulated proliferation or survival in vitro or in vivo upon T-cell-independent or T-cell-dependent stimulation.. Corinne Bouquet, MPI for Infection Biology, Chariteplatz 1, 10117 Berlin, Germany: PhD Thesis, March 23, 2012. 9.

(12) 1 Abstract Abbreviations. AP BCR BM EtOH FACS FCS FL Flt3L h IL IRES KLH KO LPS MACS MoMulV MPI-IB Myc, myc MZ, MZB ON PC PI Pim1, pim1 RT RT-PCR SIN TH TD TdT TI TLR TSLP. 10. alkaline phosphatase B-cell receptor bone marrow ethanol uorescence activated cell separation fetal calf serum fetal liver Fms-related tyrosine kinase 3 ligand hours interleukin internal ribosome entry site keyhole limpet hemocyanin knockout lipopolysaccharide magnetic activated cell separation Moloney murine leukemia virus Max-Planck Institute for Infection Biology C-Myc, V-Myc myelocytomatosis viral oncogene homolog, gene marginal zone B cells over night peritoneal cavity propidium iodide proviral integration site 1 protein, gene room temperature real time PCR self inactivating (retroviral vector) T helper cell T-dependent (antigen) terminal desoxyribonucleotidyl transferase T-independent (antigen) toll-like receptor thymic stromal lymphopoietin.

(13) 2. Introduction. 2.1 B-Cells: Development and Function. B-cells and T-cells constitute their adaptive part of the vertebrate immune system. While T-cells confer cellular immunity, B-cells are responsible for humoral immunity by secreting antibodies which circulate in the body uids to capture and neutralise foreign antigens. 2.1.1 B-Cell Development in the Mouse. The rst wave of B-cells in the murine embryo is generated from primitive pluripotent hematopoietic stem cells (pHSCs) rst aggregating at day 7.5-8 p.c. (post coitum ) in the AGM (aorta-gonad-mesonephros), which lies between the notochord and the somatic mesoderm and contains the dorsal aorta, the genital ridges and mesonephros [106]. These pHSC-progenitors then migrate to the fetal liver around day 11 p.c.. Around birth, i.e. at day 18 p.c., B cell development reaches a maximum in fetal liver, and is initiated in the bone marrow, where B-cell development takes place during the rest of life from resident pHSCs. Bone marrow-derived B cells di er from fetal liver-derived ones in several aspects [72]. Only bone marrow-derived antibodies have insertions of random bases (N regions) at the joints of the rearranged segments, since the enzyme TdT (terminal desoxyribonucleotidyl transferase) is expressed and active in the bone marrow, but not in the fetal liver [80]. Another di erence between bone marrow and fetal liver preB-cells is the absolute requirement of bone marrow B-cell precursors for IL-7, whereas fetal liver preB-cells can develop IL-7-dependently, but do not rely on this cytokine only. Hence, in IL-7 de cient mice, B-cell development is only observed during fetal and perinatal life [15]. These IL-7 de cient mice only have B1- and marginal zone B-cells and show enlarged IgM and IgG-serum levels if T-cells are present. They grow in the absence of IL-7 if supplemented with IL-3 or thymic stromal lymphopoietin (TSLP) [113]. Hence, in in vitro culture, fetal liver pre-BI cells can be grown in the absence of IL-7 if supplemented with IL-3 or thymic stromal lymphopoietin (TSLP) [113]. proB. preBI. “A”. “B”. ➞. DH➞JH. large preBII “C ”. “C’ ”. ➞. DHJH/ DHJH. small immature preBII B “D”. “E”. nomenclature: Rolink et al. Hardy et al.. ➞ ➞. ➞. VL➞JL VHDHJH/ (VH)DHJH. Binding to autoantigens: strong weak no binding. Legend preBCR IgM IgD. mature B1. mature B2. Figure 2.1 { Outline of the development of B lymphocytes in the bone marrow. Shown are two nomenclatures, the \Basel" separation system developed by Rolink et al., and the ABC nomenclature developed by Hardy et al., see the text for further details. Proliferation of preB-cells can mainly be observed in large pre-BII cells and to a lesser extent in pre-BI cells. All other immature stages do not divide. DH ! JH , etc: rearrangement of the designated segments is ongoing, DH JH , etc: rearrangement of the designated segments (V, D, and J) is nished. H : heavy chain, L : light chain. Corinne Bouquet, MPI for Infection Biology, Chariteplatz 1, 10117 Berlin, Germany: PhD Thesis, March 23, 2012. 11.

(14) 2 Introduction Development of B cells can be tracked by their state of rearrangements of the V, D and J segments of the B-cell receptor, and by FACS analysis, since di erent stages of B cells express characterising surface receptors. Several di erent systems have been established to identify the di erent B cell maturation stages. Herein, the surface marker separation system developed by Rolink et al. [111] [113] is used. In gure 2.1, this system is compared to the Hardy ABC-system [49]. The earliest event which shows that a cell is committed to the B lineage is the transcription of the non-rearranged germline heavy chain gene locus, as well as the transcription of the VpreB and 5 genes, which are parts of the pre-B cell receptor [91]. These cells are B220+ but still do not express the pan-B cell marker CD19 and are called pre/pro-B cells. Rearrangement of DH segments to JH segments of the Ig gene loci is already detectable at this stage. The next distinguishable stage on the way to a mature B-cell has almost completely rearranged all alleles of the heavy chain to DH JH , and expresses c-kit and CD19 [90]. This stage is referred to as pre-BI stage. VH to DJH rearrangements mark the transition from pre-BI cells to large pre-BII cells. pre-BII cells are CD19+c-kit CD25+CD43+. As soon as a productive V DJH -rearranged allele is made and the heavy chain is deposited on the cell surface together with the surrogate light chain (H + VpreB + 5, = preBCR, preB-cell receptor), allelic exclusion inhibits further rearrangement of the other allele. The deposition of the preBCR on the cell surface induces these cells to enter the cell cycle and divide around two to ve times. Cells de cient for the preBCR do not proliferate [73]. As soon as the preBCR is formed, expression of the VpreB and 5 proteins stops [42] and subsequently, proliferation of pre-BII cells ceases. The cells now become small (since they are resting) and start to rearrange the light chain gene segments VL to JL by activating the rearrangement machinery again and opening the light-chain gene loci for these rearrangements. They are now named small pre-BII. In contrast to humans, mice do not reactivate TdT anymore for rearranging the light chain. Hence, mouse V JL joints do not have N regions. Rearrangements of the and light chain loci are independent of each other, but the locus becomes rst accessible, and the rate of rearrangement at the L -chain locus is 5 times higher than at the L locus. Only one allele of the locus is rearranged at a time [99]. When a functional light chain is produced which can pair with the heavy chain, the immature Bcell is tested for reactivity with self-antigens. If the produced B-cell receptor (BCR) can strongly bind to self-antigen, the respective immature B-cells can be rescued by \editing" their receptor by secondary light-chain rearrangements [110]. If receptor editing is not possible or if the secondary rearrangement does not change the autoreactivity, the cells acquire an unresponsive, anergic state or are clonally deleted [53]. Immature B-cells expressing a B-cell receptor which binds self-antigen with low anity are thought to be positively selected and to enter the B1- and MZ (marginal zone) compartment. Immature B-cells carrying a BCR receptor which does not bind autoantigen enter mainly the B2 compartment. 2.1.2 B-cell Subsets and their Characterisation. B-cells can be divided into at least 2 lineages: B1 cells, and conventional (B2) B-cells [3]. B1 cells are IgMhi IgDlo CD11b+ and comprise the majority of B-cells in the peritoneal cavity. The B1 compartment is further divided into B1-a and B1-b cells according to their expression of CD5. B1-a cells express CD5, whereas B1-b cells are CD5-negative. The B1-a cells are thought to be one main source of \natural antibodies" that are produced also in the absence of antigenic stimulations, e.g. infections. These natural antibodies recognise high molecular weight polymeric antigens and are thought to be important during the early response to encapsulated extracellular bacteria [44]. In contrast, B1-b cells produce 12.

(15) 2.1 B-Cells: Development and Function antibodies only after exposure to antigens. Activation of B1-b cells can be T-helper cell (TH ) independent and can generate long lasting IgM memory [4]. Until recently there was a debate if B1- and B2 cells are derived from the same ancestor, or if there are di erent progenitors for each lineage. It has recently been shown that B1 B-cells have their own progenitor among the CD45Rlo neg CD19+ population which is highly abundant in fetal bone marrow and less abundant in postnatal bone marrow [96]. Therefore, it is not very surprising that fetal liver pre-BI cells repopulate preferentially the B1 cell compartment, whereas bone marrow pre-BI cells more eciently generate the B2 cell compartment [55], [50]. The B2 cell compartment is further subdivided into follicular B-cells and marginal zone B-cells (MZB). In rodents, the latter are mainly found in the marginal zone of the spleen which surrounds the B-cell follicles. MZB-cells are sessile [43] and express high levels of surface immunoglobulin M (sIgM) and CD21 (complement receptor 2) and low levels of sIgD. MZB-cells can respond more rapidly following exposure to antigen [86] and, together with the B1-cells, are largely responsible for rapid early TH -cell-independent B-cell responses. The follicular B-cells are IgM+IgD+ CD23+CD21lo and are found in the follicles of spleen and lymph nodes, but also circulate in the blood. They can react to TH -cell dependent protein antigens, and organize themselves in germinal centers where they develop to somatically hypermutated, Ig-class switched long lived memory and plasma cells harbouring high anity antibodies to the immunising antigen. 2.1.3 Activation of B Cells. B-cells can be activated either with or without the help of T-cells (TD, T-dependent or TI, T-independent), depending on the nature of the antigen and the receptors involved. T-independent antigens fall into two classes, which activate B-cells by two di erent mechanisms. TI-1 antigens can activate B-cells independently of the BCR. This polyclonal activation can occur e.g. via the toll-like receptors (TLRs) present on all B-cells which recognise bacterial cell wall components, bacterial DNA, agella and other bacterial components ( gure 2.2). TI-1 antigens need to be present at high concentrations in order to polyclonally activate B-cells. An example of a TI-1 antigen often used in research is lipopolysaccharide (LPS). TI-2 antigens on the other hand are highly repetitive molecules such as bacterial polysaccharides which can crosslink several BCRs and hereby activate the B-cells [10]. A typical example of TI-2 antigens used in research is anti-IgM coupled to dextran or sepharose beads. Protein antigens without repetitive antigenic structures can only activate naive B-cells with the help of activated T helper cells (TH ). If a naive B-cell recognises a protein antigen with its BCRs, it internalises the antigen, processes it by proteolytic degradation, and presents the peptide fragments via MHC-II complexes on the cell surface. This preactivated B-cell is preferentially trapped in T-cell rich zones of secondary lymphoid tissues such as spleen and lymph nodes. TH cells which have a T-cell receptor (TCR) speci c for the MHCII-antigen complexes on the B-cell are subsequently activated by the Bcell. Thereafter, the T-cell expresses CD40-L [103] [104] and releases cytokines such as IL-2 or IL-4, which in turn further activate the B-cell via CD40 and corresponding cytokine receptors ( gure 2.2). The TNF-family member CD40 plays a central role in T-cell dependent B-cell activation and germinal center formation [74] [39]. The interaction of activated T-cells with B-cells via CD40 can be mimicked with CD40-speci c antibodies [115]. Finally, B-cells upregulate the expression of B7-1 and B7-2, which interact with CD28 or CTLA-4 on helper T-cells which either enhance (CD28) or inhibit (CTLA-4) the T-B collaboration. Upon T-cell dependent activation of B-cells, there are several possible pathways a B-cell can take Corinne Bouquet, MPI for Infection Biology, Chariteplatz 1, 10117 Berlin, Germany: PhD Thesis, March 23, 2012. 13.

(16) 2 Introduction CD21. BCR. CD19. B7.1/2. TLR-4. CD40 MHC II. B cell BAFF-R. FAS. CTLA-4 CD28 + CD40-L TCR. IL-4R. TH-cell FAS-L. IL-5R. Figure 2.2 { B-cells can be activated and in uenced via a set of di erent surface receptors. The main receptor is the B-cell receptor, which is surrounded by the coreceptor signalling complex consisting of Ig = , CD19, CD81, and the complement receptor CD21. CD21 can bind the complement fragments C3d and C3g of antigencomplement clusters and leads to enhanced activation of B-cells [11]. Toll like receptors (TLR) recognise bacterial components and activate B-cells BCR-independently. Di erent cytokine receptors speci c for IL-2, IL-4, IL-5, IL6, etc can in uence the reactions of activated B-cells. Signalling via Ba R leads to enhanced survival, whereas signalling via FAS leads to apoptosis of activated B-cells. FAS is upregulated after B-cell activation in the germinal center. CD40 recognises CD40-ligand on activated T-cells. Signalling via CD40 costimulates and activates B-cells which were preactivated by signalling via BCR. B-cells in turn can activate T-cells by presenting antigen fragments on their MHC II molecules. Many di erent signalling pathways activate the NFB transcription factors which are involved in activation and survival of B-cells.. ( gure 2.3). First, activated B-cells can move to the border of the T-cell zone and the medulla in the spleen or to the medullary cords in the lymph nodes. Then they proliferate and subsequently di erentiate into short lived plasma cells which secrete mainly IgM ( gure 2.3). Second, T-cell-activated B-cells can migrate to follicles in the B-cell zone and form a germinal center. In the germinal center, proliferating B-cells form the dark zone. These cells downregulate their sIg molecules and divide every 6-8 hours (centroblasts), whereas in the light zone of a germinal center, there is a mixture of mainly non-proliferating B-cells (centrocytes) deriving from the centroblast, T-cells and follicular dendritic cells (FDCs). The dark zone is thought to be the place where the B-cells begin to acquire somatic hypermutations in the variable regions of their antibody genes, while the light zone is the place where these mutated cells are selected for BCRs with enhanced anities to the original antigen by interactions with FDCs which present a nondegraded, native form of the protein antigen to the B-cells, thereby allowing selection of hypermutated B-cells with speci c BCRs for 3-dimensional antigen determinants on the protein antigen. Hypermutated B-cells with higher anity to the antigen are positively selected and switch their antibody heavy chains to di erent isotypes. The mainly produced isotypes during a GC reaction are dependent on the cytokines which are present [125]. The cytokine milieu itself is dependent on the reactions of the cells of innate immunity. Here also, CD40 signalling is important for the survival and Ig isotype switching of germinal center B-cells [76] [82]. Finally, hypermutated, Ig-class-switched B-cells either become long lived plasma cells and migrate to niches in the bone marrow, or they di erentiate into long-lived memory cells which are quickly reactivated upon re-encounter with the same antigen. 14.

(17) T-cell zone. 2.1 B-Cells: Development and Function plasmablast. short lived plasma cell. Legend TH cell B cell. B-cell zone. germinal center centroblasts. memory cell. centrocyte. plasmablast somatic hypermutation. selection. follicular dendritic cell. long lived plasma cell. improved affinity class. switching. Figure 2.3 { T-cell dependent activation of B-cells in the spleen after antigen exposure.. 2.1.4 Growth Factors and Stimulants for B-Cells. For the di erent maturation stages and subsets of B-cells, many growth factors and survival factors are known. The main growth factor for preB-cells is interleukin 7 (IL-7). In IL-7 KO mice, B-cell development in the bone marrow is blocked precisely at the transition between pro-B-cells and pre-B-cells [137]. Vice versa, overexpression of IL-7 under the control of the MHCII promoter results in the expansion of the early immature B-cell compartment [37]. IL-3 has been shown to be able to replace IL-7 in the cultivation of fetal preB-cell lines, but in contrast to IL-7, it also induces di erentiation of hematopoietic precursors to myeloid cell fates in mixed bone marrow cultures [139]. Some of the main growth factors for mature B-cells are IL-2, the TH 2-cytokines IL-3, IL-4, IL-5, and IL6. IL-2 is known to promote proliferation and di erentiation of stimulated B-cells [140]. IL-3 can enhance growth of normal human B-cells and of human follicular B-cell lymphoma cell lines [20]. Human tonsillar B-cells activated with Staphylococcus aureus have a higher proliferation rate if IL-3 is present. IL-3 acts synergistically with IL-2, which promotes proliferation and di erentiation of stimulated Bcells [140]. IL-3 also cooperates with IL6 in inducing di erentiation and Ig secretion in human B-cells and -lines [128]. IL-4 prevents the death of naive B lymphocytes through the up-regulation of antiapoptotic proteins [30]. Furthermore, in B-cells activated by CD40- or BCR-engagement, IL-4 (together with IL-21) enhanced proliferation of puri ed mouse B-cells. On the other hand, IL-4 and IL-21 inhibited the proliferative response to LPS or CpG DNA [64]. IL-4 also induces AID-expression and therefore plays a role during class switching [71]. IL-5 promotes B1 cell growth and di erentiation. In consequence, IL-5R = mice have less than 30% of peritoneal B1 cells compared to wild type littermates. In contrast, cell numbers in spleen and lymph nodes are unaltered in these mice, as well as the B2 compartment sizes [56] [129]. In addition, IL-5 is needed for responses of B1 B-cells to stimulation with IL-4 and CD40. In contrast, B2 cells mainly rely on IL-4 in combination with CD40-stimulation [66] [34]. IL6 is a known growth factor for plasmacytomas and hybridomas, and can induce maturation to plasma cells [78]. Furthermore, it has been shown to allow survival of murine bone marrow-derived plasma cells in vitro [16]. Corinne Bouquet, MPI for Infection Biology, Chariteplatz 1, 10117 Berlin, Germany: PhD Thesis, March 23, 2012. 15.

(18) 2 Introduction 2.1.5. In vitro. Culture of B-Cells. cultivation of B-cells is a helpful tool to examine their properties and functions. So far, the only murine B-cell stage which can easily be cultured by continuous proliferation in vitro is the pre-BI-cell stage. Fetal liver pre-BI cells can be grown for several months if supplemented with bone marrow stromal cells and the cytokine IL-7 [112]. The pre-BI cells keep their phenotype of surface markers and proliferate long-term, i.e. for hundreds of divisions. In contrast to the fetal liver pre-BI cells, bone marrow pre-BI cells cultured in the presence of stromal feeder layer cells and IL-7 only grow for approximately 30 days before they die (personal communication, F. Melchers). Other di erentiation stages of B-cells can only be kept in vitro for some days. Mature naive B-cells for example can be stimulated to proliferate for short periods of time in vitro with IgM molecules coupled to sepharose beads in the presence of cytokines, or with CD40 antibody and IL-4 which simulate the activation signals of T-cells [115]. B-cells with a memory phenotype can be generated in vitro out of human GC cells by the addition of CD40, IL-2 and IL-10, whereas plasma cells can be generated in the presence of IL-2 and IL-10 alone [5]. None of them proliferate long-term. Long-term cultivation, i.e. proliferation, of speci c antibody secreting cells is only possible if activated/proliferating B-cells are fused to hybrid myeloma (hybridoma) cell lines, a technique developed by G. Kohler and C. Milstein in 1975 [70]. In the herein presented work, the cooperating oncogenes Pim1 and Myc were integrated into B-lineage cells with the aim to generate long-term proliferating naive B-cells, memory B-cells, or plasma cells. In vitro. 2.2 Myc and Pim1. Around 20 years ago, a number of experiments was conducted to nd new genes involved in tumorigenesis. Myc and Pim1 loci were found to be involved very often in retroviral insertion of the Moloney Murine Leukemia Virus (MoMuLV). Moreover, the 2 proto-oncogenes were shown to cooperate in the generation of T-cell lymphomas [2] [133] [134]. 2.2.1 Structure of Myc. The carboxyterminal end of the Myc protein contains a basic-helix-loop-helix-leucine zipper (b-HLH-LZ) domain ( gure 2.4). This region is required for dimerization with other members of the b-HLH-LZ family. In the case of Myc, it is Max, another b-HLH-LZ family member [13]. The Myc/Max heterodimers can then bind DNA by recognizing the so called E-Box sequence CACGTG [12]. Dimerization of the Mycpartner Max with the HLH-LZ family member Mad and family members thereof results in transcriptional repression which antagonizes the trancriptional and transforming activities of Myc [7]. zip. HLH. MB II. MB I. TAD. basic. exon 3. P. NLS. exon 2. ATG. MB III. exon 1. Figure 2.4 { Structure of Myc. bHLH: basic helix-loop-helix; zip: leucine zipper; NLS: nuclear localisation signal; MB I-III: conserved Myc Boxes; TAD: transactivation domain; P: one of the phosphorylation sites.. Myc contains 3 so called Myc homology boxes (MB I-III), which are highly conserved within the Myc family members and also within Myc proteins of di erent species. All of them lie in the N-terminal part of the protein. The rst box, Myc homology box I or MB I, contains 2 phosphorylation sites (Thr and 16.

(19) 2.2 Myc and Pim1 Ser), which are important for the stability of Myc. MB II is important for the transforming activity of Myc, but also seems to be involved in transcriptional repression of genes [79], [107]. Both Myc boxes carry also independent signals for protein degradation [38]. The Myc boxes therefore also play an important role in regulating the levels of the Myc protein. MB III plays a role in transcriptional repression of Myc and has recently been found to negatively regulate the pro-apoptotic function of Myc [54]. Myc exists in two major protein forms, which are generated by di erential translational initiation. The short form, Myc2, is initiated at a canonical ATG in exon 2, whereas the long form, Myc1, is derived from an alternative non-AUG codon near the 3' end of exon 1 [47]. In humans and mice, this is a CTG codon 15 codons upstream of the ATG codon. There are no apparent di erences between these two proteins in subcellular localization, stability, or post-translational modi cations [46]. In growing cells, Myc1 protein has been shown to be only 10-15% of the level of Myc2 protein levels [48]. Upon methionine deprivation as occurring during nutrient deprivation, Myc1 synthesis is increased 5-10x, whereas synthesis of the AUG-initiated Myc2 is minimally a ected [48]. The increase in Myc1-expression is not observable in cells subjected to stress factors (hypertonic treatment, heat shock, serum deprivation, growth inhibition by the lack of essential amino acids other than methionine). The small N-terminal tail of the larger Myc1 seems to o er an additional DNA-binding domain, which can speci cally activate transcription of the C/EBP sequences within the EFII enhancer element of the Rous sarcoma virus LTR. Overexpression of murine Myc1 protein in COS cells by replacing the alternative start codon to ATG results in reduced proliferation of cells compared to overexpression of the short Myc form by destroying the alternative start codon [45]. 2.2.2 Regulation of Myc. Myc is highly regulated at transcriptional, post-transcriptional, and post-translational levels [124] [138] [114] [121]. In general, Myc is expressed in proliferating cells and is downregulated in quiescent and di erentiated cells. After serum- or mitogen stimulation of quiescent cells, Myc levels peak within several hours and subsequently drop to a basal level which is dependent on the presence of growth factors [136]. 2.2.3 Function of Myc. A null Myc mutation causes lethality before day 10.5 of gestation in homozygotes and reduces fertility in heterozygous female mice. [28] Myc has a wide range of activities in cells coupled to proliferation. During B lymphocyte development, Myc enhances protein synthesis and cell size [62]. This increase in cell size occurs independently of cell cycle phase. Myc can provoke proliferation, but at the same time induces apoptosis. For example, Myc induces suppression of bcl-XL and bcl-2 in hematopoietic cells [33]. This suppression works indirectly, since de novo protein synthesis is required. Vice versa, coexpression of the anti-apoptotic BCL2 protein accelerates Myc induced lymphomagenesis [127]. In addition to block survival proteins such as BCL2, Myc activates the ARF-Mdm2-p53 tumour suppressor pathway, which is frequently disabled in human cancers [123]. Inhibition of p53 prevents Myc-induced apoptosis [63]. Taken together, these lines of evidence propose that the most important mechanism of cooperation with Myc in tumour formation is suppression of apoptosis. However, even ARFnull E-Myc mice whose B-cells show decreased apoptotic rates, only develop clonal tumours [33]. Hence, it is likely that additional transformation events are necessary to develop tumours. In normal hematopoietic cells, apoptosis induced by Myc can be suppressed by cytokines, but if Myc is expressed at high levels, it overrides the protective e ects of these survival factors [101]. Corinne Bouquet, MPI for Infection Biology, Chariteplatz 1, 10117 Berlin, Germany: PhD Thesis, March 23, 2012. 17.

(20) 2 Introduction 2.2.4 Myc and Cancer. Myc by itself is most often not sucient to transform cells. E-Myc mice develop B-cell tumours with a mean latency of 12-16 weeks of age, suggesting that deregulation of at least one more proto-oncogene is necessary for full transformation [134]. Before the development of tumours, B-cell progenitors appear relatively normal, but the early B-cell compartment is expanded and shows increased apoptosis [75]. Burkitt's lymphoma (BL) is associated with translocations and, hence, deregulation, of the Myc gene almost by de nition. In BL, Myc overexpression leads to a centroblast-like phenotype of the B-cells including upregulation of bcl-6 and expression of the human GC marker CD77 [118]. Deregulated Myc cooperates with BCL-Xl to cause plasma cell neoplasms in mice [19]. 2.2.5 Myc and B-Cell Development. Transcription of Myc is upregulated in immature B-lymphocytes upon IL-7 signalling [98], and in mature B lymphocytes by growth factors such as LPS. Within 1-3 hours of stimulation, Myc RNA levels increase 10-40 fold and decline thereafter and during subsequent proliferative cell cycles of activated B-cells to very low levels [68]. In human tonsils, Myc is predominantly expressed in IgD , CD38+, CD77 centroblasts [87]. Myc expression is also regulated by CD40 signalling in B-cells [117]. Myc transcription is repressed by BLIMP1 during nal maturation to plasma cells [83]. This repression is necessary for terminal di erentiation, but not sucient [81]. 2.2.6 The Pim Kinase Family. The Pim family comprises 3 Ser/Thr kinases, Pim1, Pim2 and Pim3, with high degrees of sequence- and structural similarities which are well conserved in vertebrates [93]. Pim1 and Pim2 are both known targets of proviral integration which is associated with a rapid development of T-cell lymphomas [133] [25]. 2.2.7 Structure and Function of Pim1. The Pim1 gene comprises around 5 kb and contains six exons. It encodes two related proteins of 34 kD and 44 kD due to the use of alternative initiation sites at AUG and CUG [116]. The catalytic domain lies in the central part of the protein starting encompassing the amino acids 38-290 of totally 313 amino acids in mouse and human. The lysine at position 67 is crucial for kinase activity, and replacement of lysine 67 by methionine results in a kinase dead Pim1 mutant. Pim1 is highly expressed in thymus, spleen, bone marrow and fetal liver, and also in some non-hematopoietic tissues such as prostate and hippocampus [31]. Pim1 protein is found in both cytoplasm and nucleus. Pim1 is also regulated at the post-transcriptional level. Its 5'UTR (untranslated region) contains a GC rich region which inhibits translation. Eukaryotic translation initiation factor 4E (eIF-4E) can relieve this translational inhibition [61]. The half life of Pim1 protein in human leukemic cells is around 1.7 hours [122]. 2.2.8 Pim1 in B-Cells. Expression of Pim1 is associated with the survival and proliferation of hematopoietic cells. Pim1 has been found to co-localise with the pro-apoptotic protein BAD resulting in a phosphorylation of BAD on serine 112, which is a gatekeeper site for BAD inactivation. This suggests a direct role of Pim1 in preventing cell death, since the inactivation of Bad can enhance BCL-2 activity and thereby promotes cell survival [1]. 18.

(21) 2.3 Thesis Objectives In addition, Pim1 binds and phosphorylates the phosphatase Cdc25A, which is a positive G1-speci c cell cycle regulator [95]. Furthermore, Pim1 also phosphorylates Cdc25-associated Kinase 1 (C-TAK1) and thereby inhibits its activity, which suggests a activating role of Pim1 at the G2/M transition of the cell cycle [8]. Mice de cient for all three Pim kinases are viable and fertile, but have a reduced body size throughout life. Furthermore, the in vitro response of distinct hematopoietic cell populations to growth factors such as IL-3 or IL-7 is impaired, e.g. proliferation of peripheral T lymphocytes upon stimulation and IL-7-mediated proliferation of late pre-B-cells [93]. LPS- and CD40-signalling in B-cells upregulate the expression of the Pim1 kinase via the NFB pathway and increase kinase activity [141]. Pim1 expression is induced by a variety of cytokines, growth factors and mitogens including IL-2, IL-3, IL-6 and IL-7 [27] [9]. 2.2.9 Pim and Tumours - Pim-p my Myc!. Pim1 by itself is a weak oncogene, but as indicated above cooperates with Myc to cause preB-cell lymphomas [134] and T-cell lymphomas. Zippo et al. have recently shown that Pim1 interacts with the Myc BoxII domain and mediates phosphorylation of histone H3 at serine 10 of Myc target genes, which contributes to the activation of a subset of Myc target genes [143]. Moreover, grafting Pim1 onto the N-terminus of Myc bypasses the requirement for Myc-BoxII in cellular transformation. Though, binding of Pim1 cannot be the only function of MycBoxII, since among others, TRRAP (transformation/transcription domain-associated protein) also binds to a di erent part of the MycBoxII. This protein is a core component of several histone acetylase complexes [89]. So, Pim1-dependent phosphorylation of Myc-target genes is possibly the second mechanism in Myc-induced transformation together with its role in inhibition of Myc induced apoptosis. Pim1 and Pim2 are also required for ecient transformation of pre-B-cells by the V-ABL oncogene [18]. E-Pim1 -transgenic mice often develop T-cell tumours with a mean latency period of 7-8 weeks [133]. These tumours often have deregulated Myc expression patterns. 2.3 Thesis Objectives. This project was aimed at examining the e ect of the proto-oncogenes Pim1 and Myc to cell cycle entry, proliferation, and sustained survival in murine B-lymphocytes at di erent stages of B-cell maturation; i.e. in preB-cells, immature IgM+ cells, mature naive B-cells, and activated B-cells such as germinal center B-cells and plasma cell precursors.. Corinne Bouquet, MPI for Infection Biology, Chariteplatz 1, 10117 Berlin, Germany: PhD Thesis, March 23, 2012. 19.

(22) 3 Materials 3. Materials. 3.1 Machines Cell culture. CO2 incubator for cell culture Laminar ow hood H2O-distillery N2 tank Inverse microscopes. MACS multistand Mini-MACS magnet Midi-MACS magnet. Binder CB210 Haereus Destamat Bi-Distiller Bi 18E, GCS Arpege 170, Air Liquide Nicon Eclipse TS100, Leica DMIL with Leica DFL 300 FX camera Gamma Cell 40, MDS Nordion LSRII, BD Dickinson, 405 nm violet laser ( lters: A: 630LP, 655/8; B: 595LP, 605/12; C: 575LP, 585/15; D: 545LP, 560/20; E: 475LP, 525/50; F: 450/50; G,H: empty); 355 nm UV laser ( lters: A: 505LP, 530/30; B: 450/50, C: empty), 633 nm red laser ( lters: A: 755 LP, 780/60; B: 710LP, 730/45; C: 660/20) and 488 nm blue laser ( lters: A: 755LP, 780/60; B: 685LP, 695/40; C: 655LP, 660/20; D: 600LP, 610/20; E: 550LP, 575/26; F: 505LP, 530/30; G: SSC, H: empty) Miltenyi Miltenyi Miltenyi. Electrophoresis chamber (SDS page) Blotter for SDS page gels Power supply for gel electrophoresis Gel analyzer (Agarose Gels) Luminescent image analyzer. Mini-Protean 3 Electrophoresis Module, Biorad Trans-Blot SD Semi Dry transfer cell, Biorad Power Pac Basic, Biorad Gel Doc 2000, Biorad LAS 3000, Fuji lm. Real time PCR machine Thermal cycler Tube heating block DNA-electroporator Bio-Photometer Tabletop centrifuges. 7900 HT sequence detection system, ABI Prism DNA Engine PTC 200, Biorad Thermomixer comfort, Eppendorf Gene Pulser X-cell total system, Biorad Eppendorf Eppendorf 5417R, Eppendorf 5810R. Gamma irradiator FACS analyser. Electrophoresis & Visualisation. PCR, molecular Biology. 3.2 Software. FACS acquisition & analysis FACS analysis Design of illustrations Processing of photos Real-time PCR acquisition Scienti c graphics 20. Diva 6.1, BD Biosciences Flow Jo, Tree Star, Inc. Adobe Illustrator CS3 Adobe Photoshop CS3 SDS v2.0, ABI Prism Prism 5.0, Graphpad software.

(23) 3.4 Labware 3.3 Kits. Gel extraction kit Midiprep kit endo-free for extraction of plasmid DNA Miniprep kit for extraction of plasmid DNA Superscript III rst strand synthesis system Topo-TA cloning kit QuantiTect SYBR Green RT-PCR Kit. Qiagen Qiagen Qiagen, Zymo Research Invitrogen Invitrogen Qiagen. 3.4 Labware product. cell culture asks 25 cm2 lter cap (T25) cell culture asks 75 cm2 lter cap (T75) cell culture plates 15 cm diam. cell culture plates cell culture plates cell culture pipettes cell strainer conical tube 0.5-2 ml conical tube 15 & 50 ml dialysis tubing Electroporation cuvettes bottletop lters 250 - 1000 ml MACS LD columns MACS MS columns + plungers Needles 30G (0.3x13mm) Needles 18G (1.2x40mm) Needles 26G (0.45x12mm) Nitrocellulose membrane PCR 8-well stripe + caps Polypropylene tubes 5 ml PVDF membrane plastic eppendorf tube crushers Pre-separation lters Syringe 1 ml Syringe 1 ml 96-well plates for ELISA 96-well plates for RT-PCR 250 ml-1 l storage bottle 250 ml-1 l storage bottle. description. Nunclon surface. manufacturer. Nunc TPP. Nunclon surface 6 - 96-well 6-well, Cell-Bind surface (for transfection) pyrogen free 40 , nylon Corning (20/30), wall thickness 0.05 mm. Nunc Corning Corning Corning and Sarstedt BD Falcon Eppendorf. Visking Biorad Express-Plus Steritop Millipore for cell depletion Miltenyi for cell enrichment Miltenyi Microlance 3 BD Sterican hypodermic needle, BC/SB B. Braun Melsungen AG Sterican disposable insulin needle, B. Braun, Melsungen AG BL/LB Nybond ECL 0.2 Amersham Biosciences Biozym round bottom, for FACS analysis BD Falcon f. Western blot, Immobilon 0.45 Millipore Eppendorf for MACS, 30 m Miltenyi Biotech Injekt-F, tuberculin, with plastic stop- B.Braun, Melsungen AG per Omni x, tuberculin, with rubber stop- B. Braun, Melsungen AG per Immuno-Maxisorp U-bottom Nunc Biozym Stericup Millipore Corning. Corinne Bouquet, MPI for Infection Biology, Chariteplatz 1, 10117 Berlin, Germany: PhD Thesis, March 23, 2012. 21.

(24) 3 Materials 3.5 Antibodies for FACS Analysis molecule dye. CD4 CD5 CD8a CD19 CD21 CD23 CD25 CD43 CD93 CD95 CD138 c-kit c-kit GL-7 IgD IgM IgM kappa. PE FITC FITC PerCP-Cy5.5 FITC PE PeCy7 FITC PE PE PE APC APC FITC PE APC FITC APC. company. eBioscience eBioscience eBioscience eBioscience eBioscience eBioscience eBioscience eBioscience eBioscience BD Pharmingen BD Pharmingen eBioscience in-house BD Pharmingen eBioscience eBioscience in-house in-house. clone name. Gk1.5 53-7.3 53-6.7 eBio1D3 eBio8D9 B3B4 eBio3C7 eBioR2/60 aa4.1 [88] Jo2 281-2 ACK 2 ACK4 GL-7 11-26 II41 M41 (C3 speci c) [77] 187-1. isotype. Rat IgG2b Rat IgG2a Rat IgG2a Rat IgG2a Rat IgG2a Rat IgG2a Rat IgG2b Rat IgM Rat IgG2b Armenian hamster IgG2 Rat IgG2a Rat IgG2a Rat IgG2a Rat IgG1. 3.6 Antibodies for ELISA molecule. goat anti-mouse IgM goat anti-mouse total IgG goat anti-mouse IgG2b goat anti-mouse IgG2c goat anti-mouse IgG3 goat anti-mouse IgA mouse IgA (Standard) mouse IgG (Standard) mouse IgG (Standard) mouse gM (Standard) mouse anti-KLH (TNP-KLH). dye. - and AP - and AP AP AP AP - and AP -. company. AbD Serotec Southern Biotech Southern Biotech Southern Biotech Southern Biotech Southern Biotech Southern Biotech Southern Biotech homemade Chemicon Int. BD Pharmingen. clone name isotype. polycl. polycl. polycl. polycl. polycl. polycl. S107 polycl. UCHT-1 polycl. A112-3. IgG1 IgG3, . 3.7 Antibodies for Western Blotting molecule. mouse anti-c-Myc rabbit anti-mouse Hdac1 goat-anti Pim-1 (m,h,rat) rabbit anti-goat IgG (H&L) goat anti-mouse IgG (H&L) goat anti-rabbit IgG (H&L) 22. dye. HRP HRP HRP. company. Santa Cruz eBioscience Santa Cruz Pierce Pierce Pierce. clone/isotype. 9E10, IgG1 polycl., IgG polycl., IgG polycl. polycl. polycl.. immunogen, expected size. AA408-439 of hc-Myc, 64, 67kD hHDAC1, c-terminal part, 60kD hPim1, interal part, 33kD.

(25) 3.10 Tissue Culture Media and Addititves 3.8 DNA Primers. m068 Linker for pSuperRetroPuro-fo, contains the restriction endonuclease sites EcoRI, HpaI, AvrII, XhoI, NruI, A III, HindII, ClaI and MluI m074 Linker for pSuperRetroPuro-re m069 pgk promoter + PuroR MluI-fo m070 pgk promoter + PuroR MluI-re m073 Sequencing primer for linker m095 histidinol resistance gene-re (BamHI) m099 pim1 BglII-fo m100 pim1 HindIII-re m101 myc HindIII-re m102 myc, BamHI-fo m122 egfp, BamHI+NcoI-fo m123 egfp, HindIII-re m136 pgk promoter-fo (XhoI) m137 pgk promoter-re (EcoRI) m147 histidinol resistance gene-fo m167 RT-PCR primer myc -fo m168 RT-PCR primer myc -re m169 RT-PCR primer pim1 -fo m170 RT-PCR primer pim1 -re m179 RT-PCR primer pim1 neu-B-fo m180 RT-PCR primer pim1 neu-B-re m181 RT-PCR primer gapdh -fo m182 RT-PCR primer gapdh. cgacgcgttaacatcgattcgcgaattctcgagcctagg tcgacctaggctcgagaattcgcgaatcgatgttaacgcgt cgcacgcgtaattctaccgggtaggggagg cgcacgcgttcgtgcgctcctttcggtcg catcgattcgcgaattctcgagc cgggatcctcatgcttgctccttgaggg gaagatctatgctcctgtccaagatcaactccctg gaccaagctttatttgcccttctacttgctggatcc gagcgaagctttatttccttacgcacaagagttccgtag cgggatccatgcccctcaacgttagcttcaccaac ctgggatccatggtgagcaagggcgagga gaagcttgcttacttgtacagctcgtccatgc cactcgaggcgttcgcaattctaccgggtagg gagaattctagcttgggctgcaggtcgaaag catcatgagcttcaataccctgattgac atgcccctcaacgttagcttc cgcaacataggatggagagca ctggagtcgcagtaccagg cagttctccccaatcggaaatc gagaacatcttaatcgacctgagc ggtagcgatggtagcgaatc catgttccagtatgactccactc gtagactccacgacatactcagc. fo=forward/5', re=reverse/3' primer 3.9 Enzymes. Restriction endonucleases Recombinant Taq polymerase RNAse-A, DNAse free Platinum Taq polymerase CIAP (calf intestinal phosphatase) T4-DNA ligase. New England Biolabs (NEB), Fermentas Fermentas Qiagen Fermentas Roche NEB. 3.10 Tissue Culture Media and Addititves Media. D-MEM + Glutamax I + 4.5g/lt glucose - Gibco/Invitrogen pyruvate Corinne Bouquet, MPI for Infection Biology, Chariteplatz 1, 10117 Berlin, Germany: PhD Thesis, March 23, 2012. 23.

(26) 3 Materials IMDM powder with L-Glutamine w/o Gibco/Invitrogen 42200-030 NaHCO3 MEM alpha powder Gibco/Invitrogen Opti-MEM Gibco/Invitrogen PBS w/o Ca, Mg PAA Laboratories RPMI-1640 medium + L-glutamine Gibco/Invitrogen Additives. L-glutamine 200mM (100x) Insulin from bovine pancreas MEM non-essential amino acids 100x, 100 ml 2-mercapto-ethanol Primatone 5% Trypsin-EDTA. Gibco/Invitrogen Sigma-Aldrich I5500 Gibco/Invitrogen Fluka/Sigma-Aldrich RL-Quest International www.sheeld-products.com Gibco/Invitrogen. Kanamycin-sulfate solution 100x, 100ml Penicillin-Streptomycin solution 100x, 100 ml L(-) Histidinol dihydrochloride 99% Hygromycin Puromycin. Gibco/Invitrogen Gibco/Invitrogen Sigma Aldrich Roche, Mannheim; Carl Roth GmbH Calbiochem, Beeston. BAFF, murine, recombinant Interleukin-21, murine, recombinant TPO. R&D Systems R&D Systems Peprotech, stocks of 10 g/ml in PBS. Antibiotics. Interleukins. 3.11 Chemicals. Ampicillin sodium salt APS CFSE / 5(6)-Carboxy uorescein diacetate, N-succinimidyl ester Chloroform / NH4Cl CNBr-activated sepharose 4B, lyophilized, average bead size 90 m DAPI Diethanolamine DMSO Hybri Max Doxycycline hyclate EDTA disodium salt 2 H2 O Ethidium bromide solution 0.5% Ethanol Glycerol Glycine electrophoresis grade HCl HEPES 1M H2O, RNAse free, DNAse free Isopropanol 24. Sigma-Aldrich Carl Roth GmbH Alexis Biochemicals Carl Roth GmbH GE Healthcare Carl Roth GmbH Merck Sigma-Aldrich Sigma-Aldrich Carl Roth GmbH Carl Roth GmbH Carl Roth GmbH Sigma Carl Roth GmbH Merck Sigma-Aldrich Gibco/Invitrogen Acros Organics. 5X59057.

(27) 3.13 Bu ers and Solutions KCl KHCO3 KLH, highly soluble, low endotoxin Methanol MgCl2 6 H2O Na-acetate NaCl NaHCO3 NaOH Propidium iodide HPLC RedSafe nucleic acid staining solution 20'000x SDS solution ultra Temed Tris Pu eran Tween20. Carl Roth GmbH Carl Roth GmbH Alexis Biochemicals Carl Roth GmbH Carl Roth GmbH Carl Roth GmbH Fluka/Sigma-Aldrich Fluka/Sigma-Aldrich Fluka/Sigma-Aldrich Sigma-Aldrich INtRON Biotech Fluka/Sigma-Aldrich Carl Roth GmbH Carl Roth GmbH Sigma-Aldrich. 3.12 Molecular- and Cell-Biology Reagents. Bradford solution BSA, fatty acid free, low endotoxin, for cell culture BSA fraction V, for western blotting, ELISA, etc. BSA Standard 2 mg/ml for bradford measurements DNA ladder (Gene Ruler 1kb plus) dNTP set 4x100 M dnpp tablets for 20 ml solution per tablet Lipofectamine MACS -mouse CD19 beads Ripa bu er Protease inhibitor cocktail 40x, contains 4-(2aminoethyl)benzenesulfonyl uoride (AEBSF), E-64, bestatin, leupeptin, aprotinin, and sodium EDTA Protein marker for western blot (Precision Plus Dual Color) Protogel Skinman Soft disinfectant TiterMax gold adjuvant Trizol Western Lightning chemiluminescence reagent plus. Biorad Sigma Serva Biorad Fermentas Fermentas Sigma Invitrogen Miltenyi Sigma Sigma, P2714 Biorad Biorad Ecolab Germany Sigma-Aldrich Invitrogen Perkin Elmer. 3.13 Bu ers and Solutions Designation. Ampicillin stock solution APS stock solution Doxycycline stock solution Erythrocyte lysis bu er. Recipe, Storage. 100 mg/ml in water, -20 C 10% APS in water, 4 C 1 mg/ml doxycycline hyclate in H2O, sterile ltered. -20 C. 0.01M KHCO3, 0.155M NH4Cl, 0.1 mM EDTA, sterile ltered, RT. Corinne Bouquet, MPI for Infection Biology, Chariteplatz 1, 10117 Berlin, Germany: PhD Thesis, March 23, 2012. 25.

(28) 3 Materials FACS Bu er Laemmli bu er LB-Medium PBS TBS. 2% heat-inactivated FCS in PBS, 4 C 250 mM Tris-Cl pH 6.8, 40% v/v glycerol, 5% p/v SDS, 0.005% bromophenol blue, 10% -mercapto ethanol, -20 C done by the media kitchen sta of the MPI-IB (10g Bactotryptone,5g yeast extract, 10g NaCl per liter, pH 7.5, autoclaved. Storage at 4 C) done by the media kitchen sta of the MPI-IB, RT 6.05 g Tris, 8.76 g NaCl, distilled water ad 1000 ml, RT. 3.14 Plasmid Vectors Designation. pTre-Tight pSuperRetroPuro w/o Stu er pCR4-TOPO pim1 -CS41. manufacturer. BD Biosciences OligoEngine Invitrogen in pSP65 vector (for in vitro transcription, contains murine pim-1, generates messages for 34 & 44 kD, kind gift of Anton Berns, Netherlands Cancer Institute pBJ4-cmyc chimera of human and murine c-myc-2 in pBJ4!, kind gift of Ulf Rapp pSRL5P Vpmut IRES nsEGFP contains the IRES sequence and a non-sticky variant of egfp, kindly provided by Ozan Guezelbey 3.15 Bacteria. Top10 electrocompetent E. coli. F- mcrA (mrr-hsdRMS-mcrBC) 80lacZM15lacX74 recA1 araD139 (ara-leu) 7697 galU galK rpsL (StrR ) endA1 nupG -. 3.16 Cell Lines name description Fetal liver preBI-cell lines. Fld18Ber3. fetal liver preBI cell line, made in Berlin at the MPI for Infection Biology by Szandor Simmons in our Lab from a fetal liver of a C57Bl/6 mouse embryo at day 18 of gestation Fld18Ber3-rtta1 pim/myc fetal liver preBI cell pool carrying the rtTA-TetON vector and the TetON-myc & TetON-pim1 vectors (non-clonal) Fld18Ber3-rtta1 myc fetal liver preBI cell pool carrying the rtTA-TetON vector and the TetON-myc vector (non-clonal) Fld18Ber3-rtta1 pim1 fetal liver preBI cell pool carrying the rtTA-TetON vector and the TetON-pim1 vector (non-clonal) Makn fetal liver preBI cell line, made in Berlin at the MPI for Infection Biology by Marko Knoll 26.

(29) 3.17 Mouse Strains Makn rtTA myc Stromal cell lines. OP9 ST2. Packaging cell lines. Phoenix-eco Plat-E. Cytokine producers. CHO-SCF. J-558L-IL-7 SP2/0-Flt3L X-63-IL-2 X-63-IL-3 X63-IL-4 X-63-IL-5 X-63-IL-6 B cell lines. Daudi. Makn cell line carrying the rtTA-TetON vector and the TetON-myc vector stromal cells established from the bone marrow of newborn B6C3F1 op/op mouse calvaria (which lacks M-CSF) a stromal cell line established from murine fetal liver [51] ecotropic retroviral packaging cell line based on the Hek-293 cell line ecotropic retrovirus packaging cell line named Platinum-E (Plat-E) based on the 293T cell line. This cell line contains the MoMulv gagpol and env coding sequences under the control of the strong EF1-alpha promoter. The promoter also drives resistance genes for puromycin and blasticidin, which are attached to the gag-pol and env coding regions by an IRES (internal ribosomal entry site) [97] SCF producer cell line [144], kind gift of T. Feyerabend, University of Ulm IL-7 producer cell line [139] Flt3L producer cell line, kind gift of P. Vieira, Institute Pasteur [29] IL-2 producer cell line [67] IL-3 producer cell line [67] IL-4 producer cell line [67] IL-5 producer cell line [67] IL-6 producer cell line [67] human Burkitt's Lymphoma cell line. 3.17 Mouse Strains strain. C57Bl/6*J* C57Bl/6*J* rag1 = Jax C57Bl/6*N* rag2 = C57Bl/6*J* rag1 = Ly5.1. Ly5 allele remarks. Ly5.2 Ly5.2 Ly5.2 Ly5.1. Taconic Jax, bad breeders, low viability. Mice were bred under speci c pathogen free conditions in IVC (individually ventilated) cages in the animal facilities of the Max Planck Institute in Marienfelde and at the MPI for Infection Biology. For transplantation experiments, mice aged from 6 to 10 weeks were used. Experimental setups done in this work were approved by the LAGeSo (Landesamt fur Gesundheit und Soziales), Berlin, approval number G0099/08, \Beein ussung der Blutzelldi erenzierung der Maus durch Regulatoren und Modulatoren der Gen-Expression und der Signaltransduktion in Vorlauferzellen des hamatopoietischen Zellsystems; Zusatz: Corinne Bouquet, MPI for Infection Biology, Chariteplatz 1, 10117 Berlin, Germany: PhD Thesis, March 23, 2012 27.

(30) 3 Materials Immunisierung der mit pra-B- und T-Zellen transplantierten Mause mit dem Protein-Antigen Keyhole Limpet Hemocyanin (=KLH) zur Messung der Funktionsfahigkeit der adaptiven Immunreaktion der in den Empfangermausen rekonstituierten gereiften B- und T- Zellen".. 28.

(31) 4. Methods. 4.1 Molecular Biology 4.1.1 Cultivation of E.. coli. Bacteria were cultivated in LB medium containing the appropriate antibiotic for selection of plasmids, usually 100 g/ml ampicillin. Bacteria carrying high-copy plasmids were grown for 12-16 hours in 2 ml LB-medium for minipreps and 100 ml LB medium for midipreps. 4.1.2 Preparation of Electrocompetent Bacteria. Top10 bacteria picked with a stick from frozen stocks were grown over night in a 37 C shaker in a volume of 100 ml of LB broth without antibiotics. The next day, 25 ml of the resulting broth was resuspended per 500 ml of LB broth without antibotics in 2 liter Erlenmeyer asks and shaken for 2-4 hours until the OD600 reached 0.6-0.8. The bacteria were cooled down on ice for 20 minutes and then centrifuged at 2600 g in a tabletop centrifuge in 400 ml asks for 20 minutes at 4 C. From this step on, bacteria were kept on ice, and handling was done in a cold room (7 C). All solutions in contact with the bacteria were sterile ltered and cooled to 4 C on ice before use. All quantities mentioned are calculated for 1 liter of starting culture and have to be adjusted accordingly. Pelleted cells were resuspended slowly in 600 ml ice-cold 0.1 M HEPES. Then, the cells were centrifuged for 15 minutes at 2600 g at 4 C, and the resulting pellet was resuspended in 400 ml 0.1 M HEPES. Once again, the cell suspension was centrifuged at 2600 g at 4 C, and the pellet was resuspended in 20 ml 0.1 M HEPES supplemented with 10% glycerol. The solution was pelleted a last time and resuspended in 3 ml 0.1 M HEPES supplemented with 10% glycerol and portioned at 200 l per precooled 0.2 ml conical tubes. The cells were shock-frosted in dry ice and kept at -80 C. 4.1.3 Electroporation of Bacteria. 40 l of electrocompetent Top10 bacteria were thawed on ice and put into ice-cold 1 mm electroporation cuvettes. 1 l of ligation product or maximally 100 ng of plasmid DNA was added and incubated on ice for 5 minutes before electroporation. Bacteria were electroporated with 1800 V, 25 F arad, and 200 in a 1 mm cuvette. After electroporation, bacteria were resuspended in 600 l of antibiotic-free LB-medium and incubated for 30 minutes in a 37 C shaker to allow expression of the resistance gene, and subsequently plated onto agar plates containing the appropriate antibiotic for selection of plasmid-containing bacteria. Plates were incubated for 12-16 hours at 37 C. 4.1.4 Restriction Endonuclease Digests. Digests were done in a total volume of 30 l using 2 g of DNA and 5U of each enzyme and the recommended bu er from New England Biolabs. Digests were usually incubated over night at the recommended temperature. 4.1.5 DNA Gel Electrophoresis. Digested DNA was separated at 60V in 0.8-1.5% electrophoresis grade agarose dissolved in TBS. Bands were visualized using ethidium bromide or RedSafe in a gel imager. Corinne Bouquet, MPI for Infection Biology, Chariteplatz 1, 10117 Berlin, Germany: PhD Thesis, March 23, 2012. 29.