ONCOLOGY REPORTS 4: 505-510, 1997
Human SAK related to the PLK/polo family of cell cycle kinases shows high mRNA expression in testis
THOMAS KARN1, UWEHOLTR!CH1, GEORG WOLF1, BJÖRNHOCK1, KLAUS STREBHARDT1 and HELGA RÜBSAMEN-WAIGMANN2
1Chemotherapeutisches Forschungsinstitut, Gcorg-Speyer-Haus, Paul-Ehrlich-Str. 42-44, 60596 Frankfurt;
2Bayer AG, Institute of Virology, Aprather Weg, 42096 Wuppertal, Germany
Rcccived January 17, 1997; Accepted Fcbruary 20, 1997
Abstract. We idcntilicd the nucleotidc sequence of a cDNA encoding a polypeptide wilh a kinase domain lhat is related to the catalytic region of Drosophila melanogaster polo, Saccharomyces cerevisiae CDCS as weil as human FNK and PLK. The novel gene seems to represent the human counterpart ol' the mouse gene sak. The sequence of SAK predicts a serine/threoninc kinase of 970 aa. Thc distribution of SAK mRNA in adult organs is rcstricted to certain tissues such as testis and thymus. Northern analyscs of tumor tissucs (Jung, breast, brain) and corresponding normal tissues from the same patient did not rcveal SAK expression. Comparing the mRNA distribulion of thc proliferation-associatcd polo- like kinase (PLK) with the exprcssion of SAK we observcd distinct differenccs. Thus, we suggest that Lhcse kinases have unique physiologicaJ roles in different cclls or in responsc to different signals.
Introduction
Phosphorylation plays a pivotal role in controlling the progression through the eukaryotic cell cyclc, cellular differentiation and changes of cellular structurcs. The Drosophila melanogaster polo genc (l) and the Sacclwro- myces cerevisiae cell cycle gene CDC5 (2) are two conserved protein kinases which are required for progression through mitosis: Mutations in polo rcsult in abnormal chromosome segregation in larval neuroblasts of Drosophila due to defective spindcl fonnation in mitotic and meiotic cells (I ,3).
Deletion of CDC5 was Iethai in Saccharomyces cerevisiae displaying an abnormal morphology of dividing cells with their nuclei almest divided but still eonnected (2). Recently, two human serine/threonine kinascs have been idcntified
Correspondence ro: Dr K. Strebhardt, Chemotherapeutisches Forschungsinstitut, Georg-Speyer-Haus, Paul-Ehrlich-Str. 42-44, 60596 Frankfurt, Germany
Key words: scrine-threonine kinase, signal transduction, cell cycle, tissue specific expression
which are homologous to polo: PLK (4-7) and FNK/PRK (8,9, Holtrich et a/, unpubJished). It could bc demonstrated that PLK mRNA expression is regulated during terminal erythrodil'l'ercntiation and during the cell cycle (4). In our own studies sevcral lines of evidencc indicate that the Ievels of PLK-mRNA and -protein correlated with ccllular proliferation (7,10). In addition we found that the prognosis of patients suffering from non-small ccll Jung cancer (NSCLC) correlates with PLK mRNA expression in lung tumor tissues. Thus, the determination of PLK mRNA expression helps to dcfine subgroups of patients in clinical stages I and 11, who have a bad prognosis bccause of an aggressivcly growing tumor (II).
Recent observations support the ccntral roJe of PLK- reJated kinascs for tbe control of mitosis: A serinelthreonine kinase, namcd Plxl, was isolatcd from Xenopus cgg extracts, which exhibits close homology of 80% to human PLK, indicating that it represents its Xenopus counterpart.
Recombinanl PJxl phosphorylated Cdc25 and stirnulatcd its activity in a purified system, suggesting that Plx 1 controls Cdc2, the cyclin dcpendent kinasc that triggers mitosis, by regulating the activity of Cdc25 (I 2).
FNKIPRK expression is limited to ccrtain tissues such as placenta, ovades and lung (9). Re-feeding of serum-deprived cell lines of hemopoietic origin activates FNKIPRK mRNA expression. Thc Ievel of FNK/PRK transcripts secms to be downregulated in Jung tun10rs compared to uninvolved lung tissues. Murine fnk was shown to bc an immediate early gene whose expression is lirst detected at 30 min after addition of various growth factors such as FGF and platelet-derived growth factor-BB to quiescent cclls (8).
In a search l'or protein kinases, which play a roJe in human lung cancer, we used a PCR-based approach to amplify kinase-related sequences. Here, we report the cloning and genetic anaJysis of a third human PLK-related gene, which encodes a putative serine/threonine kinase closely relatcd to murine sak (13). Analysis of human SAK expression in adult tissues and primary cells revealed a tissue specific expression restrictcd to thymus and testis.
Materials and methods
RNA iso/ation and Northern blots. Tissues were homo- genized in a guanidinium isothiocyanate solution ( 14). RNA
506 KARN eta/: HUMAN SAK KINASE
was isolmed by centrifugation through a 5.7 M CsCI cushion.
For Northern blot analysis RNA was scparatcd in a denaLuring agarose/fornldldehyde gel and transferred to nitrocellulose membranes (Amersham). Hybridization and washmg were pcrformed under high-stringency conditions (15).
Multiple tissue blots were purchased from Clontech (Palo Alto, CA).
PCR. First strand cDNA synthesis and PCR wcrc pcrformcd as describcd previously ( 16). Primcrs were synthesized using an Applicd Biosystems 380A DNA synthesizu. Primcr sequcnces arc as follows: Eco-VHRDL (motif VHRDL), 5'- lTTGGAA TTCGTNCA YMGNGA YYT-3'; Eco-P62[DEA]
(motif DVWXXGM), 5'-TTGGAATTCATCCCNNNNNNC CACACATC-3'; PI2(T+), 5'-GCAGAATTCGTGAACTGC GGCCGCA(dT) 12-3'; EB 5'-CTGAAlTCGGATCCGACT GGTCTGACTCG-P-CH2-CHOH-CHrNH2; EBcom 5'-CGA GTCAGACCAGTCGGATCCGAA TTCAG-3', K3L2, 5'-TT CAGTCTGAGGTGTCGGGTCTGC-3'; K3L4, 5'-GCTTCA 1TITCTGAGAAGGGTTTCAC-3'; K3U6, 5'-GTCAAAAA GAACTCTGATGCTTCTG-3'.
Labelling of probe.~·. PCR was applied to obtain probes corresponding to aa 365-474 or SAK. RadiolabeHing of the anlisense strand was performcd using primcr K3L2 and 150 j.lCi of
lu-
32P]dCTP (6000 Ci/mmol); I Ci=37 GBq.Construction and Screening of a cDNA library. Total RNA was isolnicd ( 14) from a human Jung tumor (squamous ccll carcinoma). Poly(A)~ RNA was sclcctcd by using oligo(dT)- cellulose ( 17). The construction of thc cDNA library followed thc rncthod of Gubler and Hoffmann (J 8). In summary, a Pharmacia kil was applied for synthesis and purilication of cDNA, which was Iigated to EcoRl-digested i..gt 10 DNA. After padaging with Gigapack II Gold (Stratagcnc) and plating, l.8x I
O(•
indcpendcnt rccombinant clones wcre screened under high stringency conditions (42·c. 50% fonnamide) with the prirnary PCR product as a probe derived from thc catalytic domain of SAK corresponding to aa 142-184.5' and 3' elongation by the RACE technique. Since the Iongest cDNA clone which was obtaincd by screening of the lung tumor cDNA library did not cncompass the entire open reading frame of SAK, a modified RACE (rapid amplification of cDNA ends) tcchnique was applied ( 19,20). For this purpose specitic primers from the 5' region of the SAK-PCR product were utilizcd for cDNA synthesis. The cDNA was subscquently Iigated to a 3' moditied oligonucleotidc (EB) and amplified using primer EB (com) and the SAK spccilic primer K3L4 rcsulting in the extension of 478 bp of upstream scqucnces. Anchorcd PCR was performed to completc the missing 3' portion: a cDNA starting at the poly A-tail was synthcsized with PI 2(T~). Subsequent PCR amplification with thc spccific primer K3U6 located at the 3' end of SAK and primcr P l2(T·) providcd the complete open rcading frame.
Sequencing. Sequcncing of double-stranded DNA was performed by the dideoxy chain termination mcthod with
Taq polymerase using an ABI 373A DNA sequencer according to the protocols of thc manufacturer (Applied Biosystems, Weiterstadt). Cyclc sequcncing on a DNA thennal cycler (Perkin Eimer Cctus) wa-; performed with dye tcnninators.
Results
PCR-based isolation oj a PLK related profein kinase cDNA from human tissues. cDNA from human embryonie tissucs was amplit1ed using primers corresponding to highly conscrvcd amino acid motifs (YHRDL and DYWXXGM) from sub- domains VI and lX within the catalytic domain of protcin kinascs (21) in order 10 identify novel members
or
thc kinasc family and lo cvaluatc their role in cancer dcvclopmcnt'.Resulting PCR products were Iigated to the p131ucscript
KS(~) vc~tor (Stratagene). Sequence determination
or
280 inserts revealed vurious unknown sequences related toprotein kinascs: Specific extension of two unknown kinase related sequcnccs yieldcd the complete open reading frames of the new protein-kinascs PLK (7) and MO I5
(22). Since this approach has bccn shown to provide new kinases which are of importance for Jung tumors such as PLK, a marker for ccllular proliferation with prognostic signilicance for NSCLC- paticnts, wc have chosen an additional clone, namcd K3, reprcsenting a scqucncc related to PLK for further studics. A 200 bp-inscrt dcrived from K3 was used a<; a probe for thc screcning of a cDNA library based on RNA from a human Jung tumor (squamous cell carcinoma). We obtained a clone of 1.3 kb. Thc RACE technique was applied for 5' and 3' elongation of this cDNA in order to obtain the complete opcn reading frame. The analysi1> of the elongated clone revcaled a continuous sequence or 3.1 kb with a complete open reading frame cxhibiting an ATG and stop codon. Using cDNA from normal Jung tissues we verified thc scqucnce of 3.1 kb by PCR-amplification and direct sequencing.ldentification of a human serine/threonine kinase gene related to the mouse gene sak. Determination of the nucleotide scqucnce exhibited a single open rcading rrame of 2910 nt extending from an ATG codon at position 141 to an in-frame stop codon at position 3051, which predicted a 109- kDa polypcptide of 970 aa (Fig. I). The 5' untranslated sequence has a length of 140 bp with a putative start codon which is in agreement with Kozak's rule for the Initiation of translation (23). The 3' untranslated sequence is 39 bp in length containing a potential polyadcnylation signal (AATAAA). The predicted K3-polypcptide contains an aminoterminal kinase domain which shows lhe characteristics of protein scrine/threonine kinases. Interestingly, a Iysine residue lo<.:ated within the motif HRDL.K, whkh is conserved in almest all members ()[ this family, is substitutcd by a thrconine residue (aa 138) in thc putative K3-amino acid sequencc. A computer analytic comparison of thc 970 aa- polypeptidc with other known proteins (Swiss-Prot and the Protein ldentification Rcsource, September 1996) confirmed thc first observation that it belongs to the family of serinc/threonine kinases. In panicular it is homologous to polo-rclatcd kinases: Comparing thc kinase domains of the new protcin to those of human PLK, human FNKIPRK and
ONCOLOGY REPORTS 4: 505-510, 1997
2C 14:>
2.t1J
..
)10
••
~CO
u"
.,.
l60 '.'tO
zrn
•••
2<0nl' :t:..
<ho\CTCM'f"''(U\T~'t'UC'C,I.CM":"''TC':'AC"T'GC':AATT~~A(;'fAT.\AG'l"G(;TA(;T""TJ.,...,.:;~AJ,U.':AAC-_..':'iT"""'T~;..7'J'::.VttkXCA!:~AM':" 1100 D ~ f 0 S C W A T : $ T A I ~ A S $ $ T $ I S G ~ L P u K k ~ L L ! 0 U p L p ~ J:,
MAA.TVACTC7'1.TT'l':CAANJM TAM.Mi'fTC'MC'roA T'lT'l'TC'M'C'M'CAGGAGA:'TOOMACAG'l"'''TT:'ATA<:T<' A~ 'l'l:lOOlMA'tCANJil.AJ.CCAGTAi\TA~::.1u\l:iG;r"AM~AVI'•\ L:!21)
K l>~ T V F P R N k $ ~ T D lf> ~ S S U t) (~ N Joi v y 't" O '·" (i N (,) t: 'I' J,; ~~ s :~ 1\ (: ~ V JIS'
~'M"r.AAGATGC:\GAAGAAAGGC'CAC'-1'TC~ATA:CTT.."GTA>3AGC'M'A'!'T('C'1'C1\:IATi\OATCTGCJC.\C'M'CT.\.~TMTCAI,'i'JIC't\:'MtJ('~CA1'!1.Tf..:A..l\'JV'~.MC<AJ\'I'U't~':A<: 1 ~4D
! 0 U A E ~ k ~ H S K Y L R R k Y $ ~ ~ ~ S G T S N S 0 ~ Q A Y T Y 7 ~ ~ R C H '~
~~C.;'NAAA':"<>C1":"':'CA.~':'<>'\"C'CAAAACAT'CAot~GAC.<;T""~~-AAQA(;A.f',C'tAr-T'e-'CCt:'.t.C~A('"AA("AA '!'(;C('U('.Io.'J"'M"T',~.U.rt"rr'':'TTAAA:"'~AC'A.1'C'!C'It..':'I'At":-1• fJO
:; A E X 1.. S V G X R S ~ G G e N 2 I l Y $ P '! D ~~ ~~ A ~~ I 7' N p p K E K '!' S :: ~ H '
l'C"'t'Gdi'OCTf':":'Gl._!._;GA.tCTG.\TMCM.TCANXACTC'X'CJ:.J..":'CA~~C!.:'!l'i:A~ACC'~~.\4.JCJI,;.:.O:..;.,~cG"TA~J.J..:AG'I'OOT"'7 t5 e:o
~ ~ S F ~ R P 0 ~ W 0 4 L S ~ H ~ ~ P ~ k T P F F F A C ~ f P Q T ~ ~ V 0 ~ 4 ~ 4t,
OüOM'Tt.""rue:,"u"u\TJ..U.'TtiC."TCA't"'!'TA.~:.AMI,.AC"UI<(.~TA":"G.\CACC;.ATCAOCCCA..\Aa."t;u(~~t:AT>;:;/tfvA,T t'JA:.A~...c.H.:Af"C.:'\..<Vo.Ju\.:\'l'tt(:<:T'.,II.I.AC":: 1700
~ N L 0 I N A H L k X T T E Y 0 S t S P N R ~ F C G H ~ n ~ 0 Y ~ 7 S ~ N ~ ~ T U~
G.\TAC"A.\..V'i:?'I':NA),..~'.A<:TC''MAf'OC"M"C1'GATk\TGC.l.CA.':'fC'roTMU-:'A~AM.ATACCA'!'GA..:Y.T.l.TA':'GACTG:"At:'T:'C'A.CAt:n'AAJ..::Cr:.;:..r;;..T;...:i,TC.:AACAAOMTG":" 1:.1~0
n T K V );: K ll fl (') A IS :l N .!.. H $ V k: 0 Q N 'f" "M K 'I ... ':' ,, t. 1o1 ,.. t., t' "'- l 1 0 <,: j. t~ $&:>
ttT'M'TTC:<;cn;A<;Jo."l'::<:TC'!"'t"'TC'1'C:AA('.\(1A.rx;.AA',.A<:T .%(_;(.;r.:.:;-!'A 1"(;(1Jo.(:CC"A.~;C'A"'""':~tf(j(11'TATr;A(:AATt:(;TM:A'l'1'N•(;M~K:A'l' J',\C,\';~;·J...:<.:t> !':u:.il'~UC"N.:,\t:..W'-''l''I'I\N!..'I 1140
V P G ::; :• P L S I! 0 G K T R ~ M n P P W 0 Y 0 N R '!' l " t' T T r: I' L V 1-. .,. 1t • K t;O:>
C'CMTCN:Ol-.CnG.~.;._:;cc.v..u.A30('~CJTQA~A'!AC":"''"GA7TC.\GAGGAG01'0'roNTQIG,AGC7TG'r.:V._;Q~~GT),Tr.!"'~T(""'("a.a.f:Jo.A-.a.n:'N'~r...:..AnTl'CTT:".I,(;A,TJ.TM' J(l.t;(+
• P 1 .R ;) T T' I< K 4 V 'I S 1 1- 0 !-=: ); K V (' V I'! L V K !.. Y 11. i 0 I t • .,., J.; i: V L C 1 :i: U '
~l"G(;.AA;.~T('A("7'J.Tr"AT1'A~WlWT"-J(O"T;.;;;IQ;; TJJ(( i t i .(II('I'(;J.T~<;A::XX"'I'E:A:"!:TA:T M!M~T.:.AI..l."4.._./I.CN:K":''I"1":G.o\.~1'!":'A("""'~ ~1Sl0
$ tl G l\ T 1 1' l Y 't I' H G G R Q P I' t. A D k P P S P ':' ['> ... I ~ F Y $ ; !' ~~ l t ~ MO MA'fA..~A.~V..-='A'!'CM'I'Al'OC'f'!':C:AtKr.TM't'ACAGC"l":U"!A.),GA':'C'fM.A":"C"l'C«'M.AA'XA-:'M'J.T:":'TA:.M)ATJ..":''M'A.Vo:-rY.~.-'T~~~!.),~ JJO~
K Y ~ P X T ~ Y A $ ~ P V ~ ~ Y 1 8 ~ $ r K : ~ Y ~ ~ ~ Y A ~ c· t L ~ E ~ $ t G ~0 GC":'Q;..17M'GM/GT1'1'G(;Tr."TAT(;Af0000T1\AAM'\At:J..CM~C::..CANJAT:'TC~1'TC],.r.~-ro.r..';"'t".;.!.A.:...;(;:..::A~;.::\:At.t:•J\ •• ",Al..,'IC.rl".!•:~~v,I'J•.'Gf:A.\::rMMCrr.M':'I\OC %.420
A ~ V ~ V ~ ~ Y 0 U V K • ~ K T i ~ P 1 0 V I E ~ ~ G K C V t t ~ S E n F V N ~ HO
1'T<:AAA;:}.(;('llo.(.;.!.T:..;.;.A.A'l'(:'!'"rTA.t'C1{1M;c:A.'Na:TAATI;.:..<:(;:rn:A·r<.:m•,\1"'1':\I'I"J'rM.ICAC"l'(JUfu\'J'CCl•':'>V..':'T'T::~MrJAQ•)M.AGI:i.M.V.('T .:OG>:>.:O.GN('TCCC'Tl":'TT<;'CCI>. ~ ';4U t. K E n I Y. M I' M D i1 A N e ~ B R I C L A [; ~ ::; 1 - f. "· r. ~ 1t 1< '>' v. .-. 1\ ., ~ ) I' g(:Q II. 1'AA 1'\:0\'1''1.C.>:'i.Ut,.wu\ACCJ.r:)Q'l.\Q'rAC"1'AaTl'CAC:C'f ,l.AGGC:::':'TA'XACCTCC'Tt:C'TT<:r.iroGA 'M'C.YA':"TAC'C: AA!V ~~.;.t : " T .\t ;;.,; :(.';.. 1"-:·,·T'!':· u ; · :.c :.r...t.":'' :t :1'~ • J. 1-.::c.:A t 4 t6 0 1 I l ~ k K ~ G ~ T $ ~ ? K A L S P P P S V 0 S ~ Y P T A ~ ~ A S r M L X V K ;l R(D Ml"X'r-."""!'t'C1'CC>.CJ,~A~AC'CMttCTTMTC'::crt':'AT..;GtTN:oVu\r.U...~-:A.o.ta."':"!l.:.~41r:..JIA:.AA"!":'!~A.".T.~rt":"A.~1!0T i~!l)
S A A S ? T 0 A P 1 L Zf P ~ ~ V ~ ~ I 0 L Q :.. 1" T T I- !' r. 'f r: - "- ~ H s L K ;) C.: '~<'
C'M'CcTAiu\'fC!.OCAC~tt'N'M'T':'TG'N.VA),..\~--rTO~""Tit.CACNITl'Mt7~~~:-r .~:TI"':J- l"."tA.-.1w·,.~~~AG'l"'XiOT':'V'"T'J(N:; :'::c
L P K S A 0 L t. K S V F V K N V <: W A T 0 ~ 7 S 3 A V W V ~ F F D ~ S Q C V V Q nc
OC'AOOAG'J'GTCTTCT:..i'CAOTT:O'tAC"::':'<•J.t"<':A.U.Tt.;;.~':"l:.A.:...\(:AJ,~:·r:.t:<l1'A'f"J<.lAI,;.N\N','t\.i/uWu\rl'.\CCM:;,t..CrA~).Tr.''-Mf"jl.ro)~~TT:O.f"':S.,:T:::1'("T:"1'("T'T:'<:ATC<'•I"l'~"nl l02•:':
A G V S S ! S Y T a P H 0 Q T T R Y 0 , ~ ~ K ~ P U Y 1 l, 0 ~ t. ~ C l ::; ~ t L I HG
M'(iT1'r'J'C'TAAT~'CGACT<'C'TAA'M'T1'CAT.ba.TTAAJo.}.CTC,:;T'M'CA~;..t.CAT.lTAA!!'M""''MTWTlu'.CJ'
... F ~ N ~ T ~ h f H
507
Figure I. NuclcOtidc nnd :unino acid sequcncc of human SAK (K3) including partial untranslatcd scquences. The statt codon is in bold type. Thc stop codon is underlined. Thc highly conserved rnotifs of thc kinase domain (shadcd) nrc shown in invertcd lcttcrs: theinvariant rcsiducs (DFG) implicatcd in ATP-binding and the consensus scqucnce (GXGXXA) of scrinc/threonine kinases rclatcd to cdc2 (21 ,26).
murinc snk (24) thc similarity was dctcrmined to be 37%, 41% and 39% respcctivcly. The closest ovcrall homology of 82.3% has bcen detectcd to a murine gene, which was named sak (13). Comparing thc kinase domain and the carboxyterm inal portions of K3 and sak we obscrved similarities of 94.4% and 77.2%. Thc relationship of both gcnes (K3/sak) was confirmed by the homologies of 62%
(140 bp) and 66% (40 bp) wilhin the 5' and 3' untranslatcd rcgions. K3 exhibits the same topology as tbe members of the polo-family (polo, PLK, FNK and snk) with the kinase domain Jocated at thc aminoterminal porlion of the protcin. In contrast to these proteins K3 does not contain the polo- homology 2 (PH2) domain, which is a motif of approximately 30 aa within thc carboxyterminal region of polo-related kinascs. Due the thc high degree of homology it seems likely that the 910 aa-polypeptide is thc human counterpart of the murine gene sak (Fig. 2). Thus, wc suggest to name it also SAK.
Fig. 3 shows the evolutionary relationship of thc kinase domain of SAK to the rest of human serine/threoninc kinascs.
In a phylogenctic tree based on scqucncc homologies within thc kinase domain thc split of SAK occurrcd before the cvolution of the family of polo rclatcd kinases.
SAK exlzibits tissue specific expression. Thc Northern blot analysis of RNAs isolated from various human tissues with a specific probe frorn the carboxytcrminal portion of thc open reading frame showcd SAK transcripts of 4.0 kb to bc most abundant in testis and thymus (Fig. 4). In all other tissues examincd SAK mRNA was below the Iimit of detection under high stringency conditions. Furthcrmorc, we carried out a Northcrn blot analysis of RNAs isolated from a variety of different human malignanl tissucs. Hwnan tu mors of various origin such as Jung, breast and brain and corresponding nonnal tissues from thc same patient did not exhibit SAK rnRNA expression (data not shown).
508 KARN er a/: HUMAN SAK KINASE
(·C~
Sak K3 Sak k}
Sak K:l Sak K3 S.,'lk K3
Sa~
K3 Sak KJ Sak K3 Sak
K3 Sak K3 Sak K3 sak K3 sa:-<.
X3 Suk
so
100 150 200 250 300
SISGSL?DKRRLLIGQPLPNKf'1'l'VFPKNKSST~FSSS(;DCNSFY'J'O~·i<_:.~ 349 .L •••• L. -•••• V . . .. . . . I ... Q ••• N.S ••• ,-, .. SN.C ... P -QETSKSG;(GRVIQDAEERPHSRYLRR!'> YSSDRS(;'l'Sf-.ISQ~:QAKTYTHER 3 9 3 E •• ANSR •••••• E ... . . .. ; •••• H •••• }ISP •• -•• R ...• SV ••
CHSi\EMLSV~KRSGGGENEERYS ?'IDNNANI FNPF'K t:KrSSSSGSFERPD 4 4 ö
••• V •••• KPR,.- - --- - - - ------ ---L.
NNQl.LSNHLC?Gi<'l'Pc'PFADPTPQTETVQQ\<IFGN f .(llNAn:.RKTTEYDS I 4 9 H E •• HS ••• H. L., ••••••• Q ••• M.M ••••• , ••• M •••• GE.N. HHTV SPNRDFQGHPD:.QJ<DTSKKA\•J':'DTKVKKNSDASDNAHSVK(l()N'I'~JKytiTI; 548
•••• , • ,DY •• , . - •• LR •••••• AAS. ,}I, T ,}I. V .}I ••• LSJI •••• S.
LHSK PE! l QQECVF"GSDPLSEQSK'l'RGt•lEP F\•IGYQNI\TL RS I:'S PLV.•.HR 59 8 H.H ••• VMP •• P--. LH.H •• , •• N. S •• STL ••• KPT •••••••• I , ••
LKPIRQKTKKJYv"'lSILDSEEVCVELVKEYASQEYVKEV":.QI~:;srx;wr I '1'1 €4 8 . . . , . . . LR.C •• EG . . . , •• , ••• TM •• V YYPNGGRGFPLADRPPSP'TDKISRYf.;FDNT,f!:;J<YWHKYQYASRFVQLVRS 69g
••• ,O . . . L .. .. . . .. . . ... . . I . . . . . KSPKI'I'Y I"TRYI1KCIL~~ENSPGAD!'EV\'Ir'Y DGifK If.K':'EDFIQVTF.K':'CK 7 4 8 .'I' •••••••••••••.••••••••••••.•.• A •.•••• NL.HI ••••• I SYTLKSESEVNSLKEE I lü1PHl1HP...NE<:iiR:CL?~LESI: S E2ER K~RSA Pt-' 7 9 8
•• N •• N.N. ,T •• , , , V, VY •••••••••••• S ••• V ••••• KRS.GSS.
K3 F'PI I IGRK PGSTS.S PKALSPPPSVDSNYP':~DRA~FNRt·tV~-H-J.:;f>-~~s ?'fQ.Z·~ B 4 0 Sak , ••• V., ••• N •••••••• }I •• -•• PSCCKGEQ, .AS. LSVN ••• F, •• S K3 P!I.:.Jl?SMVTNEGLGLT':'-Tt~SGTDISSN~~XDCl,J:-KSAQLLKSVFVK).."'VGt{J 89H Sak ,G,S •• 'I' .• V •••• H.JI •• 'I' •• GV •• s---- -••• , ••••• , • , •• , •••
K3 ATQLTSt;A\1\'J\/Q?NDGSQLV'.JQAG\,.SS T SY'"'S PNGüT'TRYG:::NEKLPDYI 94 ö Sak •••••••.•••••••••••••.••••••••••• 0 ••••••••••••• E ••
K·• KOKLQCLSSIL:.HFSNPTP:VPH 970
S.>k ••••••••••••••••••••• Q
Figure 2. Se<Juence alignment of the predicted human SAK (K3) and murinc
• sak amino acid sequences. Nurobers to the right rcfcr to thc last amino acid in this line. ldentical residues in the murine scqucncc arc substituted by dots.
Gaps rcprcsentcd by dashes werc inscrtcd to maximize the alignment. The shaded region rcprcscnt thc kina~c domain.
Discussion
In this study we identified a novel member of the farnily of scrine/threonine kinases which is related to thc Drosophila melanogaster gcnc polo. We dcscribe the cloning of the new gene during a screen of a cDNA library based on human RNA dcsignated to isolate ncw protein kinasc gcncs which might participate in the development of lung cancer. The closest relationship of 82.3% has been found to murine sak.
Maximal alignment required the introduction of several gaps (Fig. 2). Within the family of kinases required for the
AKT-li RAC-alpha I PKB - AKT-21 RAC-bela
K4 PKC-alpha ' - - - -- sGK
' - - -- - -cAPK DMB
r - - - FNK I PRK PLI<
r - - - CaMK PSK·C3 ' - - -- - - - PSK·HI ' - - - ' -p78K
CDK2 CDK3
CDKI/ CDC2Hs . . - + - - - CDKS/ PSSALRE
PCTAIRE·l PCTAIRE·2
PCTAIRE-3 ' - - - CDK7/ MOlS r-1' - - - -GTAP58
CDK4/PSK:J3 CDK6/ PLSTIRE
'--- - - - -CHED
' - - - -KKIALRE
ERK·3 ' - - - -- CKII·alpha
ERK-1 ERK·2
L
---[======~=
PSK·H2 PSK-Gl~ C·RAF I RAF·l '---l~f-ß.RAF
A-RAF . - - - PIM·I ' - - - -TIK I PYr ' - - - . , . . . - - - - dsRNA·PK ' - - - -MAPKK/ MEK·l ' - - - -- MOS
Figure 3. Phylogenetic relationship of SAK to othcr human serinc/threonine kinascs. Thc amino acid scqucnces of the catalytic domains of human scrinc/thrconine kina~es were used for calculation of a phylogenetic tree with the Tree program of HUSAR (Heidelberg Unix Sequence Analysis Resource, DKFZ, Heidelberg). It is based on the progressive alignment rnethod ofFeng and Doolittle (27) in a multiple sequence alignment.
progression through the cell cycle we compared the open rcading framcs of human/murine countcrparts and determined the homology to be 93.7% for PLK/plk, 91.8%
for FNK!fnk and 95.1% and human/murine M015. This comparison revealed that SAK is not as weil conserv~d as other members of the polo-family. Still, the homologies of
2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 4,4 kb
+
4 kb K3-mRNAFigure 4. Expression of SAK (K3) rnRNA in adult tissues. Each lane contained 2 J.l8 of poly(A)+ from human heart, brain, placenta, lung, liver, skeletal musclc, kidney and pancreas (lanes 1-8) as weil as spieen, thymus, prostate, testis, ovary, small intcstine, colon and pcaipheral blood leukocytes (lanc 9·16).
Hybridization was done under high stringency wilh an antisense probe corresponding to aa 365-474. Sizc markers on the left arc in kilobases.
ONCOLOGY REPORTS 4: 505-510, 1997 509
the opcn rcading frames and the untranslated parts of both cDNAs as wcll as the pattcrns of mRNA exprcssion of murine/human SAK are quite similar. Thus we suggest that thc new polo-related gene represents the human counterpatt of murine sak.
An analysis of SAK expression by Northern blot hybridization has shown that out of 16 adult lissues SAK transcripts arc rcstricted to tcstis and thymus. A dctailed study of various tumor tissues and adjacent normal tissues from the same patient revealed that human SAK transcripts are not detectable in those specimens. These data indicate that human SAK is not exprcssed in the proliferative active tissucs examincd. This Observation differs in somc way frorn a study of sak exprcssion in murinc tissues which has shown that in the embryonie central nervous system sak transcripts are restricted to the ventricular zones, where neuroblasts are dividing. Murinc sak transcripts are not detected in zones, where the postmitotic ncurons are located (13). In adult mice, sak is expressed in tissues with a mitolic component, including hemopoietic tissues and the stem cells of the intestinal crypt.
Furthermore, high levels of murine sak mRNA were found in rneiotic sperrnatocytes and oocytes (13).
Expression of human SAK differs also from PLK, which belongs to the family of polo-related kinases. PLK was shown tobe regulated during the cell cycle in NIH3T3 cells (4).
In addition, PLK mRNA is highly expresscd in rapidly dividing cell populations found in fetal and newborn tissues and adult hemopoietic tissues (25). Thercfore, PLK mRNA cxpression is strongly correlated with the mitotic activity of cells and tissues. In our own studies on the function of PLK most human tumors of various origins werc found to express high Ievels of PLK mRNA and protein, although its expression was not detectable in normal tissues, indicating that the expression of PLK is associated with cell proliferation (7,10,1 1).
In addition to the diverging pattern of mRNA expression the architecture of thc putative SAK protein differs clearly from the related human polypeptides PLK and FNK/PRK:
Close relatives of Drosophila melanogaster polo such as Saccharomyces cerevisiae CDC5 and human PLK, FNK/PRK exhibit a common domain, named polo- homology-(PH2) domain, with an unknown function. SAK Iacks this motif of polo-related kinases. Thus, despite different structural similarities of SAK and polo-related kinases, the tissue distribution pattcrns of their mRNAs as weil as the molccular design of the putative proteins are distinct, suggesting that these kinascs have special physiological roles in different cells.
Acknowledgements
This work was supported by the Deutsche Krebshilfe (W I 02/93/Rü2), by the Deutsche Forschungsgemeinschaft (Str 336/5-1 ), by the Georg and Franziska Speyer'sche Hochschulstiftung and the Hessische Verein zur Förderung der J ugendgesundheitspflege.
Referenccs
I. Llamazares S, Moreira A, Tavares A, Girdham C, Spruce BA, Gonzalcz C, Karess RE, Glovcr DM and Sunkel CE: Polo encodcs a protein kinase homolog required for mitosis in Drosophila. Gene Develop 5: 2153-2165, 1991.
2. Kitada K, Johnson AL, Johnston LH and Sugino A: A multicopy suppressor gene of the Saccharomyces cerevisiae GI cell cycle mutant gene dbf4 encodes a protein kinase and is identified as CDC5. Mol Cell Bioll3: 4445-4457, 1993.
3. Sunkcl CE and Glovcr DM: Polo. a mitoti<.: mutant of Drosophila displays abnormal spindie poles. J Cell Sei 89: 25- 38, 1988.
4. Lake RJ and Jelinek WR: Cell cycle and tenninal differentiation- associated regulation of the mouse mRNA encoding a conserved mitoti::: prorein kinase. Mol Cell Bio! 13: 7793-780 I, 1993.
5. Golsteyn RM, Schult/. S, Bartek J, Ziemiecki A, Ried T and Nigg EA: Cell cycle analysis and chromosomal localization of human Pik I, a putative homologue of the mitotic kinases Drosophilapolo and Stlcclwromyces cerevisiae Cd<.:5. J Ccll Sei 107: 1509-1517, 1994.
6. Hamanaka R, Maloid S, Smith MR, O'Conncll C, Longo DL and Ferris DK: Cloning and characterization of human and murine homologues of the Drosophila polo serinc-thrconine kinase. Cell Growth Diffcr 5: 249-257, 1994.
7. Holteich U, Wolf G, ßrauninger A, Karn T, Böhme B, Rübsamen- Waigmann H and Strebhardt K: lnduction and downregulation of human PLK, a serine/threonine kinase expressed in proliferating cells and tumors. Proc Natl Acad Sei USA 91: 1736-1740, 1994.
8. Donol1Uc PJ, Albcrts GF, Guo Y and Winkles JA: 1dentification by targeted differential display of an immediate early gene cncoding a putative serinelthreonine kinase. J Bio! Chem 270:
10351-10357, 1995.
9. Li B, Ouyang B, Pan H, Reissmann PT, Slamon DJ, Arccci R, Lu Land Dai W: Prk, a cytokinc-indudblc human protcin serinelthreonine kinase whose cxpressioti appcars to be down- regulated in Jung carcinomas. J Bio! Chem 271: 19042-19408, 1996.
10. Yuan J, Hörlin A, Stulle HJ, Rübsamcn-Waigmann H and Strcbhardt K: Polo-like kinase, a novel marker for cellular proliferation. Am J Pathol (In press).
II. Wolf G, Elez R, Doenner A, Holtri eh U, Ackermann H, Stutte HJ, Altmannsberger H-M, Rübsamen-Waigmann Hand Strcbhardt K:
Prognostic significancc of polo-likc kinasc (PLK) expression in non-small cclllung cancer. Oncogene (in press).
12. Kumagai A and Dunphy WG: Purification and molecular cloning of Plxl, a Cdc25-regulatory kinase frorn Xenopus egg cxtra<.:ts. Science 273: 1377-1380, 1996.
13. Fodc C, Motro B, Yousefi S, HeiTernan M and Dennis JW: Sak, a murine protcin-scrinc/thrconine kinase thal is related to the Drosophilapolo kinase and involved in cell proliferation. Proc Natl Acad Sei USA 91: 6388-6392, 1994.
14. Chirgwin JM, Przybyla AE, MacDonald RJ and Rutter WJ:
Isolation of biologically active ribonucleic aeid from sourccs enriched in ribonuclease. Biochemistry 18: 5294-5299, 1979.
15. Sarnbrook J, Fritsch EF and Maniatis T: Molccular cloning: a laboratory manual. 2nd edition. Cold Spring Harbor Laboratory Press, Plainview, NY, 1989.
16. Holtrich U, Bräuninger A, Strebhardt K and Rübsamen- Waigmann H: Two additional protcin-tyrosine kinases expressed in human Jung: fourth member of the fibroblast growth factor rcccptor farnily and an intracellular protein-tyrosinc kinase.
Proc Natl Acad Sei USA 88: 10411-10415, 1991.
17. Aviv P and Leder P: Purification of biologically active globin messenger RNA by chromatography on oligothymidylic aeid- cellulose. Proc Natl Acad Sei USA 65: 1408-1412, 1972.
18. Gubler U and Hoffmann BJ: A simple and very effieient method for generating cDNA libraries. Gene 25: 263-269, 1983.
19. Böhme B, Holtrich U, Wolf G, Luzius H, Grzesehik K-H, Strcbhardt K and Rübsamen-Waigmann H: PCR mcdiatcd detection of a new human receptor-tyrosinc-kinase, HEK 2.
Oncogene 8: 2857-2862, 1993.
20. Karn T, Holtrieil U, Brauninger A, Böhme B, Wolf G, Rübsamen- Waigmann H and Strebhardt K: Structure, cxpression and chromosomal mapping of TKT from man and mouse, a new subdass of receptor tyrosine kinases with a factor VIII-like domain. Oncogenc 8: 3433-3440, 1993.
510 KARN er a/: HUMAN SAK KINASE
21. Hanks SK, Quinn AM and Hunter T: The protein kinase family:
conscrvcd fcaturcs and deduced phylogeny of the catalytic domains. Science 241: 42-52, 1988.
22. Kobelt D. Karn T, Hock B, Holtrich U, 13räuninger A, Wolf G.
Strebhardt K and Rübsamen-Waigmann H: Human and Xenopus MOlS mRNA are highly conserved but showdifferent patterns ofexprcssion in aduh tissucs. Oncol Rcp 1: 1269-1275, 1994.
23. Kozak M: An analysis of venebrate mRNA sequences:
iOiimations of translational control. (Review) J Cell Bio! 115:
887-903, 1991.
24. Simrnons DL, Neel BG, Stevens R, Eveu G and Erikson RL:
ldentification of an early-growth-response gene encoding a novel putative protein kinase. Mol Cell Biol 12:4164-4169, 1992.
25. Clay FJ, McEwen SJ. Bertoncello I, Wilks AF and Dunn AR:
ldentification and cloning of a protein kinase-encoding mouse gene, Pik, related to the polo gene of Drosophila. Proc Natl Acad Sei USA 90: 4882-4886, 1993.
26. Mcyerson M, Endcrs GI I, Wu CL. Su LK, Gorka C, Nelson C, Harlow E and Tsai LI 1: A family of human cdc2-rclatcd protein kinases.l::iMBOJ I 1:2909-2917,1992.
27. Feng D-F and Doolittle RF: Progressive sequence alignment as a prerequisite to correct phylogenetic trees. J Mol Evol 25:
351-379, 1987.
