7.1 Circular Dichroism (CD) Measurements
CD spectra were recorded on a JASCO-J815 spectropolarimeter equipped with a MPTC-490S/15 multicell temperature unit using quartz cells with 1 cm optical path. Oligonucleotides were prepared in a reaction volume of 600 μL as a 5 μM solution in 10 mM Tris-HCl pH 7.5, or 10 mM Tris-HCl pH 4.5, pH 5.5 or pH 6.5 as well as 10 mM sodium acetate pH 4.5 or pH 6.5 for C-rich oligonucleotides. If noted, the solution was supplemented with either KCl, NaCl or LiCl or MgCl2 to the indicated concentration. Oligonucleotides were denatured by heating to 98°C for 5 min, followed by slow cooling to 20°C over night. Scans were performed at 20°C over a wavelength range of 220–320 nm (5 accumulations) with a scanning speed of 500 nm/min, 0.5 s response time, 0.5 nm data pitch and 1 nm bandwidth. The buffer spectrum was subtracted and all spectra zero-corrected at 320 nm.
7.2 CD Thermal Denaturation
For thermal denaturation oligonucleotides were prepared as previously described. Due to the temperature dependent pH change of tris, melting experiments of pH-dependent i-motif forming oligonucleotides was carried out in sodium acetate buffer only. Samples were heated from 20°C to 100°C with a heating rate of 0.5°C/min. The CD signal was recorded every 0.5°C at the indicated wavelength. The temperature of the half-maximal decay of ellipticity T1/2 was obtained from the normalized ellipticity decrease using a Boltzmann sigmoidal fit of the Origin 8.6 software.
7.3 UV Thermal Denaturation
6 µM oligonucleotides were prepared as previously described. Thermal denaturation was performed with a Cary 100 Bio UV-Visible Spectrophotometer. UV spectra from 220 nm to 300 nm were recorded prior to melting. Samples were heated from 20°C to 95°C with a heating rate of 0.5°C/min. UV absorbance at 295 nm was recorded every 1.0°C. The temperature of the half-maximal decrease in absorbance T1/2 was obtained from the normalized absorbance decrease.
7.4 Oligonucleotide Purification by Preparative PAGE
Prior to use in native polyacrylamide gelelectrophoresis (PAGE) oligonucleotides were purified by denaturating PAGE to separate the full length oligonucleotide from potential other contaminants. Samples were mixed with one volume of denaturing PAGE loading dye (Table 25) and heated at 95°C for 3 min. 10% urea-denaturing polyacrylamide gels were cast as described in
Table 35. 1x TBE was used as running buffer. The gel was pre-run at 700 V for at least half an hour to warm up, then samples were loaded. Seperation was carried out at 700 V until the desired resolution was obtained. After the run the gel was wrapped in cling film. Oligonucleotide bands were visualized under UV light, marked and cut-out. Excessive UV exposure was avoided.
Oligonucleotides were obtained by crush-soak-elution: the bands were transferred to a fresh 2 mL reaction tube and crushed with a clean spatula. 1 mL of ultra pure water was added. The band was incubated under shaking in a thermo mixer at room temperature over night. The solution was filtered through a glass wool stuffed syringe and concentrated by ethanol precipitation (Chapter 7.24).
Table 35: Urea-Denaturing Polyacrylamide Gels
reagents volume final concentration
Rotiphorese ® sequencing gel concentrate 80 mL 10%
10x TBE, 9 M urea 20 mL 1x
9 M urea 100 mL 4.5 M
10% APS 1.6 mL
TEMED 80 µL
7.5 Radioactive Labeling of Oligonucleotides
Prior to use in native PAGE oligonucleotides were 5’-end-labeled with γ-32P-ATP by phosphate exchange reaction through T4-polynucleotide kinase (NEB), as described in the manufacturer’s protocol. The products were purified by gel filtration (Sephadex G-25 column). After purification the DNA concentration was adjusted to 5 µM with unlabeled oligonucleotide.
Table 36: 5’ End Labeling with γ-32P-ATP
reagents volume final concentration
Water 39.5 µL
10x T4 polynucleotide kinase buffer A 5 µL 1x
DNA (50 µM) 2 µL 2 µM
γ-32P-ATP 1.5 µL
T4 polynucleotide kinase 2 µL
7.6 Electrophoretic Mobility Shift Assay (EMSA)
To investigate the influence of the potassium concentration on secondary structure formation of d(G4CT)3G4 analytical native polyacrylamide gels were run. 5 µM radioactively labeled quadruplex DNA in 10 mM Tris-HCl was folded by heating up to 95 °C for 5 min and cooling down within 12 hours in the presence of different KCl concentrations as indicated. Polyacrylamide gels containing 16% acrylamide 40 (19:1) with a thickness of 0.4 mm were poured in 1x TBE supplemented with 100 mM KCl. The folded oligonucleotide was mixed 1:1 with native PAGE loading dye (Table 25), 4 μL of the samples were loaded on the gel. Separation was carried out at
a voltage of 300-400 V in 1x TBE buffer supplemented with 100 mM KCl. The running time was 6 h at 4°C. Gels were vacuum dried and analyzed by autoradiography.
7.7 Synthesis of Spin-Labeled d[(G
4CT)
3G
4]
The syntheses of DNA oligomers were performed on an ABI 394 DNA/RNA synthesizer with commercially available reagents. The spin-labeled DNA was synthesized using an extended coupling time for the spin-labeled phosphoramidite (10 min total in several pushes). 5-(ethylthio)-1H-tetrazole (0.25 M in CH3CN) was used as the activator, 0.02 M iodine in THF/Pyridine/Water as the oxidizer, and 3% (v/v) dichloroacetic acid in CH2Cl2 as the deblock solution. The DNA oligomers were cleaved from the solid support and with concentrated aqueous ammonia at 55°C for 12 h. The crude oligomers were lyophilized and then purified twice by HPLC.
First by ion-exchange chromatography (DNAPac® PA100) under denaturing conditions; eluent A:
25 mM NaOH pH 12.0, eluent B: 25 mM NaOH, 1 M NaCl, pH 12.0 with a gradient of 0 to 40% B in 35 minutes. The oligomers were lyophilized, and desalted using a Sep-Pak C18 Classic Cartridge using standard conditions and purified by RP-HPLC using A = 0.05 M triethylammonium acetate in H2O, pH 7.0 and B = methanol. ESI-MS calculated for 7146.3, found 7146.3.
7.8 ERP Measurements
G-quadruplex samples containing 80 µM DNA oligomers were folded as described earlier without KCl or in the presence of 1 mM and 500 mM KCl, by heating up to 98°C and slowly cooling down to room temperature. 20% (v/v) glycerol was added and samples were filled into Bruker Q-band capillaries and shock frozen in liquid nitrogen. Q-band DEER measurements were performed at T = 50 K on a Bruker ELEXSYS E580 spectrometer equipped with an EN 5107D2 Q-band probehead (Bruker Biospin) and a helium gas flow system (CF935, Oxford Instruments) using the following pulse sequence:
⋯ ⋯ ( ) ⋯ ⋯ ( ) ⋯ ( + − ) ⋯ ( ) ⋯ ⋯ ℎ .
The pump pulse (length 28 ns) was set to the maximum of the nitroxide spectrum and the observer pulses (length 24/48/48 ns) were shifted 49 MHz higher. All samples were measured at τ = 256 ns and τ = 2.6 μs. Shot repetition time was set to 4 µs. Accumulation time per sample was 10 hours.
7.9 EPR Data Analysis
The DEER curves were analyzed using the DeerAnalysis2013.2 software package (312). As a reference for the calculation of the number of coupled spins a 100% doubly labeled oligo(para-phenylenethinylen) was used.
7.10
1H-NMR Measurements
NMR spectra were acquired at 278 K on a Bruker Avance III 600 MHz spectrometer equipped with a TCI-H/C/N triple resonance cryoprobe. 65 µM d[(G4CT)3G4] was dissolved in Tris buffer supplemented with different concentrations of KCl or NaCl and containing 5 % Vol. D2O as field lock. G-quadruplexes were folded as described earlier, by heating up to 98 °C and slowly cooling down to room temperature. Because high salt concentration disturbed the NMR measurements, 325 µM d[(G4CT)3G4] folded with 500 mM KCl or NaCl was diluted to 200 mM KCl or NaCl prior to the measurement with the final oligo concentration being 65 µM, because of the high stability of the parallel conformer formed in the presence of KCl dilution should not interfere with the structure formed. 1D-proton spectra were acquired with 32,000 data points using 10k accumulated scans due to low sample concentration, and processed with an exponential line broadening window function. Solvent suppression was achieved by excitation sculpting (313).
Acquired data was processed and analyzed using Bruker Topspin and MestReNova software.
7.11 Analytical Ultracentrifugation (AUC)
Sedimentation velocity profiles were recorded using a Beckman Optima XLA ultracentrifuge equipped with absorbance optical system and An-60-Ti rotor. All oligonucleotides were PAGE-purified before folding. Samples were prepared with 5 µM oligonucleotide and folded as previously described. Except samples folded in 500 mM KCl, here samples were prepared using 25 µM oligonucleotide as the sample was diluted to 100 mM KCl before measurement resulting in the same oligonucleotide concentration and comparable solution viscosity and density to samples folded directly in 100 mM KCl. Dilution should not interfere with the structure formed because of the high stability of the parallel conformer. Sedimentation velocity profiles were recorded at 25 °C and 50,000 rpm. Primary data were processed using Sedfit fit to appropriate physical models (314). A value of 0.55 g/ml was used for ν. Buffer viscosity and density was calculated with Ultrascan 3 (Demeler B, UltraScan version 3. A Comprehensive Data Analysis Software Package for Analytical Ultracentrifugation Experiments. The University of Texas Health Science Center at San Antonio, Department of Biochemistry. http:/www.ultrascan.uthscsa.edu). The partial specific volume used for determination of c(s) for all G-quadruplex species was 0.55 mL/g (315).
7.12 BLASTn Search
Bacterial genomes were searched for the quadruplex motif using the BLASTn web server (243) (http://blast.ncbi.nlm.nih.gov/Blast.cgi) and the following parameters: query sequence
“GGGGCTGGGGCTGGGGCTGGGG”, database “nucleotide collection (nr/nt)”, organism “bacteria (taxid:2)”. The search included 20,755,639 sequences and an effective sequence space used of 52,298,456,252 nt. Only hits from fully sequenced bacterial genomes with 100% identity were taken in account, all showing a bit score = 44.1 (bit score = 40.06 required) and an E-value = 0.003.
Hits were then divided into groups according to their occurrence within protein coding sequences, being complementary to protein coding sequences or occurrence in untranslated regions.
Similarly, the human genome were searched for the quadruplex motif using the following parameters: query sequence “GGGGCTGGGGCTGGGGCTGGGG”, database “Human genomic plus transcript (Human G + T)”. The search included 102,358 sequences and an effective sequence space used of 37,516,328,584 nt. Only hits from GRCh38 Primary Assembly with 100% identity were taken in account, all showing a bit score = 44.1 and an E-value = 0.002.
7.13 Identification of Repeat Patterns in Xanthomonads
Potential G-quadruplex forming sequences in Xanthomonas campestris pv. campestris ATCC 33913 (Xcc) were initially obtained from ProQuad Database (261) (http://quadbase.igib.res.in/) using the following query parameters: pattern G (for plus strand) or C (for minus strand), stem size G3 (or C3) and loop size L1-5, genomic location: all. For further studies the chromosomal sequences of Xanthomonas campestris pv. campestris ATCC 33913 (NC_003902), Xanthomonas axonopodis pv.
citri str. 306 (AE008923), plasmids pXAC33 (NC_003921) and pXAC64 (NC_003922) were downloaded from the NCBI website. Xcc and Xac genomes were manually searched for repeats comprising at least two units and containing at least once the heptamer “GGGAATC” using the software Clone Manager 9 (Scientific & Educational Software). Functions of annotated genes and their positions on the genome were collected from the KEGG (http://www.kegg.jp/) and NCBI databases.
7.14 Identification of Repeat Patterns in Nostoc sp. PCC 7120
Potential G-quadruplex forming sequences in Nostoc sp. PCC 7120 (Ana) were obtained from ProQuad Database (261) using the following query parameters: pattern G (for plus strand) or C (for minus strand), stem size G3-5 (or C3-5) and loop size L1-7, genomic location: all. From this set all patterns of the type G4L1-4 containing at least twice the units GGGGA(C/T)T were selected.
For further analysis the chromosome sequence (NC_003272) was downloaded from the NCBI
website, plasmids were searched on the NCBI webserver. Data on functions of annotated genes and their positions on the genome were collected from NCBI or Cyanobase (316) (http://genome.microbedb.jp/cyanobase).
7.15 Analysis of Repeat Associated Genes
Repeat associated genes were sorted into functional categories using the KEGG pathway mapper (317) (http://www.genome.jp/kegg/mapper.html). Total number of genes in each category was also retrieved from the KEGG website (300). Further information for genes from Ana was retrieved from Cyanobase (316) (http://genome.microbedb.jp/cyanobase).
7.16 Analysis of Sequence Homology Between Xcc and Xac in Repeat Containing Regions
Nucleotide BLAST (243) (http://blast.ncbi.nlm.nih.gov/Blast.cgi) was used to compare sequence similarity between Xcc and Xac applying the following parameters: algorithm: blastn (somewhat similar sequences), database: NCBI genomes (chromosome), organism: Xanthomonas axonopodis pv. citri str. 306 (taxid: 190486). The entire repeat containing intergenic region and the next up- and downstream neighboring ORFs or the entire ORF containing an intragenic repeat were used as query sequence. Presence of the repeat was assessed. Sites where the alignments showed less homology or gaps were then checked directly in Clone Manager for repeat presence and compared for general changes in the intergenic regions and neighboring genes.
260 intergenic regions that did not contain GGGAATC repeats including the next neighboring ORFs were randomly chosen from the Xcc genome and subjected to the same blast analysis. Control 1-3 (117 sequences each, equal to the number of intragenic repeat containing regions) were randomly assembled from this pool of controls. From the same pool sequences for control 4 were chosen to show the same distribution on the Xcc genome and sequences for control 5 were chosen to show the same orientation of neighboring ORFs as the intergenic repeat containing sequences.
Distribution of the orientation of the neighboring genes relative to the repeats was analyzed for all controls.
7.17 Analysis of Repeat Positions Relative to Neighboring ORFs
Distances from the respective start or end point of the repeat to the start or stop codon to the next neighboring ORF were calculated. Repeats were subsequently grouped according to increasing distance from the ORF.
7.18 Operon Analysis
Information on predicted operons was retrieved from DOOR2 (282) (http://csbl1.bmb.uga.edu/OperonDB_10142009/DOOR.php) for all three organisms and additionally from Microbes online (281) (http://www.microbesonline.org/operons/) for Xcc and Xac.
7.19 Analysis of Whole Transcriptome Sequencing Data of Xac
Information of differentially expressed genes of Xac in grown in full medium “NB” compared to hypersensitive response eliciting medium “XVM2” was extracted from Jalan et al. (285).
Paired-end reads of Xac (referred to as XccA306 by Jalan et al.) of NB sample 2 were downloaded from Gene Expression Omnibus database of NCBI (accession number GSE41519). Read quality was first checked with FastQC (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/) (version 0.11.2) and then trimmed with Trimmomatic (318) (version 0.32). Trimmed reads were then mapped to the Xac genome using bowtie2 (319) (version 2.2.3). Uniquely mapped reads were assembled by Trinity (320,321) (version r20140717). In total, 4266 transcripts were assembled, and their expression levels were calculated by aligning reads to each assembled transcript and normalizing them by Fragments Per Kilobase of exon per Million fragments mapped (FPKM).
Assembled transcripts were then mapped to the Xac genome using blat (322) to obtain their respective coordinates on the genome.
Number and orientation of repeat-containing transcripts was determined. Repeats were either categorized as not paired (single repeats) or paired (inverted repeats). Repeats were further classified as potential G-quadruplex forming repeats (at least 4 G-tracts without mutations) or short repeats unable to form G-quadruplexes (controls). Assembled transcripts were then sorted into the three categories according to the location of the repeat within the transcript (start, middle, end). Reads mapping to repeats located in coding regions were excluded from the final analysis.
7.20 Cultivation of Xcc for Hyperosmotic Shock Experiments
All work with Xcc were carried out under sterile conditions, no antibiotic was added to the media.
Media that was not inoculated was carried along throughout the experiments as sterile control.
10 mL TY medium (Table 23) was inoculated with Xcc from a glycerol stock and grown for 1 day at 28°C. The culture was used to inoculate 10 mL of M9 medium (Table 23). The culture was grown over night at 28°C for 1 day and then used to inoculate four times 50 mL of M9 medium with a starting OD600 = 0.06 (four replicates). Cultures were grown at 200 rpm, 28°C until they reached an OD600 = 0.3 (approx. 12 h). For each sampling time point and replicate 7 mL 1.2 M sucrose in
M9 medium or 2.8 mL 50% sorbitol in M9 medium (all sterile filtered) were prepared in advance in a 50 mL tube and pre-warmed to 28°C. After reaching OD600 = 0.3 7 mL of each Xcc culture were added to the prewarmed sucrose or sorbitol containing medium to induce hyperosmotic shock.
7 mL from each replicate were immediately collected by centrifugation as control for the uninduced cells. Shocked cells were grown at 200 rpm, 28°C for 7 min, 15 min and 30 min and then also collected by centrifugation.
7.21 RNA Isolation
Bacterial pellets were collected by centrifugation at 3,220 x g for 10 min at 4°C. The medium was discarded and the pellet shock frozen in liquid nitrogen until sampling was completed. Frozen pellets were stored at -80°C over night. RNA extraction and isolation was carried out using the Rneasy Mini Kit (Qiagen). 200 µL 1x TE buffer supplemented with 1 mg/mL lysozyme was added to each pellet and the samples were thawed on ice. Thawed samples were resuspended in the buffer and RNA extraction was carried out according to the manufacturer’s instructions. RNA was eluted with two times 30 µL of ultra pure water and directly submitted to DNase I treatment for removal of genomic DNA.
7.22 Removal of Genomic DNA
After RNA isolation RNA samples were submitted to DNase I digest to remove residual genomic DNA, which would disturb RNA quantification by qPCR. 7 µL 10x DNase I reaction buffer and 3 µL DNase I (3 U) were added per 60 µL of RNA sample. Digestion was carried out at 37°C for 20 min, then additional 3 µL DNase I (3 U) were added and the incubation was repeated. Samples were not heat-denatured, but immediately submitted to phenol-chloroform extraction for removal of DNase I.
7.23 Phenol-Chloroform Extraction
Phenol/chloroform extraction was used to remove DNase I from RNA samples after DNase I treatment for removal of genomic DNA. To increase the aquaeous phase 100 µL of ultra pure water were added to 60 µL RNA sample. 1 volume phenol/chloroform mixture (Roti-AquaPhenol, pH 4.5-5.0, Roth) was added to the sample and mixed by vortexing for 5 s. Phases were separated by centrifugation at 14,000 x g for 5 min. The aqueous phase was carefully transferred into a new reaction tube. The phenol phase was extracted with 100 µL ultra pure water one more time. The combined aqueous phases were once extracted with 1 volume 100% chloroform to remove
residual phenol. Finally the aqueous phases were subjected to ethanol precipitation to receive an RNA pellet.
7.24 Ethanol Precipitation
Ethanol precipitation was used to purify DNA or RNA from unwanted salts or to concentrate samples. 1/10 volume of 3 M sodium acetate buffer, pH 5.2 was added to the sample, followed by addition of 3 volumes of 100% ethanol. The solution was incubated for at least 20 min at -80°C or -20°C over night. The sample was centrifuged at 20,000 x g for 15 min at 4°C. The supernatant was discarded. The nucleic acid pellet was washed with 70% ethanol and centrifugated at 20.000 x g for 15 min. The pellet was air-dried and dissolved in 60 µL of ultra pure water.
7.25 Nucleic Acid Quantitation
Oligonucleotide concentrations were determined using the Tecan Infinite M200 NanoQuant Plate or the Eppendorf bio photometer. Measuring UV absorption at 260 nm was used for the quantification of DNA or RNA. Water was used as a reference. Extinction coefficients and molecular weight were determined using the web application “IDT Oligo Analyzer”
(http://eu.idtdna.com/analyzer/Applications/OligoAnalyzer). DNA concentrations were calculated based on the Lambert-Beer’s law. The ratio of absorbance at 260 and 280 nm was used to assess DNA or RNA purity from proteins or phenol (A260/280 >1.8 for DNA, A260/280 >2.0 for RNA).
7.26 cDNA Synthesis
Reverse transcription was performed with 1 µg total RNA and random hexamer (N6) priming using Superscript III reverse transcriptase (SSIIIRT, Invitrogen) in a final volume of 20 µL. First negative controls containg RNA but lacking SSIIIRT were prepared and tested in qPCR experiments against samples containing no template to check for successful removal of residual genomic DNA by DNase I. Then RNA samples were subjected to reverse transcription. Equal volumes of 214 ng/µL N6 primer and 10 mM dNTPs were mixed. 2 µL of the mixture was added to 1 µg of RNA and the volume adjusted to 13 µL with ultra pure water. The mixture was incubated at 65°C for 5 min. Samples were then placed on ice for at least 1 min for annealing of the primers.
SSIIIRT mixtures was prepared in bulk containing 4 µL First Strand (FS) buffer, 1 µL DTT and 1 µL SSIIIRT (200 U) per sample. 7 µL of the SSIIIRT mix was added to each sample. Final concentrations are 1 µg RNA, 10.7 ng N6 primer, 0.5 mM dNTPs, 5 mM DTT and 200 U SSIIIRT in 1x FS buffer. Due to random hexamer priming samples were first incubated at 25°C for 5 min.
Then cDNA synthesis was carried out at 50°C for 60 min. The enzyme was heat-inactivated at 70°C
for 15 min. Samples were cooled down to 20°C and 1 µL (5 U) RNase H was added to each sample for removal of RNA from RNA-DNA heteroduplexes. RNase H digest was carried out at 37°C for 20 min, followed by heat-inactivation of the enzyme at 65°C for 20 min. cDNA samples were used in qPCR experiments or stored at -20°C.
7.27 Semi-Quantitative Real-Time PCR (qPCR) Analysis
qPCR was performed on a Toptical thermocycler (Analytik Jena) in 96 well plates in a final volume of 10 µL according to Table 37. All reagents were kept on ice during the preparation. A polymerase master mix containing High Fidelity (HF) buffer, dNTPs, Phusion Hot Start II Polymerase (Phu HSII Pol), Sybrgreen and water was prepared. The enzyme mix was then added to each cDNA sample.
8.8 µL/well of polymerase-cDNA sample was distributed on a 96 well plate on ice. 1.2 µL of primer mix was then added per well, so that each cDNA sample was analyzed by all primers on the same plate. Each primer pair was assayed twice. Primer pairs are listed in Table 18, Table 19 and Table 20 in Chapter 6 “Materials”. A control sample containing no cDNA was run additionally to test for contamination of the reagents, non-reverse transcribed RNA had been tested in qPCR prior to cDNA synthesis to check for contamination with genomic DNA.
Table 37: Reaction Mixture for qPCR
Reagent Volume [µL] Final concentration
HF buffer (5x) 2 1x
cDNA template 0.375
dNTPs (10 mM) 0.2 0.2 mM
5 µM Primer Mix 1.2 0.6 µM
Phu HSII Pol (2 U/µL) 0.09 0.018 U
SYBRgreen (100x) in DMSO 0.07 0.7x
H2O 6.065
total volume 10
qPCR analysis was carried out according to the program detailed in Table 38 with a heating rate of 5°C/s.
Table 38: Program for qPCR
PCR cycle T
[°C] time
[s] go to step
Lid preheating 98
--1. Initial denaturation 98 59
--1. Initial denaturation 98 59