2 In vitro olfactory receptor assay
2.3 Materials and Methods
2.3.1 Materials and reagents
Odorants; ethyl butyrate (EtBE) and 2, 3-butanediol (BDOL) were purchased from Sigma-Aldrich (Taufkirchen, Germany) at the highest purity available. Probenecid (lyophilized powder; 250 mM stock solution was prepared in assay buffer), pluronic acid (20% solution in DMSO), fluo-4 acetoxymethylesters (AM) – 1 mM solution in DMSO, Dulbecco's Modified Eagle Medium (DMEM), Opti-MEM reduced serum medium, penicillin/streptomycin, lipofectamine, 1 M HEPES, 1 X HBSS and DAPI were purchased from Invitrogen (www.invitrogen.com/GIBCO). HEK293T cells were a kind gift from the group of Prof. Marcel Leist, Department of biology, University of Konstanz, Germany. Fetal calf serum (FCS) and ionomycin (calcium ionophore) was purchased from PAA (Velizy-Villacoublay, France) and Sigma-Aldrich respectively. Live cell calcium imaging was performed in sterile µ-dishes, 35 mm high – (ibi treat, tissue culture treated) purchased from ibidi (Münich, Germany). Protease inhibitors (complete protease inhibitor cocktail), nitrocellulose membrane (Protran BA83), western bright ECL kit, X ray films and microscopic mounting solutions were purchased from Roche (Indiana, USA), Whatman (New Jersey, USA), Advansta (California, USA), Fujifilm super RX (Tokyo, Japan) and Merck (Darmstadt, Germany) respectively. α-GFP primary antibody and mouse secondary antibodies were purchased from Molecular probes (Eugene, USA) and Genscript (New Jersey, USA) respectively.
Odorant stock solutions were prepared freshly every time in the assay buffer (for EtBE) or in Dimethyl sulfoxide (DMSO; for BDOL) at 100 mM. The desired odorant
Chapter 2. Materials and Methods
20
concentration was prepared by serial dilution of stock odorant solution in assay buffer.
Final concentration of DMSO added to the cells was 0.1%. Assay buffer was prepared by adding 1 part of 1 M HEPES to 49 parts of 1X HBSS. The pH of the buffer was adjusted to 7.3 with NaOH.
2.3.2 Expression vector
The constructs encoding for the odorant receptors of Drosophila melanogaster - pCDNA3-dOr22a-GFP and pCDNA3-dOr83b-GFP (C-terminal fusion constructs) were kindly provided by the lab of Prof Eva M Neuhaus, Charité – Universitätsmedizin Berlin, Germany. Sequence information of the receptor can be found in Neuhaus, Gisselmann et al. 2005. The plasmid pCDNA3.1(+)-dOr92a was constructed by inserting the synthesized cDNA sequence (1264bp; custom made gene synthesis by Eurofins MWG operon - http://www.eurofinsgenomics.eu) of D. melanogaster Or92a (Genebank accession code: NM_079690) into the multiple cloning sites of the pCDNA3.1(+) vector (Invitrogen) using the restriction enzymes HindIII (5’) and EcoRI (3’). The sequences were verified via DNA sequencing of both strands and the sequence convergence was 100%.
The plasmid encoding odorant receptor dOr67d (PCR2.1-Or67d) was a kind gift from Prof Dr Dean Smith, Department of Pharmacology and Center for Basic Neuroscience, University of Texas Southwestern Medical Center, Texas, USA (Ha and Smith, 2006). The coding sequence of Or67d was cut with BamHI (5’) and XbaI (3’) from PCR2.1-Or67d vector and inserted into pCDNA3.1(+) vector linearized with BamHI and NheI; to obtain the vector pCDNA3-dOr67d suitable for expression in HEK cells. The sequences were verified via DNA sequencing of both strands and the sequence convergence was 100%.
cDNA clones for the gustatory receptors Gr64c, d and e were obtained from the Drosophila Genomics Research centre (DGRC; https://dgrc.cgb.indiana.edu/vectors/;
ID: AT2207 (for Gr64d and e) and IP02441 (for Gr64c)). Gr64d and Gr64e cDNA were cut with respective pairs of restriction enzymes: EcoRI and MfeI and Pcil and XhoI.
Subsequently the inserts were cloned into pCDNA3.1(+) vector linearized with EcoRI and XhoI and EcoRV and XhoI for Gr64d and Gr64e respectively. To provide compatible ends, sticky ends produced by MfeI and PciI in case of Gr64d and e and XhoI in case of pcDNA3.1(+) were blunted before digestion by the second enzyme by filling the overhang using the polymerase activity of Klenow fragment. Sequence analysis was performed as described before. The cDNA clone obtained from DGRC for Gr64c had a missense mutation (found from the sequence information available at DGRC) which would lead to the production of truncated receptor. Hence by means of site directed mutagenesis (SDM) we introduced the two missing nucleotides (“TT”) in the
Chapter 2. Materials and Methods
21
right position in the cDNA clone using primers: sense –
“CTAAGGAGATTTCCTACACCCTATACGAAATACC”, antisense –
“TATAGGGTGTAGGAAATCTCCTTAGCCTCTTGCG” before cloning. Insertion of the nucleotide was analyzed by sequencing. Vector containing corrected version of Gr64c cDNA was digested with NurI and XhoI and cloned into pCDNA3.1(+) vector linearized with EcoRV and XhoI. Sequence analysis was performed as described before.
2.3.3 Cell culture and transient transfection of HEK293 cells
HEK293 cells were maintained as an adherent culture in DMEM supplemented with 10% FCS and penicillin (100 units/ml final concentrations)/ streptomycin (100 µg/ml) at 37°C and 5% CO2. For transfection HEK293 cells were cultured at a density of ~1x106 cells per well in a six well plate and transiently transfected with plasmids (2 µg/ml) encoding the receptors (pcDNA3-dOr22a-GFP and pcDNA3-dOr83b (Orco)-GFP or pCDNA3.1(+)-dOr92a and pcDNA3-dOr83b (Orco)-(Orco)-GFP) or control plasmid (pCDNA3.1(+); mock transfected cells) using 14 µl/ml of transfection reagent (lipofectamine) according to the manufacturer's protocol. Cells were washed twice in sterile PBS and split at 1:5 ratio after 8–12 h post-transfection into µ-dishes and imaged 48 h post-transfection.
2.3.4 Western blot
HEK293T cells were harvested two days after transfection (dOr22a, Orco, dOr22a and Orco and mock-transfected cells) with ice cold homogenization buffer (50 mM HEPES and 0.2 mM ethylene glycol tetraacetic acid (EGTA)) supplemented with protease inhibitors and homogenized using a dounce homogenizer. Cell debris and nuclei were removed by centrifugation at 2000g, 5 min, 4°C; supernatant was further collected and re-centrifuged at 18,000g 1 h. The resultant membrane pellet was solubilized in resuspension buffer (50 mM HEPES, 0.2 mM EGTA, 5 mM MgCl2 and 100 mM NaCl). Concentration of the protein was measured using the standard Bradford assay and equilibrated. About 10 µg of the sample (protein) were loaded on 10% SDS-PAGE gels, transferred to a nitrocellulose membrane. The nitrocellulose membranes were blocked with PBS (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4.2*H20 and 2 mM KH2PO4, pH 7.4) containing 5% non-fat dry milk and incubated for 1 h with mouse monoclonal α-GFP antibody diluted 1:1000 in the blocking buffer. After 3 times washing in PBS, membranes were incubated 1 h with mouse secondary antibodies coupled to HRP diluted 1:10,000. Detection was performed with ECL and X ray films.
Chapter 2. Materials and Methods
22 2.3.5 Cell staining
After 8 h of transfection cells were split and cultured on the poly-L-lysine coated 12 mm round cover slips in 12 well plates. After two days post-transfection cells were washed 3 times with PBS and 1 ml of 4% paraformaldehyde solution in PBS was added to each well. Cells were fixed for 20 min and washed with PBS (3X). 300 µl of DAPI (nuclear stain) solution (300 nM in PBS) was added to each well and incubated for 5 min.
Cells were rinsed with PBS several times to remove the excess dye. Excess of buffer on the cover slips was drained and they were subsequently mounted on a microscopic glass slide using mounting solution.
2.3.6 Calcium imaging
HEK293T cells in µ-dishes were washed twice with assay buffer. 1 ml of assay buffer containing 2 µM Fluo-4 AM, 0.01% pluronic acid and 2.5 mM probenecid was added to each dish and incubated at 37°C for 45 min. The Fluo-4 solution was removed and the cells were washed twice with 1 ml of assay buffer. The dishes were then incubated with 900 µl of assay buffer for further 30 min at 37°C prior to calcium imaging. Fluorescence images were acquired through the bottom of the dish using an inverted laser scanning confocal microscope (LSM 510 Meta; Carl Zeiss, Oberkochen, Germany) equipped with air objective (20x objective, NA = 0.5; Carl Zeiss). Excitation wavelength was 488 nm, which was generated by HFT 488 filter and was filtered by NFT 490 nm filter and detected by the longpass filter 505 nm. For every image the detector gain was adjusted to avoid saturation on PMT detector. We imaged with an acquisition rate of 0.2 Hz for 250 s for all experiments except for increasing odor concentration experiment (same cells tested at different concentration of an odor); 0.2 Hz for 550 s. 100 µl of desired odorant and concentration (for e.g. 100 mM of EtBE was added and final concentration of the odorant tested is 10 mM) or the solvent (assay buffer; control) was added to the cells in 900 µl of buffer between 10th and 11th frame or between 10th and 11th , 40th and 41th and70th and 71th frames for experiments with multiple concentrations. To determine the maximal fluorescence of the cells, ionomycin (final concentration is 2 µM) was added at the final stage of experiment (between 40th and 41th frame or between 110th and 111th frame).
2.3.7 Data analysis
Images were analyzed using user-defined workflows in the open source software KNIME. Prior to analysis, the background fluorescence of the images (area of the image excluding the area of the cells; gray colored area in Fig 2.1A) was subtracted from the mean fluorescence intensity (average intensity of the whole cell) of each cell in the frame.
Baseline (Bo) was calculated as an average fluorescence intensity of first ten frames
Chapter 2. Materials and Methods
23
before any application. Maximum fluorescence intensities achieved upon addition of odor solution or control buffer (11th - 39th frame) and ionomycin (40th - 50th frame) were expressed as Roand Ri respectively. Fluorescence intensity before ionomycin addition (39th frame) was expressed as Bi. Odor and ionomycin (relative to odor response) mediated calcium responses were calculated as Ro/Bo and Ri/Bi respectively. For increasing odor concentration experiments maximum fluorescence intensity after 1st, 2nd and 3rd odor presentations and ionomycin addition was expressed as Ro1 (11th - 39th frame), Ro2 (41st – 70th frame), Ro3 (71st and 100th frame) and Ri (110th - 111th frame) respectively. Fluorescence intensities before each addition of odor solution (9th, 40th and 70th) and ionomycin addition (99th frame) were expressed as Bo1, Bo2, Bo3 and Bi respectively. Odor and ionomycin mediated calcium responses were calculated as Ro1/Bo1, Ro2/Bo2, Ro3/Bo3 and Ri/Bi respectively. Though two of the receptors used in this study were tagged to GFP, GFP-positive cells were indistinguishable from non-transfected cells in the experiment, because the excitation and emission wavelengths of Fluo4-AM used in these experiments are overlapping with those of GFP.
To distinguish between the spontaneous fluctuations of the Ca2+ levels in the cells and an induced response, we set the threshold value of Ro/Bo equal 1.5. This value was calculated from the measurements of mock-transfected cells, in which the relative Ca2+ increase upon addition of odor solution did not exceed this value. Hence in each experiment the cells with Ro/Bo value below the threshold were grouped as non-responders and those above it were considered responding cells (Fig.2.1B). Additionally, the few aberrant or possibly dead cells with either unusually low Bo levels (<3000 AU) or minimum relative response to ionomycin (Ri/Bi < 1.5) were also excluded from calculation.
Figure 2.1 Data analysis.
(A) Example image of an experiment from KNIME segmentation viewer. Grey colored areas indicate the background fluorescence of the image and individual cell are filled with other colors. (B) Plot of basal
Chapter 2. Materials and Methods