Role of G proteins in olfactory signaling of Drosophila

(1)

Role of G proteins in olfactory signaling of Drosophila

Dissertation submitted for the degree of Doctor of Natural Sciences

Presented by

Jennifer Sinthiya Ignatious Raja

at the

Faculty of Natural Sciences

Department of Biology

Date of the oral examination: 31. October 2013 First supervisor: Prof C Giovanni Galizia, Second supervisor: Prof Vladimir L Katanaev

Konstanzer Online-Publikations-System (KOPS) URL: http://nbn-resolving.de/urn:nbn:de:bsz:352-250387

(2)

(3)

1

CHAPTER 1 General Introduction

A sensory system (vision, hearing, somatic sensation (touch), taste and smell (olfaction)) is a part of nervous system consisting of sensory receptors that receive stimuli from internal and external environment, neural pathways that conduct this information to brain and processes it. Olfaction, one of the chemical senses is the major focus of this thesis. Olfaction, the sense of smell, allows animals to detect, discriminate and respond to a broad range of different chemicals, which occur at a wide range of concentrations in the environment. The olfactory system provides information about food, mating partners, oviposition sites, danger, predators and pathogens and is essential for survival of most animals. Based on their function, these chemical substances are designated as odorants or pheromones, which include small volatile substances, peptides and proteins, and gases such as carbon dioxide or oxygen.

Across the animal kingdom, olfactory systems are substantially similar. The ability to recognize a vast number of odorous ligands is thought to be due to the special properties of the olfactory or odorant receptors (ORs). ORs are the large family of membrane proteins that is selectively expressed in olfactory receptor neurons (ORNs also called as olfactory sensory neurons (OSNs)) in the olfactory epithelium of vertebrates and antennae of insects. ORs have selective but broad ligand binding properties. An OR can be activated by multiple odorants and an odorant can activate multiple ORs (Araneda et al., 2000; Hallem et al., 2004; Katada et al., 2005; Malnic et al., 1999). This combinatorial coding strategy based on a large family of ORs with broad but selective ligand pharmacology in part accounts for the ability of animals to detect and discriminate a number of odorants that far exceeds the number of OR they possess. The vast majority of identified chemosensory receptors (ORs and gustatory receptors (GRs)) in multicellular organisms belong to the superfamily of seven transmembrane domain proteins called, G protein coupled receptors (GPCRs), including odorant, gustatory and pheromone receptors in mammals, birds, reptiles, amphibians, fish, and nematodes and are shown to signal via the G proteins (metabotropic signaling) (Bargmann, 2006). ORs in insects were predicted to have seven transmembrane domains like the chemosensory receptors of other organisms and of the classical GPCRs (Benton et al., 2006; Clyne et al., 2000; Clyne et al., 1999; Lundin et al., 2007; Zhang et al., 2011). But the intracellular

(7)

Chapter 1. General Introduction

5

signaling in insect ORNs remains unclear and the role of G proteins in olfactory signaling is still enigmatic and is of the major focus of this thesis. Drosophila melanogaster is used as a model insect in this study due to the advantages like: accomplished genetic transformation techniques (e.g. UAS-GAL4 system), availability of complete genomic sequence, relatively simple and stereotypic organization of the olfactory system.

Olfactory organs and olfactory receptor neurons of Drosophila

Drosophila detects odors through two pairs of olfactory sensory organs on the head: antennae (3^rd segment) and maxillary palp (Fig.1.1). Each antenna and maxillary palp contains about 1200 and 120 ORNs housed in a total of 410 and 60 olfactory sensilla, respectively (Shanbhag et al., 1999; Shanbhag et al., 2000; Stocker, 1994). The sensilla are of three morphological types: basiconic, coeloconic and trichoid sensilla. The most numerous are basiconic sensilla and are subdivided into large and small basiconic sensilla (distinguishable by light microscope)(Venkatesh and Singh, 1984). The sensilla house the dendrites of up to four ORNs. Basiconic, coeloconic and trichoid sensilla express ORs and gustatory receptors (GRs; detect also CO₂), ORs and IRs, and ORs respectively. While ORs detect many volatile compounds, food odorants and pheromones (11-cis-vaccenyl acetate - cVA), IRs detect volatile amines, carboxylic acids and few food odorants (Su et al., 2009).

Drosophila genome encodes for 62 ORs (Clyne et al., 1999; Gao and Chess, 1999;

Hallem and Carlson, 2004; Vosshall et al., 1999; Vosshall et al., 2000). Each ORN expresses in general only one type of OR (together the co-expression of co-receptor – Orco; highly conserved across insect species). However, few ORNs express more than one OR, up to three ORs maximum. All ORNs, which express the same kind of OR, project to a distinct glomerulus (functional units of the antennal lobe (AL); ~43 glomeruli) in the AL (first neuropil in the brain that processes olfactory information, homologous to the olfactory bulb in vertebrates; Fig 1.2), suggesting that ORNs with different odor specificities show different spatial pattern or distributions (Couto et al., 2005; Fishilevich and Vosshall, 2005). The AL is the interaction site of ORNs, projection neurons (PNs; dendrites of PNs; about 150-200 PNs described (Stocker et al., 1997)) and local neurons (LNs; mostly inhibitory, intermingles with ORNs and PNs) (Fig 1.2).

ORN activity is not directly relayed on PNs, but modified by the interaction with the LN network (Shang et al., 2007; Wilson and Laurent, 2005; Wilson et al., 2004). Around 100 LNs branch across AL glomeruli, most of which innervate all or most of the glomeruli.

In contrast most PNs are uniglomerular (Marin et al., 2002; Wong et al., 2002). The PNs send their axons to the mushroom body (MBs) and lateral horn (LH) of the protocerebrum (higher centers for odor processing; Fig 1.2). Binding of an odorant to

(8)

6

an OR (in the periphery) leads to a unique temporal and spatial pattern of activity in the brain (AL and MBs), which in turn leads to a behavioral response in flies.

Figure 1.1. Cartoon of Drosophila melanogaster head.

Dorsal view of a cutaway fly head showing the main elements of the olfactory pathway. Odors are sensed by olfactory receptor neurons in the antennae and maxillary palps. These neurons project axons along the antennal nerve to the antennal lobe glomeruli, where they are sorted according to chemosensitivity. From here the information is relayed by projection neurons in the inner and medial antennocerebral tract (iACT and mACT) to the mushroom body and to the lateral horn. Gustatory stimuli are sensed by gustatory receptor neurons in the labellum on the tip of the proboscis, the elongated fly mouthpiece.Adapted from (Keene and Waddell, 2007).

(9)

7

Figure 1.2. Schematic of the adult fly olfactory system circuit.

Olfactory sensory neurons (OSNs) expressing the same receptor (same color) project their axons to the same glomerulus in the antennal lobe. There they probably synapse with at least three classes of interneuron: uniglomerular projection neurons (PNs, same color as directly pre-synaptic OSNs), multiglomerular inhibitory local neurons (iLNs, red) and multiglomerular excitatory local neurons (eLNs, green). PNs form synapses with Kenyon cells in the mushroom body calyx en route to terminating in the lateral horn. Some PNs bypass the mushroom body calyx and project only to the lateral horn. Adapted from (Keene and Waddell, 2007).

Chemosensory receptors

Like other gene families, OR families have expanded over time by gene duplication and divergence. Invertebrate olfaction is mediated by receptor families that are evolutionarily distinct from vertebrate receptors. The genome of the nematode worm Caenorhabditis elegans encodes more than 1,500 predicted GPCRs (Robertson and Thomas, 2006) and most of them are expressed in chemosensory neurons, primarily involved in olfaction and gustation (Troemel et al., 1995). C. elegans also uses non-GPCRs for chemosensation, as receptor-like guanylate cyclases may also function as nematode chemoreceptors (Gray et al., 2004; Yu et al., 1997). OR gene family is the largest gene family in the mammalian genome and is larger than any other gene family in any other species and comprises 1% of genes (Hoover, 2010). Mammalian genome encodes ~ 205- 1200 functional OR genes (Niimura and Nei, 2007) and four types of chemosensory GPCRs are described : 1) odorant receptors, ORs (Buck and Axel, 1991); 2) trace amine associated receptor family, TAAR (Liberles and Buck, 2006); 3) type I vomeronasal receptors, V1Rs (Dulac and Axel, 1995); and 4) type II vomeronasal receptors, V2Rs (Matsunami and Buck, 1997). The number of chemosensory receptor genes in most insects are smaller than in most mammals and more closely approaches the number found in fish (~100 OR genes). Genomic analysis has identified 62 or 79 or 170 ORs and 68 or 72 or 13 gustatory receptors (GRs) in Drosophila melanogaster, Anopheles gambiae and Apis mellifera respectively. Several types of chemosensory receptors are described in insects as well: 1) odorant receptors, ORs (detects food odors and pheremones) including the highly conserved receptor across insect species co-receptor Orco (formerly termed as Or83b in Drosophila) (Clyne et al., 1999; Gao and Chess, 1999; Vosshall et al., 1999); 2) gustatory receptors (GRs; detects taste molecules and CO₂); and 3) ionotropic receptors, IRs (detect ammonia, amines, water vapor and alcohols). ORs and GRs were predicted to have seven transmembrane domains like classical GPCRs (Benton et al., 2006; Clyne et al., 2000; Clyne et al., 1999; Lundin et al., 2007; Zhang et al., 2011), whereas IRs are related to ionotropic glutamate receptors and predicted to contain three transmembrane domains and a pore loop (Benton et al., 2009).

(10)

8 Olfactory signaling

In both vertebrates and nematodes, odor molecules bind with the dedicated GPCRs (ORs), present on the dendritic membrane of the olfactory receptor neuron (ORNs), and activates a signaling pathway that produces intracellular messenger (through a specific G protein) called the metabotropic pathway (canonical signaling pathway). G proteins are important signal transducing molecules in a cell and are heterotrimeric and are composed of three subunits called α, β, γ. When a GPCR activates a G protein, it leads to the disassociation of the heterotrimer into Gα-GTP and Gβγ (heterodimer). Though the specificity in GPCR coupling and effectors activation is provided by the Gα subunits, both Gα-GTP and Gβγ activate different transduction pathways in the cell depending on their particular effectors (Gilman, 1984). The signaling pathways initiated by insect ORs are poorly understood. Though insect ORs were predicted to have seven transmembrane topology reminiscent of classical GPCRs, their topology is inverted (N terminal end of the protein is intracellular and the C terminal end is extracellular; Fig 1.3) and low sequence homology to all known GPCRs (Benton et al., 2006; Clyne et al., 1999; Gao and Chess, 1999; Lundin et al., 2007; Vosshall et al., 1999).

Moreover, insect ORs form heteromeric complexes with a conserved ortholog protein called Orco (Fig 1.3) (Benton et al., 2006; Larsson et al., 2004). It remains unclear whether and if so how insect ORs depend on G proteins for olfactory signaling. Two different hypotheses have been proposed for insect olfactory signal transduction: either insect ORs may act as ligand gated ion channels (ionotropic or noncanonical signaling pathway) or combine an ionotropic and a G protein-dependent pathway (metabotropic pathway) for olfactory signaling (Sato et al., 2008; Smart et al., 2008; Wicher et al., 2008).

However, the involvements of different G proteins in insect olfactory signaling are still enigmatic.

Figure 1.3. Insect olfactory receptors.

In the olfactory receptor neuron of insects, together the ORX (ligand binding OR) a conserved ortholog protein called – Orco (co-receptor) is also expressed. Both ORX and Orco were predicted to have seven transmembrane domains like classical GPCRs but it has an inverted topology; N terminus of the protein is intracellular and the C terminus of the protein is extracellular. Adapted from (Kaupp, 2010).

(11)

9

Olfactory signaling pathways in vertebrates and nematodes

In vertebrate and nematode ORNs the binding of odorants activates a G protein mediated signaling pathway. Once activated, G_olf in vertebrates (also called as G_s) and G_i in nematodes increase the levels of cyclic nucleotides, cAMP and cGMP respectively.

These cyclic nucleotides directly act on the cyclic nucleotides-gated (CNG) channels expressed on the dendritic membranes of the ORNs. Upon activation CNG channels allow the cations to enter into the neurons and which eventually leads to depolarization and generation of the action potential (Kaupp, 2010; Pellegrino and Nakagawa, 2009).

Signal transduction pathway in mammalian ORNs is shown in Fig 1.4.

Figure 1.4. Signal transduction in mammalian olfactory receptor neurons.

The binding of an odorant to the OR activates the trimeric, olfaction-specific G protein (Golf). Activated G protein disassociates to Gα-GTP and Gβγ subunits. The Gα subunit then activates the enzyme; adenylyl cyclase type III (ACIII), which, in turn, catalyzes the conversion of ATP into cyclic adenosine monophosphate (cAMP). Increase in the concentration of the second messenger cAMP leads to the activation of the olfactory cyclic nucleotide-gated channel (CNGC) and a Ca²⁺ activated chloride channel (CaCC). Activation of both channel types finally leads to depolarization. Adapted from (Kaupp, 2010).

Binding of pheromones to V1Rs and V2Rs also activates a G protein mediated signaling pathway (via the G_o/i subgroup of G proteins; Fig 1.5). Once activated V1Rs activates G_i2and stimulates Gβγ mediated calcium signaling, whereas V2Rs activates G_o and also stimulates calcium signaling (Berghard and Buck, 1996; Berghard et al., 1996;

Kaupp, 2010; Lucas et al., 2003).

(12)

10

Figure 1.5. Pheromone signaling in vertebrates.

(A) The binding of a pheromone to a V1R receptor activates Gi, a G protein that is often involved in inhibitory signal transduction pathways. Activated Gβγ subunit then activates a specific enzyme;

phospholipase Cβ2 (PLCβ2), which in turn cleaves the membrane phospholipid - phosphatidylinositol-4,5- bisphoshate (PIP2) into inositol-1,4,5-trisphoshate (IP3) and diacylglycerol (DAG). DAG then activates the transient receptor potential cation channel C2 (TRPC2), which mediates the influx of Na⁺ and Ca²⁺ ions and thus leads to the depolarization. (B) The binding of a pheromone to V2R receptor activates Go, a trimeric G protein involved in diverse signal transduction pathways. The activated Gα subunit is thought to play a role in signaling and activates TRPC2 channel and leads to the depolarization. But the mechanism by which the Gα subunit activates the channel is unknown. Adapted from (Kaupp, 2010).

Olfactory signal transduction in insects

In order to understand the signaling mechanisms of insect ORs, several researchers turned towards the expression of insect ORs in heterologous cells systems (in vitro) while others investigated these mechanisms in the native tissue (in vivo). Results of these experiments proposed contradicting models for olfactory signaling – the ionotropic or metabotropic or combined pathways.

Ionotropic signaling pathway

Some studies support the idea that insect ORs acts as ligand gated ion channels.

Both ORs and Orco were predicted to contribute to the pore of the odor gated ion channel complex (Nakagawa et al., 2012; Nichols et al., 2011; Pask et al., 2011; Sato et al., 2008). Sato et al., expressed ORs from various insects (fruit fly, mosquito and silk moth) together the co-receptor Orco in heterologous cell systems (HEK293 and HeLa cells) and characterized a fast ionotropic response, mediated by several odorants. The

(13)

11

fast ionotropic response persisted in the presence of second messenger inhibitors (e.g. a PLC inhibitor) or general G protein inhibitors (such as GDPβS), which led the authors to conclude that odor evoked currents mediated by insect ORs signal via a G protein independent pathway. Also they found no evidence for odor stimulated cAMP production. Further they showed that the specific subunit composition governs the biophysical properties of the OR/Orco receptor, suggesting that these proteins function as a complex to form an odor gated ion channel whose initial activation does not depend on G protein signaling (Sato et al., 2008). By expressing Drosophila OR (Or43b) together Orco in an insect cell line (Sf9 cells), Smart et al., found that inhibitors of the second messengers activated by Gα_q or Gα_s pathways and general a G protein inhibitor GDPβS did not block odor evoked calcium increases but changed the inactivation kinetics, which made the authors to conclude that Drosophila ORs are unlikely to be a member of GPCR superfamily proteins and in HEK cell they signal via non selective cation channels in the plasma membranes, without the involvement of G proteins (Smart et al., 2008). Wicher et al., expressed Drosophila OR (Or22a) together with Orco in HEK293 cells and found that odors evoke a fast ionotropic current independent of G proteins and a slow late response dependent on G proteins (involvement of cAMP, implicating a metabotropic pathway mediated by Gα_s). Also odor evoked currents persisted in the presence of the general G protein inhibitor GDPβS, but the cells were less sensitive to odorants. These results made the authors to conclude that ligand-bound ORs couple to Gα_s (although any direct interaction was not shown) which produces cAMP, which in turn activates Orco (which, as they hypothesize, has the properties of cAMP-gated nonselective cation channels). A model proposed from these experiments is that ORs function as GPCRs and Orco functions as an ion channel (Wicher et al., 2008). Yao et al., studied the involvement of G proteins in Drosophila OR signaling in vivo by loss or gain of function of G proteins (using RNAi constructs, competitive peptides and constitutively active Gα protein constructs). Through single sensillum recordings (SSRs) they found that in these mutant conditions the odor evoked spike activity was unaffected when compared to control flies (although Gα_q mutants exhibited a ca. 30%-reduced response, the authors considered it to be insignificant). These results made the authors to conclude that ORs rely on ligand-gated ionotropic signaling mechanisms that require Orco (Yao and Carlson, 2010). These four independent research groups support that insect ORs act as ligand gated ion channels and do not require G proteins (except that Wicher et al.

propose the involvement of G proteins as well) for olfactory signaling.

(14)

12 Metabotropic signaling pathway

In insects, especially in fruit flies and moths, involvement of Gα_s and Gα_q pathways in odor and pheromone detection was reported. Also there is an evidence for the involvement of Gα_o in olfactory signaling.

Gα_q mediated signaling

The evidence for the involvement of Gα_q pathway is mostly provided for the pheromone transduction of moths, but also involvement in general odor detection has been shown. Pheromone transduction in moths depends on PLCβ (phospholipase C β).

PLCβ hydrolyzes phospholipids generating IP₃ and DAG. A rapid transient rise of IP₃ was observed in the antennal tissue of moths upon pheromone and general odorant stimulation (Boekhoff et al., 1993; Breer et al., 1990). Also perfusion of cultured ORNs from M. sexta with IP₃ mimicked pheromone-dependent currents (Stengl, 1993; Stengl, 1994). Apart from IP₃, DAG was also shown to play a role in insect olfaction. DAG acts as an activator of PKC (protein kinase C) or as an activator of TRP channels (transient receptor potential type ion channels). Application of DAG in in situ, in vitro tip recordings and patch clamp recordings depolarized ORNs or activated depolarizing inward currents in B. mori, A. polyphemus, and M. sexta (Maida et al., 2000; Pophof and Van der Goes van Naters, 2002). Changes in the levels of membrane-bound phospholipids have also been shown to alter the primary response to odorants in crustaceans (Zhainazarov et al., 2004). Mutations in the Drosophila dgq gene encoding the G_q subunit was shown to reduce odor responses across to different concentrations in D. melanogaster (in vivo; SSR) and the responses were further attenuated by additional mutations in plc21C, a gene encoding for a PLCβ (Kain et al., 2008). Further, knockdown of Gα_q by targeted RNA interference (RNAi) resulted in behavioral deficits in Drosophila (Kalidas and Smith, 2002). The Gα_q pathway was also shown to regulate the function of the co-receptor Orco. Orco phosphorylation via PKC was shown to regulate the sensitivity of OR to cAMP and therefore to odorants. The metabotropic pathway affecting the phosphorylation state of Orco is proposed to regulate OR function and thereby shapes the odor response of ORNs (Sargsyan et al., 2011). The metabotropic regulation of Orco was proposed as a key mechanistic difference between ORs and IRs (Getahun et al., 2013).

Gα_s mediated signaling

Gα_s activates the cAMP dependent pathway by stimulating the production of cAMP from ATP. cAMP is shown to be involved in insect OR transduction. cAMP activated currents were described in cultured olfactory receptor neurons of the moth

(15)

13

Manduca sexta (Krannich and Stengl, 2008). Drosophila ORs have been shown to stimulate cAMP production, which in turn activates the co-receptor Orco (Wicher et al., 2008).

Manipulating the levels of cAMP changed the kinetics of odor response in heterologously expressed Drosophila ORs (Smart et al., 2008). Expression of cholera toxin (CTX; ribosylates the Gα_s subunit of heterotrimeric G proteins) or GTPase defective (constitutively active) Gα_ssubunit in Drosophila ORNs led to abolishment of firing frequency of the ORNs and prolonged the duration of spike activity, respectively, compared to the control flies (Deng et al., 2011). Heterologous expression of a Drosophila OR (Or43a) together the co-expression of chimeric Gα_s and Orco led to a calcium increase upon odor stimulation (Deng et al., 2011). cAMP produced by the activation of other receptors in dendrites apart from ORs was also shown to be involved in odor responses. Endogenous circadian rhythms of cyclic nucleotides, generated by varying octopamine levels, contribute to the control of the intracellular Ca²⁺ concentrations in ORNs from Manduca sexta, and generate more sensitive pheromone responses during the night (Flecke et al., 2010; Flecke and Stengl, 2009).

Other G protein mediated signaling

The majority of the studies indicate a role of Gα_s or Gα_q in insect olfactory signaling. The role of other Gα subunits and of the βγ heterodimer is largely unknown.

Only a few studies focused on the role of the G_o/i subgroup of G proteins in olfactory signaling. Chatterjee et al., showed that flies with reduced levels of the Gα_o subunit had a reduced odor response regardless of odor identity and intensity (measured as the spike activity and EAG amplitudes) (Chatterjee et al., 2009), whereas Yoa et al., and Deng et al., showed that reduced or higher levels of Gα_o or Gα_i subunits in Drosophila ORNs had no effect on odor response (measured as the spike activity and or EAG amplitudes) (Deng et al., 2011; Yao and Carlson, 2010). However, co-expression of almost all Gα subunits (Gα_s, Gα_q, Gα_o, Gα_i and Gα_f) encoded by the Drosophila genome together with Or43a and Orco in a heterologous cell system was shown to induce calcium increase upon odor addition (Deng et al., 2011).

Although these results are mutually contradicting, it could be possible that insects use multiple signaling pathways for odor transduction. Much remains to be done to provide detailed and consistent data for an integrated model for olfactory transduction. First the role of all G proteins encoded by the insect genome or those expressed on the dendrites of the ORNs should be known. For example very little is known about the role of G_o/i subgroup of G proteins in olfactory signaling of insects.

G_o/i subgroup of G proteins is shown to play a role in pheromone signaling in vertebrates. But, to date the involvement or a role of G_o/i subgroup of G proteins in insect olfactory signaling is greatly unknown. Second whether all ORs activate a same G

(16)

14

protein or not should be known. It may be possible that different ORs activate different G proteins and also a G protein can be activated to a varying degree. Most studies in the literature mutated the G proteins in all ORNs. But in order to address the above hypothesis mutation of G proteins should be targeted to a receptor of interest.

Objectives of this study

The major objective of this work is to study the role of G proteins in olfactory signaling of insects. Drosophila odorant receptors, Or22a and Or92a were used as the model for insect ORs and the role of G proteins in olfactory signaling was studied by combing in vivo and in vitro methods. I developed an in vitro olfactory receptor assay for insect ORs as a tool to study G proteins in olfactory signaling. This assay is explained in detail in Chapter 2. With this assay, screening of the molecules involved in signal transduction can be studied by excluding any possible indirect interactions. This assay is used to study the role of G proteins (G_o/i subgroup) in heterologously expressed Drosophila odorant receptors (dOr22a and Orco). Any role of the G_o/i subgroup of G proteins in insect olfaction is largely unknown. I studied a role of the G_o/i proteins in olfactory signaling of Or22a neurons by using a combined behavioral, in vivo (calcium imaging of dendro-somatic compartment) and in vitro (calcium imaging of Drosophila ORs expressed heterologously) approach. My key findings were that G_o and G_i contribute to odor responses both for the fast (phasic) and for the slow (tonic) response component;

these results are discussed in Chapter 3. It should be noted that the odor responses were reduced but not abolished when the levels of G_oor G_i is reduced in Drosophila ORNs (Or22a neurons). Two possibilities may explain the results observed, reduction of these proteins was not complete or these proteins indicate only a part of the transduction cascade (other G proteins may play a role). Also the results suggest that different ORs may activate G_o/i subgroup of G proteins to a varying degree. From these results two hypotheses can be proposed: 1) G_o/i subgroup of G protein can be activated to a varying degree by different ORs and 2) Other G proteins may involve in olfactory signaling other than G_o/I subgroup. G_o elicited strongest effect than G_i in native tissue (antenna), hence as a first step towards understanding the first hypothesis, I tested the role of G_o in olfactory signaling of Or92a neurons. In order to test the second hypothesis, G proteins that are expressed in the dendrites of Drosophila ORNs other than G_o/i - G_s, G_q(Boto et al., 2010; Deng et al., 2011) will be the best suited target protein for the study.

Involvement of G_q in insect olfactory signaling is supported by most evidences in the literature than G_s. Hence I tested the role of G_qin olfactory signaling. I studied a role of G_o or G_q or both proteins in olfactory signaling of Or92a neurons by using an in vivo (calcium imaging of dendro-somatic compartment and axon terminals) approach. My key findings were that G_o and G_q modulates the odor response in the periphery and plays a

(17)

15

role in pre-synaptic excitation and inhibition; these results are discussed in Chapter 4.

The results of the experiments explained in Chapter 3 and 4 suggest that an OR can activate a G protein to a varying degree and also an OR can activate more than one G protein for olfactory signaling. Hence the olfactory transduction may remain ORN specific. Nevertheless the olfactory system uses a combinatorial receptor coding scheme to encode odor identities. Hence apart from understanding the proteins involved in olfactory signaling, it is important to know more about the combinatorial odor coding.

In order to know more about the combinatorial odor coding, response profile of all ORs should be known. Though Drosophila ORs were studied extensively the olfactome is still incomplete. The response profiles of few ORs are not known yet and one of them is Or69a. By using the in vivo calcium imaging technique, I also characterized the molecular receptive range of the Drosophila odorant receptor Or69a. My key findings were that Or69a is a broadly tuned receptor and the best ligands belong to the chemical group of terpenes; these results are discussed in Chapter 5.

From our studies we could conclude that different olfactory receptors use G proteins to a varying degree for olfactory signaling, for e.g. reduced levels of G_o/i subgroup of G proteins in Or22a neurons reduced odor response, whereas reduced levels of G_o in Or92a neurons enhanced the odor response. Also we found that an OR can activate more than one G protein upon odor binding, for e.g. Or92a neurons activates both G_o and G_q. In general we could conclude that insects use multiple pathways for olfactory signaling and activates diverse G proteins upon odor detection.

(18)

16

CHAPTER 2 In vitro olfactory receptor assay

2.1 Abstract

Insect olfactory receptors (ORs) have seven transmembrane domains like the classical G protein coupled receptors (GPCRs) but they have a low sequence homology to the known GPCRs. Moreover insect ORs have an inverted membrane topology. Due to these reasons it is not clear whether insect ORs depend on G proteins for olfactory signaling. Recently several studies focused on this issue by combining in vivo and in vitro techniques in an attempt to make a step towards understanding the olfactory signal transduction in insects. Here, we report an in vitro assay for Drosophila ORs using calcium imaging in HEK293T cells. We transiently expressed two pairs of dORs (dOr22a and Orco or dOr92a and Orco) in HEK293T cells to validate the assay. The transfection efficiency of dORs was about 50% and the majority of the transfected cells (greater than 60%) responded to the odor by increasing the levels of intracellular calcium. Calcium response to the odor was transient and reproducible and required co-expression of Orco.

The response was dose-dependent and the expression of corresponding OR and the co- receptor (Orco) was sufficient for its induction; expression of odorant binding proteins (OBPs) or downstream signal transduction elements were not required. Every cell in an experiment was sorted and analyzed separately by a semiautonomous method. This assay can be used to study the involvement or interaction of G proteins with dORs and their role in olfactory signaling.

2.2 Introduction

Olfactory receptors are responsible for transduction of extracellular signals, enabling a cell or organism to respond to an environment. Role of G proteins in olfactory receptor transduction remains unclear. In order to understand the role of G proteins in olfactory signaling of insect ORs we aimed to develop an in vitro olfactory receptor assay for Drosophila ORs (dORs) – the odor induced calcium imaging of HEK293T cells expressing dORs.

Assays for vertebrate ORs have been developed in yeast, Xenopus oocytes, HEK293 cells (human embryonic kidney cells), COS-7 cells (derived from the kidney of the African Green Monkey, Cercopithecus aethiops: resembles fibroblast cells in humans)

(19)

Chapter 2. Introduction

17

and Sf9 cells (a clonal isolate of insect Spodoptera frugioerda Sf21 cells) (Knight et al., 2003;

Krautwurst et al., 1998; Levasseur et al., 2003; Matarazzo et al., 2005; Mezler et al., 2001;

Minic et al., 2005; Wetzel et al., 1999). Similar methods were also used to characterize insect ORs. Xenopus oocytes, HeLa cells (derived from human cervical cancer cells), HEK293 cells , S2 cells (Schneider 2 cells, derived from a primary culture of late stage (20–24 h old) Drosophila melanogaster embryos) and Sf9 cells were used for heterologous expression and the receptors were characterized by electrophysiological (voltage clamp) (Nakagawa et al., 2012; Nichols et al., 2011; Wetzel, 2001) or by calcium imaging (Grosse-Wilde, 2006; Grosse-Wilde et al., 2007; Kiely et al., 2007; Neuhaus et al., 2005;

Smart et al., 2008) or by both techniques (Sato et al., 2008; Wicher et al., 2008).

These assays were used to determine ligands for orphan receptors, used to study the molecules involved in olfactory transduction, used to study the channel properties of ORs including the characterization of the ion conducting pore, used to characterize Orco, used for structural studies and the heterologously expressed ORs were also used as an electronic nose sensor. The receptor for honey bee queen pheromone component 9- oxo-2-decenoic acid was identified through heterologous expression (Xenopus oocytes) (Wanner et al., 2007) and was used to characterize the ORs from B. mori (Or1 and Or3) in the presence or absence of Orco (BmOr2) (Nakagawa et al., 2005). Also the identity of a putative pheromone receptor of H. virescences was confirmed by heterologous expression (HEK293 cells, calcium imaging) (Grosse-Wilde et al., 2007). In recent years heterologous expression of insect ORs was used to study the mechanisms of insect olfactory signaling. ORs belonging to various groups of insects (D. melanogaster, A.

gambiae, B. mori) were expressed in heterologous cell system (Xenopus oocytes, HEK293, HeLa and Sf9 cells) and by using electrophysiological or calcium imaging techniques, the role of second messengers activated by different groups of G proteins in OR signal transduction cascades was studied (Deng et al., 2011; Sargsyan et al., 2011; Sato et al., 2008; Smart et al., 2008; Wicher et al., 2008). Also the ion conducting pore of Drosophila ORs (dORs) and Anopheles gambiae ORs (AgORs) including Orco was characterized through heterologous expression (Xenopus oocytes, electrophysiology for dORs (Nakagawa et al., 2012; Nichols et al., 2011) and HEK cells, calcium imaging and electrophysiology for AgORs (Pask et al., 2011)). By using this assay Orco agonist and antagonist was first described and characterized (HEK293 T-Rex cells, electrophysiology and calcium mobilization assays (Jones et al., 2011; Jones et al., 2012)), the channel properties of Orco were characterized (Nakagawa et al., 2012; Nichols et al., 2011; Pask et al., 2011; Sato et al., 2008; Wicher et al., 2008) and also the metabotropic regulation of Orco was described (Sargsyan et al., 2011). The membrane topology of insect ORs were predicted by this assay (Smart et al., 2008; Tsitoura et al., 2010) and also the dimerization of Drosophila ORs was elucidated by this assay (Neuhaus et al., 2005). Moreover

(20)

18

heterologously expressed Drosophila ORs was used as an electronic nose sensor and was shown to have broad range of sensitivities than other sensors like metal oxide E-nose sensors (Berna et al., 2009). In these studies insect ORs were expressed alone (Berna et al., 2009; Kiely et al., 2007; Smart et al., 2008) or with Orco (Deng et al., 2011; Nakagawa et al., 2012; Neuhaus et al., 2005; Nichols et al., 2011; Pask et al., 2011; Sato et al., 2008;

Tsitoura et al., 2010; Wanner et al., 2007; Wicher et al., 2008) and with (Grosse-Wilde et al., 2007; Jones et al., 2011; Jones et al., 2012; Wetzel, 2001) or without exogenous G proteins.

Expression of insect ORs in Xenopus oocytes requires longer time; further, only transient expression is possible. In contrast, mammalian or insect cell lines permit both transient and stable expression of insect ORs. Transient expression of ORs can be achieved in 1-2 days, which is much shorter when compared to expression in oocytes (4- 7 days). Electrophysiological experiments alone can be used to characterize insect ORs in Xenopus oocytes, whereas both electrophysiological and calcium imaging techniques can be used to characterize insect ORs in cell lines. For the electrophysiological experiments, Xenopus oocytes are best suited, because of their large size (~1 mm); handling and manipulation of the oocytes is also easy. Xenopus oocytes and mammalian or insect cell lines have their own advantages and disadvantages as an expression system for insect ORs. Mammalian or insect cell lines are well suited for the expression of insect ORs when time is considered as a major factor for expression and non electrophysiological experiments are preferred for functional studies (e.g. calcium imaging).

Only very few studies deal with insect ORs expressed in insect cell lines (Sf9 or S2 cells) when compared to mammalian cell lines. Insect cell lines would appear overall more suited for expression of insect ORs. However, although the transfection efficiency of insect and mammalian cell lines are comparable, the percentages of cells responding to odorants were much lower in insect cell lines (~4% of cells responded to an odor (Kiely et al., 2007)). Thus HEK293 and HeLa cells are largely used to express insect ORs (Deng et al., 2011; Sato et al., 2008; Smart et al., 2008; Wicher et al., 2008). Some studies used modified HEK293 cells (Flp-In T-Rex293/Gα₁₅) for functional studies (Grosse- Wilde, 2006; Grosse-Wilde et al., 2007). For functional studies in mammalian cell lines insect ORs were expressed alone or together with the co-receptor (Orco) and with or without the exogenous G proteins (Deng et al., 2011; Grosse-Wilde, 2006; Grosse-Wilde et al., 2007; Neuhaus et al., 2005; Sato et al., 2008; Smart et al., 2008; Wicher et al., 2008).

Expression of Orco together with OR was shown to enhance the sensitivity of the response up to 1000 fold (Neuhaus et al., 2005; Wicher et al., 2008).

We used HEK293T cells as a heterologous system for the functional studies of dORs. HEK293T cells are similar to the parental HEK293 cells but they stably express the SV40 large T antigen. We transiently transfected the cells with dOR and Orco but

(21)

19

not any exogenous G proteins. For the validation of the assay we expressed dOr22a and Orco or dOr92a and Orco and measured odor-induced calcium changes. About 50% of the cells were transfected with dORs and most of the transfected cells were functional (about 30% of cells responded to odor which is about 60% of transfected cells). For efficient OR expression, co-expression of Orco was required. Single cells were analyzed semiautonomously using user-defined workflows in the KNIME software (Konstanz Information Miner - http://www.knime.org/). This approach is highly efficient and less time consuming than the nonautonomous analysis methods described in the literature (Kiely et al., 2007; Smart et al., 2008). Odor responses were significant and reproducible.

This assay can be used in future to study the role of G proteins in olfactory signaling or to de-orphanize receptors or to study the mechanisms of odor adaptation. In this chapter detailed explanation of the technique is provided and in the next chapter by using this method as one of the techniques we studied the role of G proteins (G_o/i subgroup) in olfactory signaling of dORs (dOr22a and Orco).

2.3 Materials and Methods

2.3.1 Materials and reagents

Odorants; ethyl butyrate (EtBE) and 2, 3-butanediol (BDOL) were purchased from Sigma-Aldrich (Taufkirchen, Germany) at the highest purity available. Probenecid (lyophilized powder; 250 mM stock solution was prepared in assay buffer), pluronic acid (20% solution in DMSO), fluo-4 acetoxymethylesters (AM) – 1 mM solution in DMSO, Dulbecco's Modified Eagle Medium (DMEM), Opti-MEM reduced serum medium, penicillin/streptomycin, lipofectamine, 1 M HEPES, 1 X HBSS and DAPI were purchased from Invitrogen (www.invitrogen.com/GIBCO). HEK293T cells were a kind gift from the group of Prof. Marcel Leist, Department of biology, University of Konstanz, Germany. Fetal calf serum (FCS) and ionomycin (calcium ionophore) was purchased from PAA (Velizy-Villacoublay, France) and Sigma-Aldrich respectively. Live cell calcium imaging was performed in sterile µ-dishes, 35 mm high – (ibi treat, tissue culture treated) purchased from ibidi (Münich, Germany). Protease inhibitors (complete protease inhibitor cocktail), nitrocellulose membrane (Protran BA83), western bright ECL kit, X ray films and microscopic mounting solutions were purchased from Roche (Indiana, USA), Whatman (New Jersey, USA), Advansta (California, USA), Fujifilm super RX (Tokyo, Japan) and Merck (Darmstadt, Germany) respectively. α-GFP primary antibody and mouse secondary antibodies were purchased from Molecular probes (Eugene, USA) and Genscript (New Jersey, USA) respectively.

Odorant stock solutions were prepared freshly every time in the assay buffer (for EtBE) or in Dimethyl sulfoxide (DMSO; for BDOL) at 100 mM. The desired odorant

(22)

Chapter 2. Materials and Methods

20

concentration was prepared by serial dilution of stock odorant solution in assay buffer.

Final concentration of DMSO added to the cells was 0.1%. Assay buffer was prepared by adding 1 part of 1 M HEPES to 49 parts of 1X HBSS. The pH of the buffer was adjusted to 7.3 with NaOH.

2.3.2 Expression vector

The constructs encoding for the odorant receptors of Drosophila melanogaster - pCDNA3-dOr22a-GFP and pCDNA3-dOr83b-GFP (C-terminal fusion constructs) were kindly provided by the lab of Prof Eva M Neuhaus, Charité – Universitätsmedizin Berlin, Germany. Sequence information of the receptor can be found in Neuhaus, Gisselmann et al. 2005. The plasmid pCDNA3.1(+)-dOr92a was constructed by inserting the synthesized cDNA sequence (1264bp; custom made gene synthesis by Eurofins MWG operon - http://www.eurofinsgenomics.eu) of D. melanogaster Or92a (Genebank accession code: NM_079690) into the multiple cloning sites of the pCDNA3.1(+) vector (Invitrogen) using the restriction enzymes HindIII (5’) and EcoRI (3’). The sequences were verified via DNA sequencing of both strands and the sequence convergence was 100%.

The plasmid encoding odorant receptor dOr67d (PCR2.1-Or67d) was a kind gift from Prof Dr Dean Smith, Department of Pharmacology and Center for Basic Neuroscience, University of Texas Southwestern Medical Center, Texas, USA (Ha and Smith, 2006). The coding sequence of Or67d was cut with BamHI (5’) and XbaI (3’) from PCR2.1-Or67d vector and inserted into pCDNA3.1(+) vector linearized with BamHI and NheI; to obtain the vector pCDNA3-dOr67d suitable for expression in HEK cells. The sequences were verified via DNA sequencing of both strands and the sequence convergence was 100%.

cDNA clones for the gustatory receptors Gr64c, d and e were obtained from the Drosophila Genomics Research centre (DGRC; https://dgrc.cgb.indiana.edu/vectors/;

ID: AT2207 (for Gr64d and e) and IP02441 (for Gr64c)). Gr64d and Gr64e cDNA were cut with respective pairs of restriction enzymes: EcoRI and MfeI and Pcil and XhoI.

Subsequently the inserts were cloned into pCDNA3.1(+) vector linearized with EcoRI and XhoI and EcoRV and XhoI for Gr64d and Gr64e respectively. To provide compatible ends, sticky ends produced by MfeI and PciI in case of Gr64d and e and XhoI in case of pcDNA3.1(+) were blunted before digestion by the second enzyme by filling the overhang using the polymerase activity of Klenow fragment. Sequence analysis was performed as described before. The cDNA clone obtained from DGRC for Gr64c had a missense mutation (found from the sequence information available at DGRC) which would lead to the production of truncated receptor. Hence by means of site directed mutagenesis (SDM) we introduced the two missing nucleotides (“TT”) in the

(23)

21

right position in the cDNA clone using primers: sense –

“CTAAGGAGATTTCCTACACCCTATACGAAATACC”, antisense –

“TATAGGGTGTAGGAAATCTCCTTAGCCTCTTGCG” before cloning. Insertion of the nucleotide was analyzed by sequencing. Vector containing corrected version of Gr64c cDNA was digested with NurI and XhoI and cloned into pCDNA3.1(+) vector linearized with EcoRV and XhoI. Sequence analysis was performed as described before.

2.3.3 Cell culture and transient transfection of HEK293 cells

HEK293 cells were maintained as an adherent culture in DMEM supplemented with 10% FCS and penicillin (100 units/ml final concentrations)/ streptomycin (100 µg/ml) at 37°C and 5% CO₂. For transfection HEK293 cells were cultured at a density of ~1x10⁶ cells per well in a six well plate and transiently transfected with plasmids (2 µg/ml) encoding the receptors (pcDNA3-dOr22a-GFP and pcDNA3-dOr83b (Orco)- GFP or pCDNA3.1(+)-dOr92a and pcDNA3-dOr83b (Orco)-GFP) or control plasmid (pCDNA3.1(+); mock transfected cells) using 14 µl/ml of transfection reagent (lipofectamine) according to the manufacturer's protocol. Cells were washed twice in sterile PBS and split at 1:5 ratio after 8–12 h post-transfection into µ-dishes and imaged 48 h post-transfection.

2.3.4 Western blot

HEK293T cells were harvested two days after transfection (dOr22a, Orco, dOr22a and Orco and mock-transfected cells) with ice cold homogenization buffer (50 mM HEPES and 0.2 mM ethylene glycol tetraacetic acid (EGTA)) supplemented with protease inhibitors and homogenized using a dounce homogenizer. Cell debris and nuclei were removed by centrifugation at 2000g, 5 min, 4°C; supernatant was further collected and re-centrifuged at 18,000g 1 h. The resultant membrane pellet was solubilized in resuspension buffer (50 mM HEPES, 0.2 mM EGTA, 5 mM MgCl₂ and 100 mM NaCl). Concentration of the protein was measured using the standard Bradford assay and equilibrated. About 10 µg of the sample (protein) were loaded on 10% SDS- PAGE gels, transferred to a nitrocellulose membrane. The nitrocellulose membranes were blocked with PBS (137 mM NaCl, 2.7 mM KCl, 10 mM Na₂HPO₄.2*H₂0 and 2 mM KH₂PO₄, pH 7.4) containing 5% non-fat dry milk and incubated for 1 h with mouse monoclonal α-GFP antibody diluted 1:1000 in the blocking buffer. After 3 times washing in PBS, membranes were incubated 1 h with mouse secondary antibodies coupled to HRP diluted 1:10,000. Detection was performed with ECL and X ray films.

(24)

22 2.3.5 Cell staining

After 8 h of transfection cells were split and cultured on the poly-L-lysine coated 12 mm round cover slips in 12 well plates. After two days post-transfection cells were washed 3 times with PBS and 1 ml of 4% paraformaldehyde solution in PBS was added to each well. Cells were fixed for 20 min and washed with PBS (3X). 300 µl of DAPI (nuclear stain) solution (300 nM in PBS) was added to each well and incubated for 5 min.

Cells were rinsed with PBS several times to remove the excess dye. Excess of buffer on the cover slips was drained and they were subsequently mounted on a microscopic glass slide using mounting solution.

2.3.6 Calcium imaging

HEK293T cells in µ-dishes were washed twice with assay buffer. 1 ml of assay buffer containing 2 µM Fluo-4 AM, 0.01% pluronic acid and 2.5 mM probenecid was added to each dish and incubated at 37°C for 45 min. The Fluo-4 solution was removed and the cells were washed twice with 1 ml of assay buffer. The dishes were then incubated with 900 µl of assay buffer for further 30 min at 37°C prior to calcium imaging. Fluorescence images were acquired through the bottom of the dish using an inverted laser scanning confocal microscope (LSM 510 Meta; Carl Zeiss, Oberkochen, Germany) equipped with air objective (20x objective, NA = 0.5; Carl Zeiss). Excitation wavelength was 488 nm, which was generated by HFT 488 filter and was filtered by NFT 490 nm filter and detected by the longpass filter 505 nm. For every image the detector gain was adjusted to avoid saturation on PMT detector. We imaged with an acquisition rate of 0.2 Hz for 250 s for all experiments except for increasing odor concentration experiment (same cells tested at different concentration of an odor); 0.2 Hz for 550 s. 100 µl of desired odorant and concentration (for e.g. 100 mM of EtBE was added and final concentration of the odorant tested is 10 mM) or the solvent (assay buffer; control) was added to the cells in 900 µl of buffer between 10^th and 11^thframe or between 10^th and 11^th, 40^th and 41^thand70^th and 71^thframes for experiments with multiple concentrations. To determine the maximal fluorescence of the cells, ionomycin (final concentration is 2 µM) was added at the final stage of experiment (between 40^th and 41^th frame or between 110^th and 111^th frame).

2.3.7 Data analysis

Images were analyzed using user-defined workflows in the open source software KNIME. Prior to analysis, the background fluorescence of the images (area of the image excluding the area of the cells; gray colored area in Fig 2.1A) was subtracted from the mean fluorescence intensity (average intensity of the whole cell) of each cell in the frame.

Baseline (Bo) was calculated as an average fluorescence intensity of first ten frames

(25)

23

before any application. Maximum fluorescence intensities achieved upon addition of odor solution or control buffer (11^th - 39^th frame) and ionomycin (40^th - 50^th frame) were expressed as Roand Ri respectively. Fluorescence intensity before ionomycin addition (39^th frame) was expressed as Bi. Odor and ionomycin (relative to odor response) mediated calcium responses were calculated as Ro/Bo and Ri/Bi respectively. For increasing odor concentration experiments maximum fluorescence intensity after 1^st, 2^nd and 3^rd odor presentations and ionomycin addition was expressed as Ro¹(11^th - 39^th frame), Ro² (41^st– 70^th frame), Ro³(71^st and 100^thframe) and Ri (110^th - 111^th frame) respectively. Fluorescence intensities before each addition of odor solution (9^th, 40^th and 70^th) and ionomycin addition (99^th frame) were expressed as Bo¹, Bo², Bo³ and Bi respectively. Odor and ionomycin mediated calcium responses were calculated as Ro¹/Bo¹, Ro²/Bo², Ro³/Bo³ and Ri/Bi respectively. Though two of the receptors used in this study were tagged to GFP, GFP-positive cells were indistinguishable from non- transfected cells in the experiment, because the excitation and emission wavelengths of Fluo4-AM used in these experiments are overlapping with those of GFP.

To distinguish between the spontaneous fluctuations of the Ca²⁺ levels in the cells and an induced response, we set the threshold value of Ro/Bo equal 1.5. This value was calculated from the measurements of mock-transfected cells, in which the relative Ca²⁺ increase upon addition of odor solution did not exceed this value. Hence in each experiment the cells with Ro/Bo value below the threshold were grouped as non- responders and those above it were considered responding cells (Fig.2.1B). Additionally, the few aberrant or possibly dead cells with either unusually low Bo levels (<3000 AU) or minimum relative response to ionomycin (Ri/Bi < 1.5) were also excluded from calculation.

Figure 2.1 Data analysis.

(A) Example image of an experiment from KNIME segmentation viewer. Grey colored areas indicate the background fluorescence of the image and individual cell are filled with other colors. (B) Plot of basal

(26)

24

response (Bo) of the cells (X-axis) against odor response (Ro/Bo; Y-axis). Red circles and green triangles indicate transfected (dOr22a and Orco) and control group (mock transfected) of cells, respectively. Cells with very low baseline values (fluorescence intensity <3000 arb.u., left from vertical dashed line on the panel) were excluded from the analysis. Ro/Bo value of 1.5 is used as a threshold to distinguish responding (Ro/Bo>1.5, above horizontal dashed line on the panel) and non-responding (Ro/Bo<1.5, below horizontal dashed line on panel) cells.

The cell responses were not normally distributed, demonstrating a right-skewed distribution instead. Transformation using log function also produced right skewed distribution in most cases. Therefore, results were given as median with 25% and 75%

quintiles (log transformed); n represents the number of cells from 10–12 different experiments of 4–6 independent transfections. The evaluation of statistical significance of differences was tested with Kruskal-Wallis rank sum test (comparison between more than two groups), two way ANOVA (concentration and plasmid used as a factor) and chi-squared test (for comparisons between proportions). Multiple comparisons were performed by posthoc multiple comparisons and Tukey HSD tests. Statistical analysis and plots were done in R (http://www.r-project.org/).

2.4 Results

2.4.1 Analysis of expression of dOr22a and Orco in HEK293T cells

Transient transfection of HEK293T cells and subsequent expression of insect odorant receptors (ORs) have been previously used to study the molecules involved in insect OR signaling (Deng et al., 2011; Sato et al., 2008; Smart et al., 2008; Wicher et al., 2008). We transiently co-transfected HEK293T cells with Drosophila odorant receptors:

either dOr22a (tagged with GFP) or dOr92a (non-tagged) together with the co-receptor Orco (tagged with GFP). The expression levels of the dORs and their localization were examined either by microscopical analysis of GFP positive cells or by quantification of the expression levels of the proteins by Western blotting. For expression (analysis and localization of the ORs within the cell) only analysis of dOr22a (fused to GFP at the C- terminal end) was used but not of dOr92a, because the latter was not tagged and there is no antibody available for this receptor.

To study the receptor localization, the cells were fixed 48 h post-transfection and imaged using a confocal laser microscope. GFP positive cells were counted manually and the transfection efficiency was found to be 52±3% (mean±s.e.m., n=12 different experiments, from three independent transfections). Most of the GFP fluorescence was observed in cytoplasm, and a fraction of the protein was also observed at the plasma membrane (Fig 2.2A). To confirm plasma membrane localization, we isolated membranes from cells expressing dORs. The sample showed GFP-positive bands on

(27)

Chapter 2. Results

25

Western blots corresponding to the ~70 kDa proteins (Lane2; Fig 2.2B), which is close to the calculated molecular weight of dORs fused to GFP (dOr22a-GFP ~74 kDa and Orco-GFP ~81 kDa). Cell membranes of non-transfected HEK293T cells show no unspecific bands (Lane1; Fig 2.2B). These results indicate that dORs are expressed in HEK293T cells and trafficked to the plasma membrane, but it is not clear whether the cells expressed dOr22a or Orco alone or both together, as the two receptors could not be separated on the Western blots

Figure 2.2. Expression of dORs in HEK393T cells.

(A) Confocal image of HEK293 cells transfected with dOr22a and Orco (48 h post transfection). Right, middle and left image shows the pattern of GFP expression, DAPI staining (nuclei), and the overlay respectively. (B) Western blots of receptor-transfected and mock transfected HEK293T cell membranes showing the expression of dORs (GFP staining; left blot); β-tubulin was used as the loading control (right blot).

2.4.2 Expression of dOr22a in HEK293T cells requires co-expression of Orco In the above experiment we were not able to resolve the bands respective to dOr22a or Orco in case of their simultaneous expression. Hence, we transiently expressed the cells with dOr22a or Orco alone or both receptors together. Anti-GFP staining of HEK293T cell membranes showed GFP positive bands at ~70 kDa on the lanes loaded with Orco alone or dORs (dOr22a and Orco) transfected samples but not on the lane loaded with dOr22a alone sample. However, signal intensity was much stronger in the lane loaded with dORs sample than with Orco alone (Fig 2.3). These results indicate that dOr22a is not expressed in HEK cells when Orco is not present.

Hence for the functional studies of ORs we co-expressed Orco together the ORs (either dOr22a or dOr92a).

(28)

Chapter 2. Results

26

Figure 2.3. Expression of dOr22a requires co-expression of Orco.

Western blots of transfected HEK293T cells showing the levels of dOr22a, Orco and their combination (GFP staining) expressed in cell membranes. Representative blot from two individual transfections.

2.4.3 dORs expressed in HEK293T cells are functional

The results above indicated that the HEK cells express and properly traffic dORs in case of co-expression of the co-receptor Orco. In order to test whether these proteins are functional we measured odor-induced calcium changes in transfected cells.

Cells were imaged for 250 s at 0.2 Hz (5 s interval, total no. of frames is 50; stimulus protocol is shown in Fig 2.4A). First ten frames were imaged prior to addition of odorant or solvent (quantified as basal fluorescence intensity - Bo). Bo varied a lot within the experiments (Fig 2.4B, C, E, F). A possible reason for such variations is the difference in the level of uptake of the dye by the cells or the general heterogeneity of cell culture (different cell cycle phases, chromosomal aberrations, etc.). After odor addition cells were imaged for 150 s (odor is present throughout). In average, more than 30% of cells responded to odor by increasing the levels of calcium in them above the threshold value of 1.5 (see Materials and Methods). Relative increase in fluorescence intensity was individual for each cell and reached up to 8 times of basal (Fig 2.4B, E).

Most of the responder cells showed increased calcium levels within 5–15 s after odor addition (frames 11–13; examples traces are shown in Fig 2.4C). In general the maximum calcium increase mediated by odors peaked at about 30 s after odor addition (16^th frame; Fig 2.4D) and then the response decreased slowly and in most cases it reached their basal fluorescence level. Though the cells were exposed to odorants for 150 s the responses were transient (as it was shown for other receptors (Smart et al., 2008)). Addition of ionomycin elicited the calcium increase in almost all of the cells regardless of they have previously responded or not to the odor (Fig 2.4B, C, F).

Role of G proteins in olfactory signaling of Drosophila