2.1.1 Reagents and kits
Product Company
Ethylenediamine tetraacetic acid (EDTA) Fluka Chemie, Buchs/CH Ethylenediamine tetraacetic acid disodium salt Fluka Chemie, Buchs/CH
Potassium chloride (KCl) Fluka Chemie, Buchs/CH
Sodium chloride (NaCl) Fluka Chemie, Buchs/CH
Sodium citrate dihydrate Sigma-Aldrich Chemie GmbH, Munich/GER
Sodium dihydrogen phosphate NaH2PO4 Fluka Chemie, Buchs/CH Sodium hydrogen phosphate Na2HPO4 Fluka Chemie, Buchs/CH
Sodium dodecyl sulfate (SDS) Roth, Karlsruhe/GER
Acetic acid (HCl; 37% v/v) Fluka Chemie, Buchs/CH
Triton X-100 Fluka Chemie, Buchs/CH
Tris base Riedel de Haёn, Seelze/GER
Ethylene glycol (25% vol/vol) Fluka Chemie, Buchs/CH EGTA (ethylene glycol tetraacetic acid) Fluka Chemie, Buchs/CH
HPLC- H2O LiChrosolv Merck, Darmstadt/GER
Nitrogen gas
2x Spotting buffer (160 mM Na2SO4, 130 mM
Na2HPO4) Eppendorf, Hamburg/GER
Nexterion 2x spotting buffer Spot I and Spot III Schott Technical Glass Solutions, Jena/GER Taq DNA polymerase; reaction buffer 1.5 mM
MgCl2; Mg(OAc)2 Eppendorf, Hamburg/GER
ExpandTM High Fidelity Taq DNA polymerase, 1x
reaction buffer Roche Applied Science, Penzberg/GER
dATP, dGTP, dTTP, and dCTP Amersham Biosciences, Freiburg/GER
Cy3-dCTP Amersham Biosciences, Freiburg/GER
Biotin-11-dUTP Fermentas, Burlington,Ontario/Can
DNase I, 1x reaction buffer, stop buffer with EGTA Promega, Madison, WI/USA
Agarose Sigma-Aldrich Chemie GmbH, Munich/GER
Xylene cyanol FF Fluka Chemie, Buchs/CH
Orange G Fluka Chemie, Buchs/CH
87% Glycerol Riedel de Haёn, Seelze/GER
DNA ladder TrackItTM 1kb Invitrogen
China: (unknown - manufacturers of basic chemicals were not identifiable)
Proteinase K unknown
Phenol/chloroform unknown
Sodium acetate unknown
Isopropanol unknown
Ethanol unknown
RNase unknown
Zirconia/silica beads 0.1 mm BioSpec Products, Bartlesville, OK/USA Zirconia/silica beads 3 mm BioSpec Products, Bartlesville, OK/USA
Phenol unknown
Chlorophorm unknown
Isoamyl alcohol unknown
rTaq DNA polymerase; 1x Mg2+-free reaction buffer;
MgCl2
Takara Bio Inc., Shiga/JAP
dATP, dGTP, dTTP, and dCTP Fermentas; Burlington,Ontario/CAN
Biotin-11-dUTP Fermentas, Burlington,Ontario/CAN
DNase I; 1x reaction buffer, stop buffer with EGTA Fermentas; Burlington,Ontario/CAN
Agarose unknown
Ladder GeneRuler 100bp Plus Fermentas, Burlington,Ontario/CAN Lambda DNA/EcoRI+HindIII Marker 3 Fermentas, Burlington,Ontario/Can
40
Product Company
Glycerol unknown
Dimethylbenzene xylene unknown
Bromophenol blue unknown
Polyacrylamide unknown
Urea unknown
Deionized formamide unknown
10% APS (ammonium persulfate) unknown
TEMED (Tetramethylethylenediamine) unknown
SybrGreen I Amresco, Solon, OH/USA
Kits
Product Company
QIAquick Spin PCR purification kit Qiagen, Hilden/GER
2100 Bioanalyzer DNA 7500 LabChip kit Agilent Technologies, Santa Clara, CA/USA 2100 Bioanalyzer DNA 1000 LabChip kit Agilent Technologies, Santa Clara, CA/USA
Silverquant Detection Kit Eppendorf, Hamburg/GER
BigDye Terminator cycle sequencing kit Applied Biosystems, Darmstadt/GER
Stool extraction kit Sigma-Aldrich Chemie GmbH, Munich/GER
2.1.2 Technical equipment
DNA extraction and processing
Product Company
Reaction tubes, various sizes Eppendorf, Hamburg/GER
Falcon tubes Becton Dickinson, Franklin Lakes, NJ/USA
Vortex-Genie 2™ Bender und Hobein AG, Zürich/CH
Centrifuge 5810 R (rotor: A-4-62) Eppendorf, Hamburg/GER
MiniSpin® Eppendorf, Hamburg/GER
ND-1000 spectrophotometer NanoDrop Technologies, Rockland, ME/USA DyNA Quant 200 fluorometer Amersham Biosciences, Freiburg/GER
Mastercycler gradient Eppendorf, Hamburg/GER
Electrophoresis Power Pac 300, Sub Cell GT Bio-Rad Laboratories, Munich/GER
Tetrad2 thermocycler Bio-Rad Laboratories, Munich/GER
Bioanalyzer 2100, lab-on-a-chip electrophoresis Agilent Technologies, Santa Clara, CA/USA Gel documentation system Las-1000 Plus Fujifilm, Düsseldorf/GER
Array fabrication and processing
Product Company
MicroGrid II 610 microarrayer BioRobotics, Cambridge/UK
MicroSpot 2500 pins BioRobotics, Cambridge/UK
Accelerator PT 3000 split pins (70 µm) Point Technologies, Boulder/USA Microarray scanner ScanArray Express Perkin Elmer, Waltham, MA/USA Thermomixer comfort with slide adapter Eppendorf, Hamburg/GER
OV5 heating compartment Biometra, Göttingen/GER
drying compartment (model U) Memmert, Schwabach/GER
Gene Frame®, 65 µL; 15 x 16 mm ABgene, Hamburg/GER
Gene Frame® coverslips ABgene, Hamburg/GER
384-well polystyrol (PS) microwell plates (U-shape) Greiner Bio-One, Frickenhausen/GER Nexterion® Slide E (75,6 x 25,0 x 1,0 mm) Schott Technical Glass Solutions, Jena/GER Epoxy-coated glass slides (3D) Eppendorf, Hamburg/GER
Glass container 10x7 cm unknown
Magnetic stirrer IKAMAG® RET-GS; IKA® Janke und Kunkel, Staufen/GER ScanArray Express array scanner Perkin Elmer, Waltham, MA/USA
Silverquant scanner Eppendorf, Hamburg/GER
Digital pH-meter pH525 WTW, Weinheim/GER
41 Sequencing
Product Company
MasterCycler Gradient, MasterCycler ep Gradient, MasterCycler ep Gradient S
Eppendorf, Hamburg/GER
ABI Prism 377 DNA sequencer Applied Biosystems, Darmstadt/GER DGGE
Product Company
Dcode System apparatus Bio-Rad Laboratories, Munich/GER
UVI gel documentation system UVItec, Cambridge/UK
Software
Product Company
ARB software environment Freeware (Ludwig 2004)
ScanArray® Express 3.0 Perkin Elmer, Waltham, MA/USA
Microsoft Excel Microsoft, Richmond, WA/USA
Microsoft Word Microsoft, Richmond, WA/USA
Microcal Origin 5.0 Microcal, Milton Keynes/UK
Corel PhotoPaint 12.0 Corel Corporation, Ottawa, Ontario/CAN
SeqMan II 5.0 DNAStar, Madison, Wis/USA
OligoAnalyzer 3.0 Online tool, Integrated DNA Technologies
MatLab & Simulink R2006a MathWorks GmbH, Ismaning/GER
PAST (Paleontological Statistics Software) Freeware (Hammer 2001)
2.1.3 Biological material
Isolated DNA from 31 bacterial reference strains was obtained from the Institute for Medical Microbiology at the University of Giessen (Germany) for the verification of the microarray.
Nine of them were strains from the German Collection of Microorganisms and Cell Cultures (DSMZ): Aeromonas trota DSM7312 (later identified as A. minutum), Aeromonas hydrophila (later identified as Aeromonas bestiarum DSM30019), Atopobium minutum DSM20586, Bacteroides fragilis DSM9671, Bifidobacterium bifidum DSM20456, Clostridium haemolyticum DSM5565, Atopobium vaginae DSM15829, Bacteroides ureolyticus DSM20703, Campylobacter coli DSM4689, Campylobacter jejuni DSM4688, Campylobacter lari DSM11375, Clostridium difficile DSM12056, Lactobacillus delbrueckii DSM20074, Lactococcus lactis DSM4644, Mycobacterium avium subsp. paratuberculosis DSM44133, Plesiomonas shigelloides DSM8224, Roseburia intestinalis DSM14610, Veillonella parvula DSM2008, Vibrio fischeri DSM9499, Vibrio parahaemolyticus DSM11058, Yersinia pseudotuberculosis DSM8992. All others were clinical isolates from the University Hospital of Giessen: Enterococcus faecium UR13873 (later identified as E. faecalis), Enterococcus faecium UR15676, Enterococcus faecalis, Listeria innocua 6b, Listeria monocytogenes EGD-e, Mycobacterium tuberculosis, Salmonella enterica subsp. enterica serovar Typhimurium (in the following called S. typhimurium), Salmonella enterica subsp. enterica serovar Enteritidis (in the following called S. enteritidis), Yersinia enterocolitica. All strains were identified by culture and specific real-time PCR assays. Escherichia coli DH5α was cultivated in-house and DNA was isolated by a phenol/chloroform extraction protocol. An E. coli O157:H7 (EHEC) DNA isolate was derived from the collection of the Institute for Technical Bio-chemistry.
Fifty-eight clinical faecal isolates of patients with gastroenteritic symptoms and six isolates from healthy volunteers were obtained from clinical routine of the Institute for Medical Microbiology at the University of Giessen (Germany). The samples of patients were pre-characterized by culture-based methods and real-time PCR.
42 Sixteen faecal samples from a trial with germ-free piglets delivered via caesarean section into a SPF-level barrier system, which were inoculated orally with a whole faecal suspension from a healthy 10-year old boy (human flora-associated piglets, HFA), were obtained from the School of Life Sciences and Biotechnology at Shanghai Jiao Tong University (China) (Pang 2007). The faecal samples were taken at two different points in time after birth, eight at day 14 and another eight at day 21. Additionally, seven faecal samples from pig-flora associated (PFA) piglets of day 14 and six samples of day 21 were obtained. Both trial groups were affected by an intestinal pathogen, which caused death of one PFA piglet (P1) at day 10 and a second one (P4) at day 21 after birth. Two faecal samples from the pig donor and the human donor and four faecal samples from two conventionally raised piglets at day 14 and day 21 were obtained for analysis.
Ten faecal specimens from rotavirus-infected children (group R) and ten samples from healthy children (group H) were obtained from the School of Life Sciences and Biotechnology at Shanghai Jiao Tong University (China) for investigation. Samples of rotavirus-infected children were derived from patients of Shanghai Xinhua Hospital. Samples of healthy children were randomly collected from children of a local kindergarten. Samples of group R were taken before therapy was started and confirmed rotavirus-positive by the hospital using a commercial kit (Diarlex-Rota, Orion-Diagnostics, Finland). None of the children involved in this study had received any antibiotic medication within three month before collection of their faeces. The study was performed with their parents’ consent.
2.1.4 Primers
For the amplification of the target genes, 16S and 23S rRNA genes, primer pairs were designed or derived from literature (see probeBase (Loy 2007)) and modified(*) according to own purposes, which are directed against conserved regions of both genes regarding the target species (Tab. 2.1). Positions are numbered according to E. coli base numbering.
Primer pair 616V/985R was used to amplify both, the 16S as well as the 23S ribosomal gene in one fragment. Two additional primers, Lo180Va and Lo110Ra, located at the beginning of the 23S rRNA gene, were used to amplify the 16S and 23S genes separately. For the amplification of both genes in seven shorter fragments, eleven new primers (Tab. 2.1) were combined with the primers 616V, Lo180Va, and 985R, amplifying the 16S ribosomal gene in three fragments and the 23S rRNA gene in four fragments in nearly full length. For amplification of the genes in five fragments, three new primers (Tab. 2.1) were designed and seven ones were rejected. The new primer pairs amplified the 16S rRNA gene in two fragments and the 23S rRNA gene in three ones. In few cases, the fragment DE was amplified with the primer combination Lo180Va/1084R instead of 114V/1084R.
Three more primers were designed for sequencing only, to receive overlapping fragments:
855V, 1608V-G, and 1608V-A for the 23S rRNA gene. Primer 855V in combination with 1084R amplified the end of the DE fragment together with the F fragment. Primers 1608V-G and 1608V-A in combination with primer 985R amplified the end of fragment F together with fragment G. Primer 1608V-G was used for E. coli, mycobacteria, Atopobium, Campylobacter, Salmonella, Yersinia, Plesiomonas, Roseburia, Vibrio, and Aeromonas, while primer 1608V-A was used for enterococci, lactococci, Listeria, Veillonella, and clostridia.
For amplification of the V3 region of the 16S rRNA gene for DGGE analysis, a primer pair was derived from literature (Tab. 2.1). The V3 region was amplified with primers P2 and P3 containing a 40 nt-GC-clamp (Muyzer 1993).
All oligonucleotide primers, besides those for DGGE, were obtained from Metabion international AG (Martinsried/GER). The source of DGGE primers is unknown (work in Shanghai).
43 Tab. 2.1: Primers for amplification of the 16S and 23S ribosomal genes. (*) primers previously published in ProbeBase and modified according to own purposes.
Gene Fragmenta) Primer name Sequence 5’3’ E. coli
position TM °Cb) Amplification of both genes in one 4.5 kb fragment
16S 4.5 kb 616V AGAGTTTGATYMTGGCTCAG 8-27 52.7
23S 4.5 kb 985R CCGGTCCTCTCGTACT 2654-2669 53.6
Amplification of both genes in two fragments of 2.1 and 2.5 kb
16S 2.1 kb 616V AGAGTTTGATYMTGGCTCAG 8-27 52.7
23S 2.1 kb Lo110Ra TBCCCCATTCRGANATC 110-126 51.1
23S 2.5 kb Lo180Va CYGAATGGGGVAACC 115-129 51.2
23S 2.5 kb 985R CCGGTCCTCTCGTACT 2654-2669 53.6
Amplification of both genes in seven fragments
16S A 616V AGAGTTTGATYMTGGCTCAG 8-27 52.7
16S A 515R CGGCTGYTGGCAC 515-527 53.5
16S B 524V GCCGCGGTAATACG 524-537 50.8
16S B 907R* CCCGTCAATTYMTTTGAGTTT 907-927 51.9
16S C 926V GGGRCCCGCACAA 926-938 54.9
16S C 1390R* GGGCGGTGWGTACAA 1390-1404 48.8
23S D Lo180Va CYGAATGGGGVAACC 115-129 51.2
23S D 458R CCWTTCCYTCACRGTAC 458-474 50.2
23S E 463V GTGARGGAAWGGYGAAAAG 463-481 52.0
23S E 1084R GAGCTRTTACGCWYTCTTT 1082-1102 50.6
23S F 1091V GCGTAAYAGCTCACTRGT 1091-1109 52.4
23S F 1923R GAATTTCGCYACSTTAGGA 1923-1941 52.0
23S G 1934V CGAAATTCCTTGTCRGKTAA 1934-1953 51.0
23S G 985R CCGGTCCTCTCGTACT 2654-2669 53.6
Amplification of both genes in five fragments
16S H 616V AGAGTTTGATYMTGGCTCAG 8-27 52.7
16S H 781R CCAGGGTATCTAATCCTGTT 781-800 51.6
16S J 790V AGATACCCTGGTAGTCC 790-806 50.0
16S J 1390R GGGCGGTGWGTACAA 1390-1404 48.8
23S DE 114V TCYGAATGGGGVAAC 114-128 48.6
23S DE 1084R GAGCTRTTACGCWYTCTTT 1084-1102 50.6
23S F 1091V GCGTAAYAGCTCACTRGT 1091-1109 52.4
23S F 1923R GAATTTCGCYACSTTAGGA 1923-1941 52.0
23S G 1934V CGAAATTCCTTGTCRGKTAA 1934-1953 51.0
23S G 985R CCGGTCCTCTCGTACT 2654-2669 53.6
Additional primers for sequencing
23S EFü 855V GGVGGTAGAGCACTG 855-869 51.5
23S FGü 1608V-G AAACCGACACAGGTGG 1608-1623 52.9
23S FGü 1608V-A AAACCGACACAGGTAG 1608-1623 48.9
Primers for DGGE analysis
16S V3 P2 ATTACCGCGGCTGCTGG 59.5
16S V3 P3 with 40nt
5’-GC-clamp
CGCCCGCCGCGCGCGGCGGG CGGGGCGGGGGCACGGGGGC CTACGGGAGGCAGCAG
56.2 a) fragment (internal identifier), which is amplified with the primer pair
b) calculated with OligoAnalyzer (http://eu.idtdna.com/analyzer/Applications/OligoAnalyzer/); concentration 0.4 µM; for primers with degenerated bases the average TM is given; for primers with GC-clamp the clamp was not included in the calculation.
44