A microarray for the detection of intestinal, bacterial pathogens regarding diarrheal disease and predominant intestinal residents including lactic acid bacteria (LAB) was developed. The target organisms were chosen according to clinical and literature information (Janka 2001) about their relevance in gastrointestinal disease and the healthy gut. The primary selection of target organisms is listed in Tab. 3.1. The bacteria were grouped by their affiliation to resident intestinal bacteria, potentially probiotic bacteria, and intestinal pathogens. Probes were designed (chap. 2.2.1) targeting the ribosomal RNA genes, which are universal to all bacteria and provide conserved regions for primer annealing as well as variable regions, which allow specific identification. Specificity is defined in this chapter as in-silico specificity.
The small subunit (SSU) RNA gene alone was not sufficient to differentiate between all target species as in-silico investigations indicated (ARB). Therefore, the large subunit (LSU) RNA gene was also taken into consideration. As far as possible, probes were designed following a multiple probe concept. It was aimed to detect each species with at least two probes and, if possible, on the species and genus level. Due to a limitation in available sequences (Tab.
3.1) and specific regions, this could not be achieved in all cases. The probe sets of the different array versions (chap. 2.2.1) are depicted in Tab. 3.2. Probe design was in some cases limited due to a lack of available sequences. Full-length sequences of the 16S ribosomal gene were not available for C. coli. Likewise, for Acholeplasma spp., Anaeroplasma spp., C. difficile, F. prausnitzii, Prevotella spp., Roseburia spp., and Veillonella spp. no 23S ribosomal gene was sequenced at that time.
Despite availability of sequences, no genus-specific 16S probes could be designed for Acholeplasma, Clostridium, Eubacterium, Lactobacillus, and Salmonella due to low homology between members of the genus. This also applied for Bifidobacterium, Fuso-bacterium, Lactococcus, Prevotella, and Shigella due to non-specificity towards other genera. For Plesiomonas no genus probes were designed, because only P. shigelloides sequences were available. For clostridia, also sub-clustering of the sequences into OTUs (operational taxonomic units) did not result in probes with clearly defined specificity. In case of Clostridium and Bifidobacterium, 23S probes were selected instead, but on a much smaller data basis of only 16 and 2 sequences, respectively. The Clostridium genus-probe did not cover C. difficile. For Salmonella, two 23S probes were selected based on 34 sequences covering all Salmonella except for S. bongori.
Otherwise, dominant members of the group were chosen and species-specific probes were developed. Species-specific 16S probes could not be designed for A. hydrophila, C. jejuni, E. faecalis, E. coli, L. lactis, M. avium complex and paratuberculosis, S. enterica, several Shigella species, V. parahaemolyticus, and Y. enterocolitica due to low discriminative power towards other species of the same or different genus. Escherichia coli and Shigella spp., or the M. avium subspecies, for example, do not distinguish in the 16S gene. In all cases, except for Salmonella enterica, also 23S species-specific probes were selected, but in general from a smaller sequence basis.
The coverage and the predicted specificity of the designed probes were variable between the targets. In most cases, the coverage of target sequences was 100% of the available full-length sequences in the database, but for some probes, it was lower between 75% and 98%
(Tab. 3.2). In some cases, the specificity of a probe could not be predicted, if only one member of a genus was already sequenced. For Y. enterica, L. lactis, and B. fragilis, for example, no sequences of other species of the genus were in the 23S database and P. shigelloides was the only representative of its genus in both, 16S and 23S database.
Therefore, the specificity of these probes towards their relatives remained unclear. The probes might have been species- or genus-specific.
57 Tab. 3.1: Target organisms, which were selected for detection by the microarray according to clinical information and literature data about their relevance in gastrointestinal disease and the healthy gut, availability of their sequence data for probe design, and the operon copy number.
16S operon copy number
16S full length sequences
Designed 16S probes
23S operon copy number
23S full length sequences
Designed 23S probes Species/genus
Acholeplasma ssp. 2 9 0 2 0 0
Acholeplasma laidlawii 2 2 2 2 0 0
Anaeroplasma ssp. no data 0 0 no data 0 0
Atopobium ssp. 1 4 2 1 1 2
Bacteroides ssp. 5-7 38 2 4-7 1 0
B. fragiles 6 x 0 6 1 2
Clostridium ssp. 4-15 323 0 4-15 16 2
Enterococcus ssp. 4 117 1 4 66 2
Enterococcus faecalis 4 21 0 4 4 3
Escherichia ssp. 7 64 0 7 51 0
Escherichia coli K12+EHEC 7 61 0 7 51 1
Escherichia coli K12 7 x 0 7 37 1
Eubacterium ssp. no data 78 0 no data 8 0
Eubacterium biforme no data 1 1 no data x 0
Fusobacterium ssp. 5 27 0 5 1 0
Fusobacterium prausnitzii no data 5 2 no data 0 0
Prevotella ssp. no data 86 0 no data 0 0
Roseburia ssp. no data 5 1 no data 0 0
Roseburia intestinalis no data 2 2 no data 0 0
Veillonella ssp. no data 8 1 no data 0 0
Bifidobacterium spp. 2-5 54 0 2-5 2 1
Bifidobacterium bifidum no data 5 1 no data 1 2
Lactobacillus spp. 4-9 305 0 4-9 24 0
Lactobacillus delbrueck ii 9 8 1 9 1 0
Lactobacillus acidophilus 4 4 1 4 1 0
Lactococcus spp. 6 43 0 6 4 0
Lactococcus lactis 6 39 0 6 4 3
Aeromonas ssp. 9-10 91 1 9-10 26 2
Aeromonas hydrophila 10 25 0 10 8 2
Campylobacter ssp. 2-3 35 2 3 13 3
Campylobacter coli 3 0 0 3 3 3
Campylobacter jejuni 3 6 0 3 4 3
Clostridium difficile 11 4 2 11 0 0
Escherichia coli O157:H7 7 x 0 7 14 1
Listeria ssp. 6 22 1 6 22 1
Listeria monocytogenes 6 9 2 6 8 0
Mycobacterium ssp. 1-2 224 1 1-2 26 1
M. avium c omplex no data 3 0 no data 2 2
M. avium subsp.
paratuberculosis
1 2 0 1 2 2
Mycobacterium avium no data 5 0 no data x 0
Plesiomonas ssp. no data 4 0 no data 3 0
Plesiomonas shigelloides no data 4 1 no data 3 2
Salmonella ssp. 7 51 0 7 34 2
Salmonella enteritidis no data 16 0 no data 16 0
Shigella ssp. 7 21 0 7 5 0
Shigella flexneri 7 x 0 7 2 1
Shig. flexneri + Shig. boydii 7 x 0 7 3 1
Shigella sonnei 7 x 0 7 1 1
Shigella dysenteriae 7 x 0 7 1 1
Vibrio ssp. 8-13 246 1 7-12 30 0
Vibrio cholerae 8 16 1 8-10 12 4
Vibrio parahaemolyticus 11 22 0 11 1 3
Vibrio parahaemolyticus et rel. 100 1 x 0
Yersinia ssp. 6-7 66 2 6-7 3 0
Yersinia enterocolitica 7 6 0 7 3 2
residentsprobioticspathogens
(x) not checked
Tab. 3.2: Identification oligonucleotide probes on the microarray with thermodynamical parameters.
target arraya) in-silico
coverage
probe nam eb) PMwm(0) of (n)c)
PMwm(1) PMwm(2) probe 5'-->3' (sense)d) GC (%) Tm
(ARB)e) Tm (OlAn)e)
dG Hairpinf) (kcal*m ol-1)
dG Selfdim erf) (kcal*m ol-1)
Acholeplasma laidlawii V1-V6 100% A.laid16S_177_22 2 (2) 3 3 GGATAGGATGTGTGCATGAAAA 40,9 n.d. 53,2 0,3 -7,05
V1-V7 100% A.laid16S_625_27 2 (2) 2 9 CTGTGAGGCTATGAAAACTATATAACT x x 33,3 n.d. 52,6 1,69 -5,83
Aeromonas hydrophila V1-V6 75% A.hyd23S_1170_18 6 (8) 11 30 CTAAGCGTGAGTGGTAGG x x 55,6 56,0 52,0 0,95 -3,61
V5-V7 11% A.hyd23S_241_18 1 (9) 1 4 AGTAGCGGCAGAGCGAAC 61,1 n.d. 57,7 0,47 -3,61
Aeromonas ssp. V1-V6 98% Aero16S_581_20 167 180 275 CAGGCGGTTGGATAAGTTAG 50,0 60,0 53,0 2,34 -3,61
V1-V7 100% Aero23S_1402_20 26 (26) 26 26 ACGACTTGTAATTGCGATGG x x 45,0 58,0 53,2 0,52 -5,36
V1-V6 100% Aero23S_1766_20 26 (26) 35 110 GCTGGGACTGTTTATCAAAA 40,0 56,0 50,6 1,53 -3,89
Atopobium ssp. V1-V7 100% A.min.fos16S_838_18 5 (5) 5 10 GATGTACCTTCCGTGCCG x x 61,1 58,0 55,8 1,02 -3,65
V3-V7 100% Atop16S_1020_18 25 (17) 47 99 GTGGCCGAAAGGAGCCTA x x 61,1 58,0 57,3 -0,87 -9,28
V2-V6 100% A.min23S_254_20 1 (1) 1 1 AACGGGGATATAGGTCAAAC 45,0 58,0 51,7 1,54 -3,91
V2-V6 100% A.min23S_135_21 1 (1) 1 1 GGACTCATCTCCTGATACTTG 47,6 n.d. 51,9 0,63 -4,64
Bacteroides ssp. V3-V7 81% Bact16S_815_20 111 (64) 316 1475 ACGATGAATACTCGCTGTTT x x 40,0 56,0 51,8 1,09 -5,19
V3-V7 81% Bact16S_226_20 103 (64) 109 307 GATGGGGATGCGTTCCATTA x x 50,0 60,0 55,0 0,13 -6,5
Bacteroides fragilis V1-V7 100% B.frag23S_152_20 1 (1) 1 1 AACTTGGTTGGAGGCTAACG x x 50,0 60,0 55,2 1,22 -3,61
V1-V7 100% B.frag23S_1025_20 1 (1) 1 1 AACTAACGAAGTCAGATTGC x x 40,0 56,0 50,3 -0,12 -3,61
Bifidobacterium spp. V4-V7 100% B.bif23S_2205_19 3 (3) 3 3 ACAGTCATCCTGTTCAGGG x x 52,6 58,0 54,1 0,04 -6,62
Bifidobacterium bifidum V4-V7 100% B.bif16S_183_20 7 (5) 7 15 ATGATCGCATGTGATTGTGG x x 45,0 58,0 53,4 0,97 -5,38
V1-V7 100% B.bif23S_2168_20 1 (1) 1 1 AAATACCGCTCTGTTCTCGT x x 45,0 58,0 53,8 1,57 -3,61
V4-V7 100% B.bif23S_2178_20 1 (1) 1 1 TCTGTTCTCGTTTGATGTCT x x 40,0 n.d. 51,2 1,16 -3,61
Campylobacter coli V1-V6 100% C.col23S_756_20 3 (3) 3 3 CAGGGTAGACTTGTGGATAG 50,0 60,0 51,7 1,11 -1,95
V1 100% C.col23S_755_20 3 (3) 3 3 CCAGGGTAGACTTGTGGATA 50,0 60,0 53,2 0,79 -5,02
V1-V6 100% C.col23S_1400_20 3 (3) 3 3 ATACCAACATTAGTCGTCGC 45,0 58,0 52,4 0,93 -3,61
Campylobacter jejuni V3-V7 100% C.jej23S_387_21 5 (5) 9 24 AGGAATCCTGTCTGAATCCGG x x 52,4 n.d. 56,4 1,19 -9,75
V3-V6,V7s 100% C.jej23S_394_19 5 (5) 9 35 CTGTCTGAATCCGGGTCGA x 57,9 n.d. 56,5 1,04 -9,75
V1-V6 100% C.jej23S_1153_24 4 (4) 4 4 GAAGCTGTAGACTTAGTTTACTAA 33,3 n.d. 49,9 0,97 -6,34
Campylobacter ssp. V1-V6 100% Camp16S_414_20 142 (136) 155 334 CACTTTTCGGAGCGTAAACT 45,0 58,0 53,1 1,31 -3,89
V1-V6 100% Camp16S_405_20 141 (136) 145 510 GGAGGATGACACTTTTCGGA 50,0 60,0 54,4 1,79 -3,61
V1-V6,V7s 100% Camp23S_2631_22 13 (13) 13 13 AAGATTGAAGAGATTTGACCCT x 36,4 n.d. 51,6 0,53 -1,94
V1-V7 100% Camp23S_932_18 13 (13) 13 13 AATCACAGCAGTCAGGCG x x 55,6 n.d. 55,5 0,41 -3,61
V1-V7 100% Camp23S_2174_22 13 (13) 13 13 CACTCTTTCTTATTTGGGTAGC x x 40,9 n.d. 51,2 1,98 -3,14
Clostridium difficile V1-V7 100% C.diff16S_992_20 5 (4) 6 37 GACATCCCAATGACATCTCC x x 50,0 60,0 52,9 0,04 -3,43
V1-V7 100% C.diff16S_1012_20 4 (4) 4 40 TAATCGGAGAGTTCCCTTCG x x 50,0 60,0 53,7 0,32 -4,64
Clostridium ssp. V1-V6 100% Clos23S_1038_24 21 (21) 22 45 GATTTCTAAGACAACTAGGATGTT 33,3 n.d. 50,4 0,85 -4,16
V6-V7 Clos23S_1038_22 n.d. n.d. n.d. GATTTCTAAGACAACTAGGATG 36,4 n.d. 48,2 1,3 -4,16
Enterococcus ssp. V2-V6 86% Entc16S_1281_22* 131 (101)fsd 182 297 CTCTTAAAGCTTCTCTCAGTTC 40,9 n.d. 50,7 1,2 -10,23
V2-V6 89% Entc23S_2618_18 59 (63) 160 293 GTCGCGGGCGTTGGAAAT 61,1 n.d. 59,2 0,75 -10,36
V2-V7 91% Entc23S_175_19 63 (63) 77 101 GAGGTAGACGCAGAGAACT x x 52,6 58,0 53,4 1,68 -3,61
Enterococcus faecalis V1-V7 E.faec23S_1470_23 GCAATGAGTCTTGAGTAGAGTTA x x 39,1 n.d. 52,0 0,83 -3,9
V1-V6,V7i 100% E.faec23S_1172_20 4 (4) 4 25 ATTAGGTGTAGTGGTAGGAG x 45,0 58,0 50,3 2,38 -1,47
V1-V7 100% E.faec23S_284_25 4 (4) 4 5 TGTTAGTATAGTTGAAGGATTTGGA x x 32,0 n.d. 51,7 1,17 -3,4
Escherichia coli K12+EHEC V1-V6 E.coli23S_271_18B 47 (51) 47 56 AGCCTGAATCAGTGTGTG x x 50,0 n.d. 52,3 1,15 -5,13
Escherichia coli K12 V1-V7 92% E.coli23S_542_18 35 (34) 35 44 GCTTAGGCGTGTGACTGC x x 61,1 n.d. 56,6 0,98 -3,61
Escherichia coli O157:H7 V1-V7 100% EHEC23S_1164_18 14 (14) 16 31 AGCGACACTGTGTGTTGT x x 50,0 54,0 54,6 -0,4 -4,64
final arrayg) s i
Tab. 3.2: Continuation from previous page.
target arraya) in-silico
coverage
probe nam eb) PMwm(0) of (n)c)
PMwm(1) PMwm(2) probe 5'-->3' (sense)d) GC (%) Tm
(ARB)e) Tm (OlAn)e)
dG Hairpinf) (kcal*m ol-1)
dG Selfdim erf) (kcal*m ol-1)
Acholeplasma laidlawii V1-V6 100% A.laid16S_177_22 2 (2) 3 3 GGATAGGATGTGTGCATGAAAA 40,9 n.d. 53,2 0,3 -7,05
final arrayg) s i
Eubacterium biforme V4-V7 100% E.bifo16S_193_20 1 (1) 1 3 GCTATTAAAGTGGCTAAGGC x x 45,0 58,0 51,1 0,83 -4,85
Fusobacterium prausnitzii V1-V6,V7s 100% F.praus16S_171_18 51 (7) 401 1348 ATACCGCATAAGCCCACG x 55,6 56,0 55,1 0,51 -3,61
V1-V6,V7s 100% F.praus16S_738_18 63 (7) 102 1389 CTGGGCACCAACTGACGC x 66,7 60,0 59,5 -0,98 -5,02
Lactobacillus delbrueck ii V3-V7 100% L.delb16S_176_22 17 (8) 17 21 GGATAACAACATGAATCGCATG x x 40,9 n.d. 52,3 -0,2 -5,38
Lactobacillus acidophilus V4-V7 L.acid16S_997_19 3 (4) 13 93 CTAGTGCAATCCGTAGAGA x x 47,4 56,0 50,8 1,79 -7,05
Lactococcus lactis V2-V6,V7i 100% L.lac23S_1581_23 7 (7) 7 7 CGTAAAGTCATATCTACCCGTAC x 43,5 n.d. 52,3 1,91 -3,91
V2-V6 100% L.lac23S_2198_18 7 (7) 7 15 AACCCGCTGGCATAATCG x x 55,6 n.d. 55,6 0,89 -3,61
V2-V7 100% L.lac23S_1436_21 7 (7) 7 7 GCTAAGAGATGCCAGTTAATG x x 42,9 n.d. 51,1 1,38 -4,85
Listeria monocytogenes V1-V6 79% L.mono16S_1274_27 22 (19) 51 808 GAGCTAATCCCATAAAACTATTCTCAG 37,0 n.d. 53,4 1,46 -6,34
V3-V6, V7i L.mono16S_1276_23 24 (16) 127 1473 GCTAATCCCATAAAACTATTCTC x 34,8 n.d. 49,0 1,76 -3,42
Listeria ssp. V2-V6 100% List16S_1151_19 45 (43) 55 443 AAGTGACTGCCGGTGCAAGC 57,9 n.d. 58,4 0,00 -9,75
V2-V7 100% List23S_2175_20 22 (22) 22 22 ACCCTGGCTGTATGACCATT x x 50,0 60,0 56,2 1,20 -5,02
Mycobacterium avium complex
V2-V7 100% M.aviC23S_650_17 2 (2) n.d. 8 CGCATCCCCTTTGGGGT
x x
64,7 n.d. 58,3 -0,79 -9,21
V2-V6 100% M.aviC23S_2443_18 2 (2) 2 614 GGGGATAACGGGCTGATC 61,1 58,0 55,2 1,08 -4,62
Mycobacterium avium subsp.
paratuberculosis
V2-V7 100% M.aviP23S_650_17 2 (2) 4 4 CGCATCCCTTTTGGGGT
x x
58,8 n.d. 55,7 -0,86 -6,14
V2-V6 100% M.aviP23S_1495_19 2 (2) 2 3 ATCCGTCCGTCACTAATCC 52,6 58,0 53,9 2,00 -3,61
Mycobacterium ssp. V2-V7 100% Mycb16S_987_20 426 (n) 455 568 GGTTTGACATGCACAGGACG x x 55,0 n.d. 56,7 1,56 -7,05
V2-V7 100% Mycb23S_1872_20 21 (17) 21 (17) 27 (17) GGGTGAAGCGGAGAATTTAA x x 45,0 58,0 52,7 1,94 -5,36
Plesiomonas shigelloides V1-V7 100% P.shig16S_468_20 4 (4) 4 19 CCTAGTGGCATTGACGTTAC x x 50,0 60,0 53,2 1,19 -6,3
V2-V6 100% P.shig23S_714_19 3 (3) 3 3 AACACGTAACTGGAGGACC 52,6 58,0 54,3 1,07 -6,3
V2-V7 100% P.shig23S_1475_19 3 (3) 3 3 AAGGTGGAGAGACTAGGCA x x 52,6 58,0 54,9 1,78 -4,16
Roseburia intestinalis V1-V7 100% R.inte16S_996_18 12 (2) 20 36 TCCCGATGACAGAACATG x x 50,0 54,0 51,7 0,75 -5,38
V3-V7 100% R.inte16S_1011_21 9 (3) 15 15 TGTAATGTGTTTTCTCTTCGG x x 38,1 n.d. 50,6 1,98 -3,61
Roseburia ssp. V3-V7 100% Rose16S_834_18 25 (6) 41 46 GGGGAGCATTGCTCTTCG x x 61,1 58,0 56,2 -0,15 -8,27
Salmonella ssp. V4-V6,V7s 82% Salm23S_274_20 29 (28) 97 103 CTGAATCAGCATGTGTGTTA x 40,0 56,0 50,4 0,98 -5,38
V1-V7 85% Salm23S_1704_17 32 (29) 40 109 ACGCTGACACGTAGGTG x x 58,8 n.d. 54,7 -0,11 -6,3
Shigella flexneri V4-V6 100% S.flex23S_1704_19 2 (2) 102 116 ACGCTGATACGTAGGTGAA 47,4 56,0 53,1 0,33 -8,22
Shig. flexneri + Shig. boydii V4-V6 100% S.flex.boyd23S_1215_19 3 (3) 3 74 GTGTGCTGTGAGGTATGCT 52,6 58,0 54,9 1,3 -3,14
Shigella sonnei V4-V6 100% S.sonn23S_2153_17 1 (1) 1 156 CATGGAGCCGGCCTTGA 64,7 n.d. 58,2 1,44 -16,03
Shigella dysenteriae V4-V6 100% S.dys23S_842_17 n.d. n.d. n.d. AACTCATCTCGGGGGGT 58,8 n.d. 55,6 2,12 -3,61
Veillonella ssp. V1-V7 100% Veill16S_985_20 33 (27) 35 76 AGGTCTTGACATTGATGGAC x x 45,0 58,0 52,2 -0,12 -3,43
Tab. 3.2: Continuation from previous page.
target arraya) in-silico
coverage
probe nam eb) PMwm(0) of (n)c)
PMwm(1) PMwm(2) probe 5'-->3' (sense)d) GC (%) Tm
(ARB)e) Tm (OlAn)e)
dG Hairpinf) (kcal*m ol-1)
dG Selfdim erf) (kcal*m ol-1)
Acholeplasma laidlawii V1-V6 100% A.laid16S_177_22 2 (2) 3 3 GGATAGGATGTGTGCATGAAAA 40,9 n.d. 53,2 0,3 -7,05
final arrayg) s i
Vibrio cholerae V1-V6 100% V.chol16S_831_17 18 (15) 764 837 AGGTTGTGCCCTAGAGG 58,8 n.d. 53,7 0,55 -4,67
V1-V7 83% V.chol23S_1379_20 10 (10) 11 17 CCCGTACTTCTGACTATTGC x x 50,0 60,0 52,7 2,35 -3,65
V1-V7 83% V.chol23S_1207_21 10 (10) 14 64 CGTTGAAGGTGAATCGTAAGG x 47,6 n.d. 53,5 0,46 -3,61
V1-V7 83% V.chol23S_1580_21 10 (10) 10 10 GCTTCAGATAGTCAGGAATCG x x 47,6 n.d. 52,7 1,53 -3,61
V1-V7 83% V.chol23S_133_22 10 (10) 10 10 TGCATAAGCAGTTACTGTTAAC x x 36,4 n.d. 50,9 -0,28 -7,53
Vibrio parahaemolyticus V4-V7 100% V.par23S_1212_19 1 (1) 1 1 AAGGTGTGTGGTAACGCAT x x 47,4 56,0 54,6 -0,03 -3,61
V4-V7 100% V.par23S_339_19 1 (1) 1 4 AGTTGACGACGTGTGTTCA x x 47,4 56,0 54,3 0,79 -6,3
V4-V6 100% V.par23S_1523_18 1 (1) 1 4 CGTCGAGCATCTACGGAT 55,6 n.d. 54,0 1,23 -6,76
Vibrio parahaemolyticus et rel. V3-V7 n.d. V.parRel16S_63_19 109 135 165 CGAGCGGAAACGAGTTATC x x 52,6 n.d. 53,3 -1,17 -3,61
Vibrio ssp. V3-V6,V7i 80% Vibr16S_570_20 392 (375) 559 n.d. TAAAGCGCATGCAGGTGGTT x 50,0 60,0 57,8 0,12 -11,66
Yersinia enterocolitica V1-V7 100% Y.ent23S_1478_18 3 (3) 3 4 GCGGAGTGACCAGGTAAA x x 55,6 n.d. 54,5 0,31 -4,41
V1-V6,V7i 100% Y.ent23S_1501_20 3 (3) 3 4 TTGCTTATCAACGCTGAGGT x x 45,0 58,0 54,4 0,97 -3,09
Yersinia ssp. V1-V6 100% Yers16S_1274_20 88 (87) 122 363 AGCGGACCACATAAAGTCTG 50,0 60,0 54,7 0,81 -3,61
a) array version on w hich probe is present; i - only antisense probe is present, s - only sense probe is present 55 53
b) target_E.coli-position_lenght; antisense probes are labelled w ith "i" in the end
c) number of perfect matches of the probe w ith zero, one, or tw o w eighted mismatches tow ards the target against the w hole database (except for 'fsd' = against full sequence database) d) plus 5'-polyT spacer w ith a lenght of 11 nucleotides and amino modification
e) °C; ARB: 2AT+4GC; Oligoanalyzer: nearest neighbo r f) at 45°C and Na+ 50mM; determined for the sense p robe g) probe presence on final array, s - sense, i - antisense
(n.d.) not determined, (*) w rong sequence ordered and spotted; corresponds to Entc16S_1283_22
61 For all selected species and genera, besides Prevotella and Anaeroplasma, a group- or species-specific probe based on the 16S or 23S ribosomal gene was finally found. The melting temperature according to OligoAnalyzer (nearest neighbour method) varied between 48.2 and 59.5°C. In total, 70 out of 87 probes matc hed the predefined TM parameter of >50°C and <56°C. Regarding the hairpin and selfdimer stab ility, 73 and 72 probes matched the defined parameters of ≥0 kcal*mol-1 and ≥-7 kcal*mol-1, respectively. The highest hairpin stability was found for a Vibrio parahaemolyticus probe (V.parRel16S_63_19/i) with -1.17 kcal*mol-1 due to only two neighboured GC pairs. The highest selfdimer stability was -16.03 kcal*mol-1 for a Shigella sonnei probe (S.sonn23S_2153_17/i) due to six neighboured GC pairs. The GC content of all probes varied between 32% (E.faec23S_284_25/i) and 66.7% (F.praus16S_738_18/i). The distribution of the probes of the final array V6f across both target genes is depicted in Fig. 3.1.
ribosom al genes prim er prim er Acholeplasm a laidlawii Aerom onas ssp.
Aeromonas hydrophila Atopobium ssp.
Atopobium m inutum/fossor Bacteroides ssp.
B.fragilis Bifidobacterium bifidum Cam pylobacter ssp.
Cam pylobacter jejuni Clostridium difficile Enterococcus ssp.
Enterococcus faecalis Escherichia coli Escherichia coli O157:H7 Eubacterium biform e Faecalibacterium prausnitzii Lactobacillus delbrueckii Lactobacillus acidophilus Lactococcus lactis Listeria ssp.
Listeria m onocytogenes Mycobacterium ssp.
Mycobacterium avium (com plex) Myc. avium (paratuberculosis) Plesiom onas shigelloides Roseburia ssp.
Roseburia intestinalis Salmonella ssp.
Veillonella ssp.
Vibrio ssp.
Vibrio cholerae Vibrio parahaem olyticus et rel.
Vibrio parahaem olyticus Yersinia enterocolitica
H 794 bp
J 616 bp
DE 1000 bp
F 850 bp
G 736 bp
16S gene 23S gene
Fig. 3.1: Distribution of detection probes (array V6f) for all species on the ribosomal genes and position of the primers used for amplification.