Generation of malectin specific antibody

Analysis of intracellular localization, study of embryonic protein expression and confor-mation of disrupted protein synthesis upon morpholino injection required a malectin specific antibody. The N- terminus of malectin was predicted as signal peptide (aa 1-30),(aa 1-30),, potentially cleaved of during modification processes while the hydrophobic C-terminus was possibly a transmembrane domain (aa 208-276). For the purpose of antigen generationFor the purpose of antigen generation both regions were excluded and just the soluble core domain was overexpressed in bacteria,overexpressed in bacteria, affinity purified and used for rabbit immunisation.used for rabbit immunisation.

2.2.7.1 Cloning of malectin core domains

The malectin core domain was PCR amplified out of the pCS2+/p150-ORF plasmid. Four different core fragments were generated to test optimal conditions for overepxression in bacteria. Two different primer sets were used: tg1- 4 (named after collaboration partner Toby Gibson (EMBL, Heidelberg; cloning was done by Günther Stier (EMBL, Heidel-berg).

name sequence 5�� 3�

tg1 (for):(for):: GCTGCTCATGAGCGGTCTAGCGGATAAAGTGATCTGG tg2 (for):(for):: GCTGCTCATGAGCGATAAAGTGATCTGGGCAGTGAATG tg3 (rev):(rev):: GCTGGTACCTTACTCCAGACCTGGGTGAGGCTGC tg4 (rev):(rev):: GCTGGTACCTTAAGGCTGCAGCATTGGGACATC

The resulting four fragments were subcloned into pETZ2-9d vector, in frame to a 6× His-tag (thereby destroying the NcoI (nt 932) cloning site). Correct in frame fusion was con-firmed by sequencing. All proteins could be efficiently expressed and purified in bacteria (personal communication with Günther Stier). Due to size advantages the largest construct TG1 was used by Thomas Schallus (EMBL, Heidelberg) for structural analysis by NMR.

The smallest fragment TG4 protein was used for antibody generation as subsequently de-scribed.

2.2.7.2 O�erexpression and purification of antigen

TG4 protein expression and purification was done using the protocol: ”E.coli expression- High speed protocols” (Jeanne Perry, UCLA Los Angeles; Günther Stier, EMBL, Heidel-berg) with some modifications. In general, all buffers contained Tris and DTT for proteinIn general, all buffers contained Tris and DTT for protein stabilization, disulfide bond reducing β-mercaptoethanol, proteinase inhibitors as PMSF or PEFAC and nonionic detergents, like NP-40 or Triton-X-100 to remove unbound proteins and nucleic acids from the affinity column. Imidazol competes with proteins for Ni²⁺-NTA binding sites and prevents at low concentrations (≥ 20mM) unspecific protein binding to Ni²⁺-beads while at high concentrations ( ≤ 100 mM) it leads to elution of His-tagged pro-teins.

The TG4- plasmid was transformed into BL21 (DE3) bacteria by chemical transformati-on. A 50 ml LB^Kan oN- culture was set up at 37°C. The next day oN-culture was diluted to OD₆₀₀= 0.3 in 37°C prewarmed LB^Kan. Protein expression was induced upon 1 mM IPTG and the culture grew for 6 hr to OD₆₀₀= 0.8 at 25°C to increase protein yield (highest pro-(highest pro-tein expression occurs during exponential growth phase). 1 ml samples were taken (0, 2, 4, 6h) to analyse protein synthesis in a time course experiment. The culture was spin down atThe culture was spin down at 6000 × g for 15 min and resuspended on ice in 10 ml/mg wet weight lysisbuffer using a glas/mg wet weight lysisbuffer using a glasmg wet weight lysisbuffer using a glas pipet. The suspension was split in 50 ml Falcon tubes, complemented with 100 µg/ml lyso-zyme and 1 µg/ml DNaseI and incubated on ice for 15 min. Cells were completely disrupted by sonification on ice at highest intensity (2 × 2 min) thereby preventing protein denatu-on ice at highest intensity (2 × 2 min) thereby preventing protein denatu-at highest intensity (2 × 2 min) thereby preventing protein denatu-(2 × 2 min) thereby preventing protein denatu-thereby preventing protein denatu-ration by spooming. Cell debries were separated by centrifugation for 15 min at 10.000 × gat 10.000 × g and the clear yellowish supernatant was filtered through 0,45 µm filter (Sartorius).the clear yellowish supernatant was filtered through 0,45 µm filter (Sartorius).yellowish supernatant was filtered through 0,45 µm filter (Sartorius).supernatant was filtered through 0,45 µm filter (Sartorius).

For affinity purification, a column (Polyprep, Biorad) was filled with 0.5 ml well mixed Ni²⁺ agarose beads and equilibrated with 5 ml lysisbuffer. The filtered solution was applied to the column that was drained by gravity. The flow through was collected and reloadeddrained by gravity. The flow through was collected and reloaded by gravity. The flow through was collected and reloaded once. Proteins that bound unspecifically to the beads were washed off under stringent con-ditions by 5 ml Wash 1 buffer, 5 ml Wash 2 buffer and 5 ml Wash 3 buffer. 100 µl of each flowhtrough were kept for an analytic SDS-PAGE analysis. The fusion protein was eluted with 2.5 ml elution buffer. The flowthrough was reloaded twice to elute maximal protein amount. Protein concentration was estimated by Bradford. The column was washed with 1M imidazol and stored with 70% EtOH at 4°C.

To remove the His-tag of the TG4 protein, a TEV protease cleavage was performed oN at 30

°C by addition of 40 U/ml enzyme (Invitrogen). Enzymatic cleavage occured at recognition sequence EBL�FZG located between the 6 × His- tag and the protein of interest, here TG4.× His- tag and the protein of interest, here TG4. tag and the protein of interest, here TG4.protein of interest, here TG4..

Tag and cleaved off protein were separated by a second Ni^2±affinity purification step. The-refore the high imidazol concentration was reduced using a spin column (Vivaspin, 50000spin column (Vivaspin, 50000(Vivaspin, 5000050000

For the second affinity purification the Ni²⁺- NTA column was equilibrated with 10 ml Wash 1 buffer. The now „dialysed“ protein sample was applied and collected in the flow through whereas the 6× His-tag carrier remained on the Ni6× His-tag carrier remained on the Nicarrier remained on the Ni²⁺column. To increase the pro-tein yield the flow through was reloaded once. After concentration measurement by Brad-ford, protein was diluted to a 1 mg/ml stock solution aliquoted and stored at -20°C. 5 mg of purified TG4 protein were sent to BioScience, Göttingen (Ritschlweg2, 37085 Göttingen, Tel: 0551-25248; e-mail: Bioscience@T-online.de) for rabbit immunization..

Lysisbuffer: 20 mM Tris pH 8.0, 10 mM imidazol pH 8.0, 150 mM NaCl, 0.2% NP-40, 2 mM β-Mercaptoethanol ( 1:10000) or 5 mM DTT/ DTE, 1 µM PEFAC or 200 µM PMSF Wash 1 buffer: = Lysisbuffer without 0,2% NP-40

Wash 2 buffer: = Washbuffer 1 with 1 M NaCL Wash 3 buffer: = Washbuffer 1 with 30 mM imidazol

Elution buffer: = Washbuffer 1 with 330 mM imidazol, 10% glycerol Storage buffer: 20 mM Tris pH 8.0, 150 mM NaCl, 2 mM DTT, 10%

glycerol

PMSF: proteinase inhibitor 200 mM stock

PEFAC: proteinase inhibitor 100 mM stock

1 M IPTG isopropyl b- D-thiogalactopyranosid

Ni²⁺ agarose beads: Quiagen, binding capacity of 5 -10 mg/ ml beadsbinding capacity of 5 -10 mg/ ml beads Polyprep chromatographie

column

Biorad

2.2.7.3 Purification of rabbit polyclonal antibody

Crude blood serum was tested after 3 (1^st bleeding), 6 (2^nd bleeding) and 9 weeks (3^rd blee-ding) for its antibody content by immuno detection (Western blot, see 2.2.7.4). Protein samples used to test antibody specificity were purified antigen TG4 protein, whole embryo extracts that were further separated into membrane and soluble protein fraction as well as bacterial lysate. The 22^nd bleeding was used to extract TG4 antibody by affinity purification was used to extract TG4 antibody by affinity purification using AminoLink Plus Immobilisation Kit (Pierce) according to the manufacturers two-step protocol.