development in Xenopus laevis
Dissertation zur Erlangung des Doktorgrades der Mathematisch-Naturwissenschaftlichen Fakultäten
der Georg-August Universität zu Göttingen
vorgelegt von
Christine Jäckh aus Heidelberg Göttingen 2008
Referent: Prof. Dr. Tomas Pieler Korreferent: Prof. Dr. Ernst Wimmer Tag der mündlichen Prüfung: 29. 10. 2008
Table of Contents List of Figures List of Tables Abstract
1 Introduction
1.1 From endoderm specification to pancreas organogenesis in Xenopus laevis 1.1.1 Endoderm specification
1.1.2 Gut tube formation and patterning 1.1.3 Pancreas organogenesis
1.2 Molecular mechanism regulating pancreas development 1.2.1 Signalling pathways involved in pancreas development
1.2.1.1 Signalling pathways involved in endocrine cell differentiation 1.2.1.2 Retinoic acid signalling
1.2.2 Transcription factors involved in pancreas developmentTranscription factors involved in pancreas development 1.2.2.1 The homeobox transcription factor Pdx1/ XlHbox8 1.2.2.2 The role of HNF1β in pancreas development 1.2.2.3 The role of HNF6 in pancreas development
1.3 Screening for novel pancreas specific marker genes in Xenopus laevis 1.4 Xenopus laevis as experimental model system
1.5 Aims of this study
2 Materials and Methods
2.1 Materials2.1.1 Chemicals
2.1.2 Buffers and solutions 2.1.3 Enzymes
2.1.4 Reaction and purification kits
1 2 2 3 4 7 7 8 9 11 11 13 16 17 17 18
19 19 19 19 19 19
2.1.6 Antibiotics 2.1.7 Oligonucleotides
2.1.7.1 Morpholinos
2.1.7.2 DNA oligonucleotides 2.1.8 Vector systems
2.1.8.1 pGEM®-T and pGEM®-T Easy vector system (Promega) 2.1.8.2 pCS2+ vector and derivatives
2.1.8.3 pETZ2-9d 2.1.9 Constructs
2.1.10 Experimental organisms 2.1.11 Technical equipment 2.1.12 Hard- and Software 2.2 Methods
2.2.1 Working with Xenopus laevis
2.2.1.1 Culturing Xenopus laevis embryos 2.2.1.2 Microinjection
2.2.1.3 Embryo fixation
2.2.1.4 β- galactosidase staining 2.2.1.5 Embryonic explant preparation
2.2.1.6 Chemical treatments of embryos and explants 2.2.2 Bacterial work
2.2.2.1 Generation of chemical competent cells 2.2.2.2 Chemical transformation of competent cells 2.2.2.3 Glycerol stocks
2.2.3 DNA work
2.2.3.1 Native agarose gel electrophoresis 2.2.3.2 DNA purification
2.2.3.3 Measurement of nucleic acid concentration 2.2.3.4 Polymerase chain reaction (PCR)
2.2.3.5 DNA sequencing 2.2.3.6 Plasmid linearisation 2.2.3.7 Double restriction digest 2.2.3.8 Ligation of DNA fragments 2.2.4 RNA work
2.2.4.1 Total RNA extraction from embryos, adult tissues and explants
20 20 20 21 22 22 22 23 23 26 26 27 28 28 28 29 29 30 30 31 31 31 32 32 32 32 33 34 34 35 36 36 37 37 37
2.2.4.4 5´-/ 3´- Rapid amplification of cDNA ends (RACE- PCR) 2.2.4.5 In vitro RNA transcription
2.2.4.6 Whole mount in situ hybridisation (WMISH) 2.2.5 Vibratome sections
2.2.6 Protein work
2.2.6.1 Protein extraction from Xenopus laevis embryos 2.2.6.2 SDS- Polyacrylamide gel electrophoresis (PAGE) 2.2.6.3 Coomassie staining
2.2.6.4 Western blotting 2.2.6.5 Bradford assay
2.2.6.6 In vitro transcription and translation assay (TnT©) 2.2.7 Generation of malectin specific antibody
2.2.7.1 Cloning of malectin core domains
2.2.7.2 Overexpression and purification of antigen 2.2.7.3 Purification of rabbit polyclonal antibody 2.2.8 Eukaryotic cell culture
2.2.8.1 Culturing, media and solutions 2.2.8.2 Transient cell transfection
2.2.9 Immunofluorescent (IF) protein detection 2.2.9.1 IF in eukaryotic cells
2.2.9.2 IF in animal caps
3 Results
3.1 Characterisation of HNF1β during pancreas development 3.1.1 Expression profile of HNF1β during embryogenesis
3.1.2 Functional characterisation of HNF1β during pancreas development 3.1.2.1 Knockdown of HNF1β leads to pancreatic hypoplasia
3.1.2.2 Induction of HNF1β expands expression of pancreatic marker genesβ expands expression of pancreatic marker genes expands expression of pancreatic marker genes 3.1.3 Requirement of RA- signalling for endodermal HNF1β expression
3.1.3.1 HNF1β expression is responsive to RA- signalling 3.1.3.2 HNF1β reponds to RA- signalling in the endoderm
3.1.3.3 HNF1β expression responds to RA-signalling in the dorsal and ventral endoderm
3.2 Isolation and characterisation of HNF6/ onecut-1 of Xenopus laevis 3.2.1 Isolation of an onecut transcription factor
40 41 43 46 47 47 48 49 49 50 50 51 51 52 53 55 55 56 57 57 57
59 59 59 62 63 70 80 80 83 85
87 87
3.2.3 Comparative expression analysis of XHNF6 within the endoderm 3.2.3.1 XHNF6 expression preceds the onset of pancreatic marker genes 3.2.3.2 XHNF6 is expressed in the neural tissue and anterior endoderm 3.2.3.3 XHNF6 is expressed in the ventral and dorsal pancreas
3.2.3.4 XHNF6 and HNF1β are expressed in the dorsal endoderm 3.2.3.5 Tissue distribution of XHNF6 in adult Xenopus laevis 3.2.4 Functional characterisation of XHNF6 during pancreas development 3.3 Malectin, a novel ER- resident protein in Xenopus laevis
3.3.1 Malectin is an ubiquitously expressed protein 3.3.2 Malectin resides in the endoplasmic reticulum (ER)
3.3.3 Functional analysis of malectin in Xenopus laevis organogenesis
4 Discussion
4.1 The requirement of HNF1β for pancreas development 4.1.1 HNF1β is necessary for pancreas specification
4.1.2 HNF1β is not sufficient for pancreas formation
4.2 The requirement of HNF1β for endocrine cell differentiation 4.3 HNF1β is a mediator for RA- signalling in the endoderm 4.4 Ectopic activation of XHNF6 promotes pancreas development 4.5 Malectin, a novel ER resident protein in Xenopus laevis
5 Abbre�iations Abbre�iations 6 Bibliography 7 Appendix
7.1 Effect on XlHbox8 expression upon ectopic activation of HNF1β 7.2 Phenotypes induced upon misexpression of HNF1β
7.3 Statistical values of affected insulin expression upon HNF1β misexpression 7.4 Sequence alignment of XHNF6 and eukaryotic onecut proteinsSequence alignment of XHNF6 and eukaryotic onecut proteins
List of publications Acknowledgements
90 90 92 95 96 98 99 101 103 106 110
115 116 117 119 122 125 128 129
133 135 155 155 156 157 158
Figure 1.1 Endoderm formation and gut tube patterningEndoderm formation and gut tube patterning Figure 1.2 Pancreas development in Xenopus laevis
Figure 1.3 Metabolic pathway and mechanism of retinoic acid (RA)- signalling Figure 1.4 Expression of RALDH2 and C�P26 at gastrula stage ofExpression of RALDH2 and C�P26 at gastrula stage of Xenopus laevis Figure 1.5 Regulatory factors directing pancreatic lineage specification in Xenopus laevis Figure 2 Schematic drawing of a semi- dry western blot sandwich
Figure 3.1.1 Expression pattern of HNF1β during Xenopus laevis development Figure 3.1.2 Position and sequences of HNF1β- specific morpholinos
Figure 3.1.3 Determination of knockdown efficiency of HNF1β- specific morpholinos Figure 3.1.4 Knockdown of HNF1β reduces expression of pancreatic marker genes Figure 3.1.5 Knockdown of HNF1β leads to reduced insulin expression
Figure 3.1.6 Phenotypes induced upon ectopic expression of HNF1β in the endoderm Figure 3.1.7 HNF1β constructs used for gain- and loss of function approaches Figure 3.1.8 Changes in pancreatic marker gene expression upon ectopic activation
of HNF1β
Figure 3.1.9 Ectopic activation of HNF1β leads to induced insulin expression Figure 3.1.10 HNF1β positively regulates XlHbox8 expression
Figure 3.1.11 HNF1β expression is responsive to RA- signaling
Figure 3.1.12 HNF1β expression in the endoderm is responsive to RA- signalling Figure 3.1.13 HNF1β expression in the dorsal and ventral endoderm is responsive
to RA- signalling
Figure 3.2.1 Isolation of an onecut transcription factor from Xenopus laevis Figure 3.2.2 Nucleotide and amino acid sequence of the isolatedof the isolated Xenopus laevis
onecut protein
Figure 3.2.3 XHNF6 preceds expression of pancreatic marker genes
Figure 3.2.4 Expression pattern of XHNF6 during Xenopus laevis development Figure 3.2.5 XHNF6 is expressed in the ventral pancreas
Figure 3.2.6 XHNF6 is expressed in the dorsal and ventral endoderm by the onset of pancreatic budding
Figure 3.2.7 XHNF6 is expressed in liver, pancreas and brain of the adult Xenopus laevis Figure 3.2.8 Ectopic expression of XHNF6 promotes pancreas development
Figure 3.3.1 Sequence comparison of Xenopus laevis malectin with eukaryotic homologues Figure 3.3.2 Spatial and temporal expression profile of malectin in Xenopus laevis
embryos and adult
Figure 3.3.3 Malectin constructs generated for protein overexpression Figure 3.3.4 Malectin resides in the endoplasmic reticulum
Figure 3.3.5 Position and sequences of malectin- specific morpholinos
Figure 3.3.6 Determination of knockdown efficiency of malectin- specific morpholinos Figure 3.3.7 Misexpression of malectin affects endoderm development
Figure 7.1 Effect on XlHbox8 expression upon ectopic activation of HNF1β Figure 7.2 Phenotypes induced upon misexpression of HNF1β
Figure 7.3 Sequence anlignment of XHNF6 and eukryotic onecut proteins
35 109 4914 6063 6466 6971 7375
7779 8481 86 8889
9293 9798
10099 103105
107109 112111 155114 156158
Table 1 Genetic mutations that are linked to MOD�-type of diabetes Table 2 Duration of proteinase K treatment during WMISH for differentDuration of proteinase K treatment during WMISH for different
developmental stages
Table 3.1 Phenotypes induced upon ectopic expression of HNF1β in the endoderm Table 3.2 Sequence homology between isolated XHNF6 and onecut proteins Table 3.3 Sequence comparison of malectin with eukaryotic homologuesSequence comparison of malectin with eukaryotic homologues
Table 4 Comparison of RA and HNF1β induced effects on pancreas development Table 5 Statistical values of affected insulin expression upon HNF1β misexpression
441
7291 102126 157
On the background of severe clinical conditions as diabetes type I, it is essential to un- derstand pancreas development, in particular endocrine cell differentiation. Pancreas development is under control of signalling pathways and a complex transcription factor network. It was previously reported that inIt was previously reported that in Xenopus laevis retinoic acid (RA)- signalling was required for dorsal pancreas development and endocrine cell differentiation as early as during gastrulation. It was also shown, that a combined expression of the two transcriptionof the two transcription factors Pdx1/ XlHbox8 and Ptf1a/Xp48 in the endoderm is sufficient to induce pancreaticXlHbox8 and Ptf1a/Xp48 in the endoderm is sufficient to induce pancreatic cell fate. However, it remained unknown how these early RA induced prepatterning events contribute to later organ formation that is marked by the onset of Pdx1/XlHbox8 and Pt- f1a/p48 expression in the gut epithelium.in the gut epithelium..
This study focused on the identification of regulatory factors that link early RA- signalling with the onset of pancreas formation in Xenopus laevis. In this context, the two transcrip- tion factors HNF1β/TCF2 and HNF6/ onecut-1 were identified as positive upstream regu- lators for Pdx1/XlHbox8 and Ptf1a/Xp48. HNF1β was shown to be necessary but not suf- ficient for pancreas specification and outgrowth. Whereby, in contrast to HNF1β deficient mice, knockdown of HNF1β in Xenopus laevis did not lead to complete pancreas agenesis.
HNF1β was also shown to be responsive to RA- signalling within the early endoderm, and that it was able to promote endocrine cell differentiation. HNF6 was newly isolated, its spa- tial and temporal expression was confind to the anterior endoderm, and gain of function studies revealed a pancreas promoting activity.
A second aspect in this study concerned the identification of new pancreas specific marker genes that could serve as useful tools for the descriptive analysis of organogensis. The puta- tive pancreatic marker gene malectin revealed an ubiquitous expression in Xenopus laevis and an intracellular ER residence. In collaboration, it was shown that malectin was a car- bohydrate binding protein playing a putative role in the N- glycosylation pathway, imply- ing a general function in Xenopus laevis development.
The importance of the pancreas is evident from the number of clinical conditions resulting from the malfunction of this organ, notably diabetes mellitus. Diabetes is characterised by abnormal high blood glucose levels that are caused by absence of pancreatic β-cells,β-cells, their impaired insulin secretion or reduced insulin responsiveness of the metabolic system.
According to the time point of clinical manifestation and insulin requirement, diabetes is classified into two major forms: an early insulin- dependent diabetes type I and a later non-insulin dependent diabetes type II. The most frequent form of diabetes type I is an autoimmune disease leading to neonatal self-destruction of β-cells. A second variant of β-cell disorder is the maturity onset diabetes of the young (MOD�). This milder form of diabetes is based on genetic mutations that lead to disrupted β-cell formation or impaired insulin production (summarized in table 1, reviewed in Fajans et al., 2001).
Over several years, basic research has gathered information on factors, which are crucial to activate the genetic program for β-cell generation during normal pancreas development.
Type affected gene function reference
MOD�1 HNF4α (TCF14) TF regulating HNF1α and HNF1β as well as gene expression for glucose metabolism
Frayling et al., 2001;
�agamata et al., 1996 MOD�2 Glucokinase blood glucose sensor Hattersley et al., 1992 MOD�3 HNF1α (TCF1) TF regulating insulin expression Frayling et al., 2001 MOD�4 Ipf1 (Pdx1, XlHbox8) TF regulating pancreas development and
gene expression of glucose metabolism
Stoffers et al., 1997
MOD�5 HNF1β (TCF2, LFB3) TF regulating pancreas development and gene expression for glucose metabolism
Horikawa et al., 1997;
Haumatire et al., 2005 MOD�6 Neurogenic differenti-
ation 1 (NeuroD1)
TF promoting exocrine versus endocrine cell differentiation
Copeman et al., 1995
MOD�7 Krüppel-like factor 11 (KLF-11)
TF promoting endocrine gene expression versus exocrine differentiation
Neve et al., 2005
MOD�8 Bile salt dependent lipase (CEL)
enzyme involved in lipid metabolism and linked by observational studies to diabetes
Raeder et al., 2006
Table 1: Genetic mutations that are linked to MODY-type of diabetes. The table lists all types of �iabeti���iabeti��
�isor�ers known for human maturity onset �iabetes of the youn�� ������. �enes relate� to the �isor�ermaturity onset �iabetes of the youn�� ������. �enes relate� to the �isor�er an� their fun��tion are state� as well as their literature referen��e. TF= trans��ription fa��tor; names in bra-
��kets state synonymes.
Due to the identification of essential regulating factors, as transcriptional regulators and signalling molecules, human embryonic stem cells could be fated under optimized condi- tions towards a mature insulin producing β-cell in vitro (D´Amour et al., 2006). Recently a breakthrough in diabetes research was achieved by in vitro generation of pancreatic endo- derm that was transplanted into mice and that subsequently generated endocrine cells that were responsive to high blood glucose levels in vivo (Kroon et al., 2008).
Many of these factors, that direct endocrine cell fate are not only essential to determine and maintain identity of a mature pancreatic cell, but they also play decisive roles during the three key events of pancreas development, namely endoderm specification, gut tube formation and patterning as well as pancreas organogenesis (reviewed in Oliver-Krasinski and Stoffers, 2008).
Most studies that focus on revealing the developmental aspects during pancreas organoge- nesis made use of vertebrate model systems as mouse (Mus musculus) and zebrafish (Danio rerio). In this study, the amphibian model systemIn this study, the amphibian model system Xenopus laevis was used to reveal in detail the regulatory mechanisms that direct pancreas development.
1.1 From endoderm specification to pancreas organogenesis in Xenopus laevis 1.1.1 Endoderm specification
The early Xenopus laevis embryo is divided into three regions: the animal pole, the mar- ginal zone and the vegetal pole (figure 1.1). Upon dynamic cell movements during gas- trulation, these distinguished regions give rise to the three germ layers, namely the ecto-, meso- and endoderm respectively. The ectoderm differentiates into the epidermis and the nervous system, the mesoderm develops into muscle, vascular system, kidney and connec- tive tissue, while the endoderm forms the digestive tract, including liver and pancreas, as well as the respiratory organ.
Establishment of the endodermal fate depends on maternal factors in the vegetal hemis- phere as the T-box transcription factor VegT (Zhang et al.,the T-box transcription factor VegT (Zhang et al.,VegT (Zhang et al., 1998; �asuo and Lemaire, 1999).
Veg-T induces zygotic expression of downstream targets as the nodal-relates genes (Xnr;zygotic expression of downstream targets as the nodal-relates genes (Xnr;expression of downstream targets as the nodal-relates genes (Xnr;
Jones et al., 1995), the homeobox factor Mixer and mix-like protein (Henry and Melton,Henry and Melton, 1998), which in turn induce expression of pro-endodermal transcription factors as Xsox17,), which in turn induce expression of pro-endodermal transcription factors as Xsox17,Xsox17, FoxA1 and 2 (HNF3α, HNF3β) and GATA 4- 6 as well as synthesis of vegetal mesodermand GATA 4- 6 as well as synthesis of vegetal mesodermGATA 4- 6 as well as synthesis of vegetal mesoderm antagonists like Cerberus (Xanthos et al., 2001). Maintenance of Gata 4-6 and Xsox17 ex- pression is mediated by TGFβ (nodal) signalling. Their persistent expression is required to
specification (Afouda et al., 2005). Dorso- ventral axis specification is already establishedDorso- ventral axis specification is already established after fertilisation by stabilisation of the transcriptional regulator β-catenin in the prospec- tive dorsal half of the embryo, where it overlaps the VegT containing region, specifying the Nieuwkoop center. Studies using the animal cap system in Xenopus laevis demonstrated that combined overexpression of VegT and β-catenin changed the prospective ectodermal fate of isolated animal pole cells into dorso- endodermal fate. The dorsal endoderm in- ducing activity of VegT/β-catenin was shown by their capacity to induce gene expression of pancreas specific genes as Pdx1/XlHbox8, insulin and XPDIp (Chen et al., 2004). Spe- Spe- cification of dorsal-ventral and anterior-posterior axis is crucial for subsequent gut tube formation and patterning.
1.1.2 Gut tube formation and patterning
Anterior-posterior axis specification in respect to the gut tube occurs between stage 12 and 20. Transplantation experiments revealed that dorsal vegetal cells give rise to the an- terior gut endoderm and the ventral vegetal cells to the posterior gut endoderm (Gamer and Wright, 1995; Henry et al., 1996). Establishment of the A-P axis is also reflected by the asymmetric gene expression within the dorsal involuting endoderm of the hematopoieti- cally expressed homeobox transcription factor (Hex), the secreted factor Cerberus (Bou- wmeester et al., 1996) and the pancreatic progenitor gene XlHbox8 (Wright et al., 1989).
Fate mapping determined that Hex, Cerberus and XlHbox8 expressing cells translocate to the anterior region of the embryo and will give rise to the organs of the anterior foregut,the organs of the anterior foregut,
Figure 1.1 Endoderm formation and gut tube patterning. Before sta��e 10, the embryo is sub�ivi�e� into three re��ions: animal pole, mar��inal zone an� ve��etal pole, the later en�o�ermal ��ermlayer �yellow�. At the onset of ��astrulation the �orsal blastopore lip spe��ifies �orso-ventral axis ��, V� evi�ent in asymmetri��asymmetri��
��ene expression, e.��. Hex ���reen�. At sta��e 1�� the three ��erm layers e��to- meso- an� en�o�erm are sepa-. At sta��e 1�� the three ��erm layers e��to- meso- an� en�o�erm are sepa- rate� an� the anterio-posteror axis �A, P� is �etermine�. The en�o�erm forms the primitive ��ut tube that a��tivates or��an spe��ifi�� ��ene expression �sta��e ���� in �istin��t re��ions like P�x1�� �lHbox� �re�� an� Ptf1a���sta��e ���� in �istin��t re��ions like P�x1�� �lHbox� �re�� an� Ptf1a��in �istin��t re��ions like P�x1�� �lHbox� �re�� an� Ptf1a��
�p4� �bla��k lines�, both markin�� the prospe��tive pan��reati�� epithelium. �urin�� subsequent �evelopment the primtive ��ut tube ��ives rise to the lun�� an� the ��astroinstentinal tra��t at sta��e 41 �mo�ifie� after �orn:mo�ifie� after �orn:
http:����www.��in��innati��hil�rens.or����resear��h���iv���ev-biolo��y��fa��-labs��zorn-lab��liver-�ev.htm�
including liver and pancreas, whereas ventral involuting endoderm was fated to become, whereas ventral involuting endoderm was fated to becomewhereas ventral involuting endoderm was fated to become posterior gut tissue (Chalmers and Slack, 2000). Apart from Wnt-signalling it was shown that BMP signalling was repressed in order to determine dorsal endoderm tissue (Sasai et al., 1996).
The primitive gut tube is patterned along the anterior- posterior (A- P) and dorsal- ventral (D- V) axis into subregions that form different organs. Tissue identity within the gut tubegut tube relies on mesoderm- endoderm interactions that promote region restricted expression ofregion restricted expression of genes via intrinsic and extrinsic factors. Region specific gene expression establishes organRegion specific gene expression establishes organ boundaries that are required to coordinate anterior-posterior, dorsal-ventral and left-rightcoordinate anterior-posterior, dorsal-ventral and left-right position of the organ in the primitive gut (Horb and Slack, 2001). In context of pancreas. In context of pancreas organogenesis, research focused predominatly on the gene expression profile of the ante- rior gut epithelium.
1.1.3 Pancreas organogenesis
In Xenopus laevis, the pancreas develops from the anterior foregut epithelium as one dor- sal anlage and two ventral anlagen at stage 35 and 37, respectively. The pancreatic buds, positioned posterior to the liver diverticulum, grow and branch from the foregut into the mesenchyme. At stage 40, the pancreatic lobes fuse to one discrete organ that is positioned to the right side of the embryos due to gut rotation movements, behind the stomach and duodenum (Figure 1.2; Pieler and Chen, 2006).
Based on studies in mouse, many transcription factors have been identified that are re- quired for the specification of pancreatic cell fate in the primitive gut, among them the pancreatic and duodenum transcription factor 1 (Pdx1; also called XlHbox8 in Xenopus laevis; Jonsson et al., 1994) and pancreatic transcription factor 1a (Ptf1a; also called Xp48;
Kawaguchi et al., 2002). These two transcription factors mark a subset of multipotent pro- These two transcription factors mark a subset of multipotent pro- genitor cells that give rise to all cell lineages of the mature organ (Gu et al., 2002).
Also in Xenopus laevis, XlHbox8 (Wright et al., 1989) and Xp48 (Afelik et al., 2006) are the first genes that exclusively mark multipotent pancreatic progenitor cells in the anteriorexclusively mark multipotent pancreatic progenitor cells in the anteriormark multipotent pancreatic progenitor cells in the anterior foregut, the pre-pancreatic endoderm, and it was reported that they play crucial roles for the pre-pancreatic endoderm, and it was reported that they play crucial roles for pancreas specification and differentiation of cell lineages of the mature organ (Afelik et al, 2006; Jarikji et al., 2007).
The mature pancreas contains two functional units: the exocrine and the endocrine com- partment. The exocrine pancreas represents the majority of the tissue and comprises acinar and duct cells. During food uptake, acinar cells secrete digestive enzymes that are collected
digestion of the organ, duct cells secrete bicarbonate, sodium chloride and water to buffer the pancreatic fluid. The earliest exocrine differentiation marker in Xenopus is the pancreas specific protein disulfide isomerase (XPDIp). It is expressed from stage 39 onwards in the
Figure 1.2 Pancreas development in Xenopus laevis. (A) At sta��e 39 two ventral an� one �orsal pan��reati��
anla��en are marke� by exo��rine �P�Ip, also seen in the transversal se��tion �1�. At sta��e 40 �3� the ventral pan��reati�� anla��e ��ome in ��lose proximity to the �orsal bu� �ue to ��ut rotation movements an� fuse to�ue to ��ut rotation movements an� fuse toan� fuse to one or��an (4, re� arrow in�i��ates the fusin�� re��ion�. After fusion, the pan��reas is positione� to the left si�e of the embryo un�erneith the stoma��h an� �uo�enum re��ion. �evelopmental sta��es are in�i��tae�
to the left. White lines represent the position of transversal se��tions. (B) Temporal expression profile of pan��reati�� ��enes in �enopus embryos. P�x1���lHbox� an� Ptf1a��p4� are expresse� early �sta��e ��9��30�, an�
this early expression ��an serve in the i�entifi��ation of the pan��reati�� pre��ursor ��ells �Afelik et al., ��006�. �u- rin�� late �evelopment, P�x1���lHbox� expression is restri��te� to β-��ells, whereas Ptf1a��p4� expression is
��onfine� to exo��rine ��ells. Insulin is expresse� sli��htly later at sta��e 3�� an� is initiallly observe� only in the
�orsal pan��reati�� bu�. In ��ontrast ��lu��a��on expression in the pan��reas is quite late �sta��e 46��47; Kelly an�
�elton, ��000; Horb an� Sla��k, ��00��; Afelik et al., ��004�. As for exo��rine markers, �P�Ip is expresse� earlier
�sta��e 39� than trypsino��en �sta��e 41��4��; Afelik et al., ��004�. Abbreviations: vp: ventral pan��reas, �p: �orsal pan��reas, st: stoma��h, �u: �uo�enum. �Pieler an� Chen, ��006�
A
B
dorsal and ventral pancreatic anlage whereas digestive enzymes as amylase, trypsinogen and elastase are initiated after bud fusion at stage 41- 42 and carboxypeptidase at stage 44 (Figure 1.2; Pieler and Chen, 2006; Horb and Slack, 2002).
The endocrine compartment is composed of five cell types that are clustered as islets of Langerhans within the exocrine tissue. Specific peptide hormones involved in glucose homeostasis and metabolism are produced in these cell types, namely glucagon by α-cells, insulin and amylin by β-cells, somatostatin by δ-cells, pancreatic polypeptide by PP-cells and the appetite stimulating hormone ghrelin by ε- cells (reviewed in Blitz et al., 2006;
Murtaugh, 2007).
As observed in mouse, differentiation of endocrine cells occurs in two distinct waves, re- ferred as primary and secondary transition. During primary transition between E9.5 and E13.0 early endocrine cells expressing glucagon and insulin appear in the Pdx1- positive epithelium. Lineage tracing experiments revealed that these early endocrine cells do not originate from Pdx1- positive progenitor cells and that they do not contribute to the endo- crine cell mass of the mature islet (Burlison et al., 2008).
Endocrine cells of the mature islets rather differentiate from a common progenitor pool of the branching Pdx1- positive epithelium at E13.5 and E16 during secondary transition.
Appearance of Ngn3 that is expressed in all endocrine progenitor cells marks the onset of the secondary transition which is characterised by a vast increase in cell proliferation and subsequent differentiation of all endocrine as well as exocrine cell types (Gradwohl et al., 2000).
In Xenopus laevis, the first endocrine gene insulin is expressed from stage 32 onwards exclusively in the dorsal gut epithelium. These insulin positive cells move anteriorly along with the XlHbox8 positive pancreatic anlage and accumulate in the forming dorsal pancre- as (Kelly and Melton, 2000). Studies showed that these insulin positive cells appear to dif-Kelly and Melton, 2000). Studies showed that these insulin positive cells appear to dif-). Studies showed that these insulin positive cells appear to dif- ferentiate within the dorsal pancreatic region independently from the XlHbox8- p48 posi- tive progenitor cell pool and it was suggested that they correspond to cells of the primary transition in mouse (Afelik et al., 2006). A later endocrine differentiation phase is initiated(Afelik et al., 2006). A later endocrine differentiation phase is initiated. A later endocrine differentiation phase is initiated at stage 46 when glucagon, somatostatin and PP positive cells appear scattered in the exo-scattered in the exo-in the exo- crine tissue. During subsequent development, all endocrine cells cluster to form islet- like structures at stage 50 (Afelik et al., 2004; Kelly and Melton, 2000). However, in contrast toKelly and Melton, 2000). However, in contrast to). However, in contrast toHowever, in contrast to the mouse system, it remains unclear when and how this later phase of endocrine differ- entiation is initiated in Xenopus laevis. So far, there is no gene known in this system that specifies a common endocrine progenitor pool, thereby rising the interest to investigate
The pancreas arises as ventral and dorsal anlage that fuse during development to one ma- ture organ. The ventral gut epithelium gives not only rise to the pancreatic rudiment but also to the adjacent liver. It was shown that both organs derive from a common bipotential progenitor pool (Deutsch et al., 2001). On one side, the genetic program must be similar in both pancreatic anlagen to generate a common tissue, but at the same time it must differ to specify the two organ anlagen from its neighbouring tissue, that differs between the ventral and dorsal gut epithelium. Specification of ventral and dorsal pancreas from a different location and varying surrounding tissues requires a divergent set of genetic regulators in the ventral versus dorsal gut epithelium (reviewed in Zaret, 2008).
1.2 Molecular mechanism regulating pancreas de�elopment 1.2.1 Signalling pathways in�ol�ed in pancreas de�elopment
Various extrinsic signals from the surrounding mesoderm are required for region- specific gene expression in the epithelium that coordinates organogenesis along the anteroposte- rior and dorsoventral axis of the gastro-intestinal tract, emphasizing the importance of mesenchymal- endodermal cross-talk for gut tube patterning (Oliver-Krasinski and Stof- fers 2008; Pieler and Chen, 2006). Extrinsic signals include members of the secreted fac- tors of the Wnt-, TGFβ-, hedgehog (HH)-, Notch-, FGF- and retinoic acid (RA)- signalling pathways. These signalling pathways maintain either a negative or a positive regulatory function on pancreas specification and determination of cell lineage. In this context, it was shown that canonical Wnt- signalling was required for exocrine cell differentiation in the mouse (Murtaugh et al., 2005). A recent study demonstrated that early endodermal Wnt- signalling must be inhibited during gastrulation, to maintain foregut identity and to promote liver and pancreas development in Xenopus laevis (McLin et al., 2007). These find- ings define a strict time window of signalling action for endoderm patterning.
The segregation of neighbouring tissues as liver and ventral pancreas, shown to derived from a common progenitor pool, requires distinct molecular mechanism to determine ei- ther hepatic or pancreatic cell fate in the ventroanterior gut tube. Ventroanterior endoder- mal progenitor cells would normally adopt pancreatic fate. The exposure of these ventro- anterior cells to secreted molecules of the TGFβ superfamily, namely BMP and FGF, they adopt hepatic cell fate. BMP and FGF are secreted from the adjacent cardiac mesoderm and septum transversum (Deutsch et al., 2001). Apart from Wnt- signalling, hedgehog signalling is also repressed in restricted territories in order to render the epithelium com- petent for pancreatic cell fate aquisition. From studies in chicken, it was postulated that FGF2, secreted from the notochord, represses sonic hedgehog (SHH) the gut epithelium
and consequently activates Pdx1 expression and permits pancreas organogenesis (Hebrok et al., 1998). Expansion of SHH can be induced in the pancreatic region upon inhibition of the RA-signalling pathway which is associated with a reduced Pdx1/ XlHbox8 and insulin expression (Chen et al., 2004).
1.2.1.1 Signalling pathways in�ol�ed in endocrine cell differentiation
Specification of the endocrine cell lineage depends on permissive signals from the sour- rounding tissues as the vascular epithelium (Lammert et al., 2001; Nicolova et al., 2006) or the neural crest cells (Nekrep et al., 2008). However, the best analysed molecular mech- anism regulating the segregation of the exocrine and the endocrine cell lineage is the Notch- signalling pathway.
This cell-cell signalling pathway is activated by binding of Notch- ligands, the transmem- brane proteins delta and serrate, to the Notch receptor of the neighbouring cell. Upon ligand binding, the intracellular domain of the Notch receptor, Notch- ICD, translocates into the nucleus, where it recruits the DNA-binding protein RBP-Jκ (recombining binding protein suppressor of hairless) and activates gene expression of the Hairy and Enhancer of Split (HES) gene family. Hes1 has been shown to repress expression of the pro- endo- crine gene Ngn3 in the same cell, thereby promoting its exocrine fate (Jensen et al., 2000).
This negative regulation of gene expression between neighbouring cells is therefore called lateral inhibition. Lack of Ngn3 resulted in absence of all endocrine cell types within the pancreatic islets (Gradwohl et al., 2000).
Overactivation of Notch- signalling maintained pancreatic progenitor cells in a prolifer- ating state, resulting in delayed cell differentiation. Consequently, impaired maturation of endocrine and exocrine tissue was evident in a hypoplastic pancreas (Murtaugh et al., 2003). In contrast, inhibition of Notch- signalling or overexpression of Ngn3 leads to pre- mature differentiation of endocrine cells and to defects in pancreatic outgrowth (Apelqvist et al., 1999; Kim et al., 1997; Schwitzgebel, 2000). Hes1 also was reported to directly repress Ptf1/p48 expression and therefore inhibiting exocrine differentiation in mouse (Ghosh and Leach, 2006). Together these data underline the bifunctional role of Notch- signalling during early proliferation and on later differentiation of the pancreas. Another signalling factor that has been associated with pancreatic cell lineage commitment of the endocrine compartment is retinoic acid (RA).
Figure 1.3 Metabolic pathway and mechanism of retinoic acid (RA)- signalling. (A) Cellular retinol bin�- in�� protein �CRBP� bin�s retinol, whi��h is oxi�ise� to retinal by retinal�ehy�e �ehy�ro��enase �A�H� or short-��hain �ehy�ro��enase��re�u��tase �R�H��S�R�. Retinal is oxi�ise� to retinoi�� a��i� by retinal�ehy�e �e- hy�ro��enase �� �Ral�h���, whi��h is boun� by ��ellular retinoi�� a��i� bin�in�� protein �CRABP�. Retinoi�� a��i� is
�e��ra�e� by the enzyme C�P��6. (B) In the absen��e of RA, the retinoi�� re��eptors RAR an� R�R are boun�
as hetero�imer to their �NA tar��et sequen��e an� re��ruits a ��orepressor ��omplex that inhibits trans��rip- tion of tar��et ��enes �A, B, C� throu��h histone �ea��etylation. Bin�in�� of li��an� �RA� in�u��es ��onformational
��han��es an� bin�in�� of ��o-a��tivator lea�in�� to histone a��etylation an� a��tivation of trans��ription �mo�i- fie� after �arlétaz et al., ��006�.
1.2.1.2 Retinoic acid signalling
Retinoic acid (RA) a is a small lipophilic molecule that derives from vitamine A (retinol) that is uptaken by dietry and maintained in the blood system bound to retinoic binding proteins (Noy, 2000). After passive diffusion into the cell, retinol binds to the retinal bind- ing protein (CRPB) and is oxidised to retinal by retinal dehydrogenases (RDH). Retinal is subsequently metabolised by the enzyme Raldh2 in a rate limiting step to RA (figure 1.3).
Binding to CRAB promotes translocation of RA into the nucleus where it is transferred to its nuclear receptor RAR and the retinoic X receptors RXR that are both members of the
Cx- type zinc finger family. RAR and RXR are composed of α, β and γ isoforms, which homo- or heterodimerise to form DNA binding complexes (reviewed in Maden, 2001).
DNA binding is restricted to conserved sequences referred to as retinoic acid responsive elements (RAREs). Further cofactors are recruited to the RA- receptor complex to achieve transcriptional induction or repression. After activating its nuclear receptors, RA returns to the cytoplasm binds to the retinol binding protein 1 (RBP1) that targets RA for its me- tabolizing enzyme C�P26. This P450- class enzyme oxidises RA to inactive metabolites.
In Xenopus laevis, RA is synthesised at the beginning of gastrulation by the retinol dehy- drogenase 2 (RALDH2). RALDH2 expression is initiated in the deep mesodermal layer adjacent to the involuting endoderm region (figure 1.4; Chen et al., 2001). According to
Figure 1.4 Expression of RALDH2 and CYP26 at gastrula stage of Xenopus laevis. The RA synthesisin��
enzyme RAL�H�� �1; 3 blue� is expresse� as two lateral stripes in the involutin�� meso�erm a�ja��ent to the prospe��tive pan��reati�� pro��enitor ��ells in the en�o�erm �yellow, PPP�. The RA �e��ra�in�� enzyme C�P��6A1 ���� is expresse� in the epithelial layer of the �orsal animal hemisphere, the neuro e��to�erm, an�
the ��ir��umporal mar��inal zone �Chen et al., ��004�.
lineage tracing experiments this region, expressing anterior endodermal marker genes like XHex and XlHbox8 (Zorn et al., 1999), will give rise to pancreatic and hepatic progeni- tor cells (Kelly and Melton, 2000; Chalmers and Slack, 2000) and thereby supporting the idea that RA is involved in prepatterning the prospective anterior gut endoderm. Cyp26 is expressed in the gastrula ectoderm adjacent to the involuting endoderm (figure 1.4; Hol- lemann et al., 1998).
Inhibition of RA signalling by the synthetic RA antagonist BMS453, directed against retin- oic acid receptor α and γ (Matt et al., 2003), leads to reduced exocrine and endocrine tis- sue in the dorsal pancreas and to a slightly reduced ventral pancreas (Chen et al., 2004).
Conversely, RA treatment of gastrula stage embryos causes an increase of endocrine at the expense of exocrine tissue in the dorsal pancreas whereas the ventral exocrine pancreas was expanded.
Since later RA application did not result in a pancreatic phenotype (Zeynali and Dixon,
pancreas organogenesis, in particular for the dorsal anlage (Chen et al., 2004). The require- ment of the vitamine A derivate for pancreas development was further observed in Xeno- pus laevis using the animal cap assay. Coinjection of VegT and β-catenin activates a dorsal endodermal fate in pluripotent animal cap cells. Exocrine and endocrine gene expression was only initiated upon RA treatment (Chen et al., 2004). As VegT is also inducing meso- dermal tissue, the question of indirect or direct signalling of RA on the endoderm was sub- sequently studied by analyzing changes in gene expression within dissected endodermal explants that were exogenously treated with RA or BMS453 (Pan et al., 2007).
Until now it remains obscure how pancreas development proceeds between these RA in- duced pre-patterning steps and the actual induction of pancreas formation that is marked by the onset of the expression of two transcription factors Pdx1/XlHbox8 andPtf1a/p48 in the foregut. The two transcription factors Pdx1/XlHbox8 and Ptf1a are not the only modulators that direct pancreas development in the gut endoderm promoting endocrine cell differentiation. Indeed, it is a whole set of transcription factors that form a complex regulatory network (reviewed in Zaret, 2008).
1.2.2 Transcription factors in�ol�ed in pancreas de�elopment
Specification of the different pancreatic cell types from pancreatic progenitors in the gut epithelium is driven by a variety of transcription factors. Previously these transcription factors were supposed to regulate their downstream targets in a linear cascade. But the constant growing number of genetic regulators and analysis of their interactive relations implies a complex regulatory network rather than a simple hierachical model (Zaret, 2008;
Oliver-Krasinski and Stoffers, 2008).
Focusing on the factors analysed in the context of this study, the key regulators in pancreas development are the two transcription factors Pdx1/ XlHbox8 and Ptf1a/ p48. Pdx1- Ptf1a positive cells give rise to all pancreatic cell types of the mature organ (figure 1.5; Kawaguchi et al., 2002; Burlison et al., 2008).
1.2.2.1 The homeobox transcription factor Pdx1/ XlHbox8
In mice, the homeobox domain protein Pdx1 is expressed in the foregut from E8.5 onwards including the stomach, duodenal and pancreatic region (Ohlson et al., 1993; Jonsson et al.,(Ohlson et al., 1993; Jonsson et al., 1994). At E11.5 the expression extends towards the cystic duct, the antral stomach and the. At E11.5 the expression extends towards the cystic duct, the antral stomach and the common bile duct. Analysis of Pdx1-/- mice revealed that ventral and dorsal pancreatic budding from the posterior foregut still occured. However, further outgrowth and diffe- rentiation of the rudiment was impaired. Inhibited pancreatic development upon Pdx1
depletion also became obvious by the lack of endocrine islet cells in the adult organ. Here, Pdx1 was essential for β-cells maintenance as it was evident by the linkage to MOD�4 (ta- ble 1; Gannon et al., 2008; Holland et al., 2005).
In contrast, activation of early glucagon and insulin expressing cells deriving from the pri- mary transition within the Pdx1+ epithelium were still detectable in the Pdx1-homozygous mutants demonstrating that these early endocrine cells are Pdx1 independent (Offield etPdx1 independent (Offield et al., 1996; Burlison et al., 2008). In the dorsal pancreas Pdx1 is regulated by transcription. In the dorsal pancreas Pdx1 is regulated by transcription factors Hb9 or by Isl1, a lim1 homeobox protein which is expressed in the surrounding mesoderm (reviewed in Edlund, 2002). In the ventral pancreas Pdx1 expression is regula- ted by HNF1β and HNF6 (Haumaitre et al., 2005; Jaquemin et al., 2003a). Although Pdx1 owns a high pancreas promoting capacity, it was otherwise shown that Pdx1 alone is not sufficient to induce pancreatic tissue (Horb et al., 2003; Grapin-Botton et al., 2001).Horb et al., 2003; Grapin-Botton et al., 2001).Grapin-Botton et al., 2001).
The second key regulator that is subscribed to pancreatic development is the basic helix loop helix (bHLH) protein Ptf1a/ p48 (pancreatic transcription factor 1a). Ptf1a is part of a trimeric DNA binding complex Ptf1. This complex was originally identified as proteinDNA binding complex Ptf1. This complex was originally identified as protein complex, activating expression of exocrine genes in the adult pancreas in mice (Krapp et al., 1998). In addition to the bHLH protein p48, the trimeric complex consists of the two transcription factor subunits ribosomal binding protein -J (RBP-J) and an E-box bind- ing bHLH protein (E-box protein). p48 dimerises with the E-box protein and binds to ap48 dimerises with the E-box protein and binds to a specific PTF1a-binding site on the DNA. Gene activation requires recruitement of RBP-J.
Recent studies in knockout mice showed that lack of p48 disrupts proper outgrowth of thein knockout mice showed that lack of p48 disrupts proper outgrowth of theshowed that lack of p48 disrupts proper outgrowth of thelack of p48 disrupts proper outgrowth of the dorsal pancreas and the specification of the ventral pancreas. Instead, the p48-/- foregut epithelium acquires duodenal fate (Kawaguchi et al., 2002). In humans, p48 mutations. In humans, p48 mutationsIn humans, p48 mutations manifest pancreatic and cerebellar agenesis (Sellick et al., 2004). In context of endocrineIn context of endocrine cell differentiation, it was shown that upon p48 depletion, few endocrine cells can be found in the adjacent intestine (Kawaguchi et al., 2002).(Kawaguchi et al., 2002).
P48 not only plays a role in establishing a pancreatic progenitor pool, but it was also de- scribed as driving factor for differentiation of the exocrine compartment as it was showndriving factor for differentiation of the exocrine compartment as it was shownexocrine compartment as it was shown to promote outgrowth of the proliferating tips of the branching epithelium. During sub- sequent morphogenesis, these tip structures differentiate into acinar cells (Stanger et al., 2007). The Ptf1 complex is differentially active within these tips, as it replaces RBPJl against RBPJk after which precursor cell proliferation is blocked and exocrine cell differentiation is initiated (Masui et al., 2007). Similar to Pdx1, dorsal and ventral p48 expression depends on permissive signals from the surrounding tissue as the endothelial cells (�oshitomi and Zaret, 2004) and FGF10 (Jaquemin et al., 2006).
In Xenopus laevis, it was reported that a combined expression of XlHbox8 and Xp48 was sufficient to induce pancreatic fate in the gut epithelium (Afelik et al., 2006). Downregula- tion of Xp48 and XlHbox8 function resulted in loss of exocrine and late endocrine pancre- atic tissue, whereas early insulin expressing cells remained unaffected.
Similar observations were reported upon overactivation of p48 within the pancreatic en- doderm in Hes1- knockout mice. Here, pancreatic enlargement only occurred where p48 expression overlapped with endogenous Pdx1 expression within the stomach, bile duct and duodenum, thereby causing cell fate conversion into pancreas of the Pdx1- p48 positive domain (Fukuda et al., 2006).
Data obtained from in vivo experiments using transgenic mice indicated that Pdx1 and p48 regulate each other and auto-regulate themselves (Hale et al., 2005; Wiebe et al., 2007).
However, it remained unclear how initial gene activation of Pdx1 and p48 is activated in the restricted boundary of the gut epithelium. Direct gene activation requires earlier ex- pression of the upstream regulator in the same cell, which is supposed to induce target gene expession. In this regard, the two transcription factors HNF1β and HNF6, that are both expressed prior the onset of Pdx1 and p48 in an overlapping but broader regions of the foregut epithelium, represented potential upstream regulators.
1.2.2.2 The role of HNF1β in pancreas de�elopment
The transcription factor HNF1β [variant hepatocyte factor one (vHNF1), transcription cell factor two (TCF2) or homologue liver specific factor B (LFB3) (DeSimone et al., 1991; De- martis et al., 1994)], belongs to the group of liver enriched transcription factors known as hepatocyte nuclear factors (HNFs). HNF-group members belong to different transcription factor families, like the homeobox proteins HNF1β and its close relative HNF1α, nuclear receptor HNF4α, forkhead box proteins HNF3α, β and γ (FoxA1-3) and the onecut fam- ily member HNF6 (onecut-1: Cereghini, 1996). All group members were reported to play essential roles during liver specification, as it was also recently demonstrated for HNF1β (Lokmane et al., 2008). As previously described, dominant negative mutations in the HNF1β gene are also linked to diabetic disorder MOD�5 that is characterised by impaired glucose- stimulated insulin secretion and is associated with a severe glomerulocystic kid- ney disease (GCKD; Fajans et al., 2001).
HNF1β was first isolated as albumin promotor binding protein from a rat hepatoma cell line (Cereghini et al., 1988) and demonstrated to be a strong transcriptional activator (DeS- imone et al., 1991). The HNF1β protein contains an N-terminal DNA-binding region that is composed of a dimerisation domain, a POU-like DNA binding motif and a downstream HOMEOBOX motif (Nicosia et al., 1990). Structural analysis of the human homologueStructural analysis of the human homologue
revealed that the homeobox contains a helix- turn- helix motif (HTH), but which differs from other homeobox proteins by an extention of 21 amino acids between the second and third helix (Bach et al., 1991) and which was suggested to stabilize DNA- binding (Fin- ney et al., 1990). The POU- like DNA binding motif is formed by five helices, similar to the POU DNA binding domain, and is therefore also referred as pseudo- POU structure
Figure 1.5 Regulatory factors directing pancreatic lineage specification in Xenopus laevis. A simplifie�
mo�el for the role of the major trans��ription fa��tors an� si��nallin�� pathaways involve� in pan��reati�� li- nea��e �etermination. Cir��les in�i��ate ��ell subtypes. Boxes state trans��ription fa��tors that are require� for
��ell fate �etermination. Arrows in�i��ate �ire��tions of ��ell linea��es that are spe��ifie� a����or�in�� to the ex- presse� marker ��ene �s�. �ifferent arrow len��hts in�i��ate the relative time point of final �ifferentiation mo-
�us after pre��ursor ��ell �etermination. Blunt lines in�i��ate inhibition of parti��ular ��ell linea��es. Question marks in�i��ate instan��es where ��ene �s� in parti��ular linea��e �etermination is not known in Xenopus laevis
�mo�ifie� after Pieler an� Chen, ��006�.
forms were identified, namely HNF1β- B and HNF1β- C (Tronche and �aniv, 1992). In thisHNF1β- B and HNF1β- C (Tronche and �aniv, 1992). In this. In this respect, HNF1β- C that lacks the C- terminal transactivation domain might function as an endogenous dominant negative variant of the transcription factor (Bach and �aniv, 1993).)..
HNF1β and the closely related HNF1α bind to identical DNA binding sites as homo- orHNF1α bind to identical DNA binding sites as homo- orto identical DNA binding sites as homo- or heterodimers (g/aGTTAATNATTAACc/a; Rey-Campos et al.,1991) but it is unclear which protein region is preferred for either interaction. The dimerisation process is promoted by the dimerisation cofactor DCoH. DCoH does not bind to the DNA but stabilizes the struc- ture of the HNF1 dimer, thereby enhancing interaction with nucleic acids (Cerenghini,HNF1 dimer, thereby enhancing interaction with nucleic acids (Cerenghini,(Cerenghini, 1996). Subsequent studies in mice specified its expression profile during development toSubsequent studies in mice specified its expression profile during development to the extraembryonic visceral endoderm and later to the definitive endoderm where it is ex-extraembryonic visceral endoderm and later to the definitive endoderm where it is ex-definitive endoderm where it is ex- pressed in cells of the neural tube and of the foregut epithelium, including the hepatic and pancreatic primordia. Along the gut tube, differential HNF1β expression was detectableβ expression was detectable expression was detectable in the gallbladder, duodenum and both pancreatic anlagen aat stage E8.5. Here,Here, HNF1β expression was detectable in the Pdx1-positive epithelium of the budding pancreatic rudi- ments, where it became restricted to the developing duct cells, excluded from acinar orwhere it became restricted to the developing duct cells, excluded from acinar or endocrine cells, in the branching pancreatic epithelium (E12.5). In adult mice, HNF1β was(E12.5). In adult mice, HNF1β wasIn adult mice, HNF1β was transcribed in the epithelial cells of liver, genital tract, kidney, pancreas and lung (Barbacci et al., 1999; Reber et al., 2001).
HNF1β-deficient mice died before gastrulation due to defective formation of the viscer- al endoderm. This lethality was prevented by generation of HNF1β-null embryos with a wildtype (WT) extraembryonic endoderm using tetraploid embryo complementation (Bar- bacci et al., 1999). These teraploid HNF1β deficient mice were completely devoid of ventralHNF1β deficient mice were completely devoid of ventral pancreatic structures and demonstrated a severe hyploplasia of dorsal pancreas (Haumai-(Haumai- tre et al., 2005). Interestingly, inhibited pancreatic development upon HNF1β depletion. Interestingly, inhibited pancreatic development upon HNF1β depletion phenocopied effects caused by impaired expression of the pancreatic progenitor marker Pdx1 (Offield et al., 1996) and Ptf1a/p48 (Kawaguchi et al., 2002). Therefore, data obtaineddata obtained from studies in knockout mice support the idea that the transcription factor HNF1β func- tions as an upstream regulator of Pdx1 and p48. HNF1β-hypomorphic zebrafish mutants showed a similar phenotype regarding pancreatic agenesis, suggesting that HNF1β func- tion during vertebrate development is conserved (Sun and Hopkins, 2001).
In 1994, the Xenopus laevis HNF1β homologue was isolated and its expression traced dur- ing different stages of embryogenesis (Demartis et al., 1994). HNF1β expression was ac- tivated after mid blastula transition (MBT) in ecto- and endoderm as well as later in the mesoderm. In early tadpole stages, HNF1β transcripts were found in the foregut marking the prospective hepatic and pancreatic domain. In adult tissues, HNF1β transcripts were detected abundantly in liver, kidney, digestive tract and lung, but also in the pancreas (De- martis et al., 1994; Vignali et al., 2000).
HNF1β regulates a gene expression cascade essential for differentiation of epithelial cells lining the ducts. In 2002, Clotman et al. revealed that one of the upstream regulators of HNF1β in biliary duct differentiation is the onecut 1 transcription factor HNF6 (Clotman et al., 2002; Coffinier et al., 2002). An additional link between HNF1β and HNF6 was dis- covered regarding endocrine cell differentiation as both were reported as Ngn3 upstreamwere reported as Ngn3 upstream regulators associated with the diabetic disorder MOD�6 (Maestro et al., 2003; Horikawa et al., 1997).
Conversely, it was revealed that the mouse HNF6 gene contained an intronic HNF1β bind-intronic HNF1β bind- ing site with high potency to activate transcription of a reporter constructwith high potency to activate transcription of a reporter construct in vitro. These data located HNF1β upstream of HNF6 in the regulation hierarchy (Poll et al., 2006).
1.2.2.3 The role of HNF6 in pancreas de�elopment
The hepatic nuclear factor 6 (HNF6) belongs to the class of the cut- homeobox domain transcription factors. The name of the cut- transcription factor family is based on the pre- viously identified CUT protein from Drosophila melanogaster (Blochlinger et al., 1988). All onecut family members contain a characteristic C-terminal DNA binding domain, com- posed of one CUT motif and one downstream HOMEOBOX motif. The N-terminus differs between onecut family members classifying them into three subgroups: onecut-1, 2 and 3 (OC-1, 2 and 3).
HNF6 contains one CUT DNA binding motif, therefore also called onecut-1 (OC-1), that functions together or independent with the downstreamHOMEOBOX. Beside onecut-1, there are two paralogues known in mice and humans, namely onecut-2 (OC-2) and onecut- 3 (OC-3) that share common expression domains with OC-1, but play different or partially redundant roles in organogenesis (Jaquemin et al., 1999; Vanhorenbeeck et al., 2007).(Jaquemin et al., 1999; Vanhorenbeeck et al., 2007).Vanhorenbeeck et al., 2007).
HNF6/ OC-1 was originally identified in rat as liver enriched transcription factor binding to a gene involved in glucose metabolism (Lemaigre et al., 1996). Studies on its temporal and spatial expression profile in mouse embryogenesis reported an early onset of expressi- on in the developing nervous system and in endoderm derivatives like liver and pancreas at E8.0 (Landry et al., 1997). In the pancreas, HNF6 transcripts were detectable next to (Landry et al., 1997). In the pancreas, HNF6 transcripts were detectable next to. In the pancreas, HNF6 transcripts were detectable next to HNF1β in the Pdx1 positive epithelium of the developing foregut. Therefore HNF6 expres- sion in the anterior endoderm was present in all pancreatic progenitor cells prior to pan- creatic bud formation. Later, HNF6 RNA became restricted to the pancreatic acinar and duct cells (Pierreux et al., 2006). In the adult organism HNF6 expression was evident in the liver, brain, testis, spleen and pancreas (Lemaigre et al., 1996; Hong et al., 2002).Hong et al., 2002).).
In accordance with its early endodermal expression, gene knockout studies in mice de- monstrated that HNF6 plays an important role in liver and biliary duct specification (Clot-(Clot- man et al., 2005), as well as in pancreas organogenesis (Poll et al., 2006). Studies in knock-, as well as in pancreas organogenesis (Poll et al., 2006). Studies in knock-Studies in knock- out mice reported that lack of HNF6 caused a delay in Pdx1 induction at E9 resulting in pancreatic hypoplasia. Promotor studies confirmed that the Pdx1 promotor contained HNF6 site (Jacquemin et al., 2003a). In addition to its role during early pancreas organo-In addition to its role during early pancreas organo-early pancreas organo-pancreas organo- genesis it was also shown that HNF6 stimulated the promotor of the endocrine precursort was also shown that HNF6 stimulated the promotor of the endocrine precursor marker Ngn3 and maintained its activity for proper endocrine cell differentiation and islet formation (Jacquemin et al., 2000; Maestro et al., 2003).
As the Xenopus laevis homologue was not yet identified, it would be of further interest to identify the homologue and to elucidate its function during Xenopus laevis organogen- esis.
1.3 Screening for no�el pancreas specific marker genes in Xenopus laevis
In an attempt to identify new molecular markers for pancreas development, a cDNA library screen was performed of an adult pancreas cDNA library from Xenopus laevis (Afelik et al., 2004). The substractive filter hybridization screen excluded all clones corresponding to di- gestive enzymes. Clones that were negative in the filter hybridisation screen were randomly picked and used for expression analysis in Xenopus laevis embryos. One of them was clone number 150 (“pancreas clone 150”/ p150), that showed pancreas expression at tadpole stage 41. Hence, p150 became interesting for subsequent analysis of pancreas organogenesis.1.4
Xenopus laevis as experimental model systemIn this study, the African clawed frog Xenopus laevis is used as model sytem to study or- ganogenesis. The possibility of easy in vitro fertilization, high number of progeny and fast external development allows rapid and effective manipulation by microinjection and che- mical treatment. Existing cell fate maps allow to target microinjected substances to a pre- dicted region of interest at later developmental stages. In addition, the generation of em- bryonic tissue explants and transplantation assays can serve as important tools to analyze the influence of extrinsic factors on cell fate determination (Vize et al., 1991).
1.5 Aims of this study
Pancreas formation from the gut epithelium requires the activation of a genetic program to specify organ precursor cells. It was shown that early RA- signalling is essential for pancreas specification and early endocrine cell fate determination. Pancreas formation is initiated with the onset of the expression of the transcription factors Pdx1/XlHbox8 and Ptf1a/p48. The two transcription factors HNF1β and HNF6 were described as putativeβ and HNF6 were described as putative and HNF6 were described as putative upstream regulators of Pdx1/XlHbox8 and Ptf1/P48 in mouse. However in Xenopus laevis Pdx1/XlHbox8 and Ptf1/P48 regulation remains obscure. regulation remains obscure.
This study focused on the identification of regulatory mechanism, that link early RA- si- gnalling to later expression of Pdx1/ XlHbox8 and Ptf1a/ p48 during organogenesis. The- refore, we analysed the two transcription factors HNF1β and HNF6. This included the isolation of the Xenopus laevis HNF6 homologue, the generation of its temporal and spatial expression profile and primary functional analysis by ectopic expression within the endo- derm. The HNF1β expression profile was refined and its role during pancreas development characterised by loss- and gain of function approaches. As HNF1β was known to be a RA downstream target in the nervous system (Hernandez et al., 2004), it was of further interest how RA influenced HNF1β expression within the endoderm. Therefore, RA- signalling was activated and inhibited in whole embyros and in endodermal explants. Furthermore,Furthermore, the novel putative pancreas specific marker gene p150 was analysed regarding its expres- sion and its functional analysis was approached by loss- and gain of function studies. In addition, protein structure and biochemical interactions of this undescribed protein were analysed in collaboration with the group of Muhle-Goll (EMBL, Heidelberg).
2.1 Materials 2.1.1 Chemicals:
Basic chemicals used in this study were obtained from companies Fluka, Baker, Sigma-Al- drich, Roth and Merck in high purity grade (p.A.). Special chemicals were obtained from Roche Diagnostics, Fluka, Sigma-Aldrich and Serva.
2.1.2 Buffers and solutions
All media and buffer solutions were made as described in (Sambrook et al., 1989). If not stated differently solutions were made in dH2O and autoclaved for 20 min at 120°C. Heat sensitive chemicals were filtersterilzed (0.2µm, Sartorius).
2.1.3 Enzymes
DNaseI ( 10 U/µl) Biozyme, Cardiff (UK)
RNase Out ( 40U/µl) Invitrogen, Karlsruhe
RNaseT1 (R-8251) ( 2000 U/µl) Sigma-Aldrich, Deisenhofen RNaseA (R-5000) ( 10 mg/ml) Sigma-Aldrich, Deisenhofen Restriction enzymes ( 10 U/µl) MBI-Fermentas, St. Leon-Rot Pyrophosphatase ( 0.1 U/µl) MBI-Fermentas, St. Leon-Rot T4 DNA- ligase ( 3 U/µl) Promega Germany, Mannheim Sp6 RNA- polymerase ( 50 U/µl) Stratagene GmBH, Heidelberg T3 RNA- polymerase ( 50 U/µl) Stratagene GmBH, Heidelberg T7 RNA- polymerase ( 50 U/µl) Stratagene GmBH, Heidelberg GoTaq Flexi DNA-Polymerase ( 50 U/µl) Promega Germany, Mannheim High Fidelity Polymerase Mix MBI-Fermentas, St. Leon-Rot PowerScript ReverseTranscriptase ( 50 U/µl) BD Bioscience Clontech, Heidelberg
Lysozyme ( 10 mg/ml) Invitrogen, Karlsruhe
Proteinase K ( 20 mg/ml) Merck KGaA, Darmstadt AcTEV protease ( 10U/µl) Invitrogen, KarlsruheKarlsruhe
2.1.4 Reaction and purification kits
mMESSAGE mMACHINETM SP6, T7, T3 Ambion Ltd., Huntingdon (UK) ECL+ plus Western Blotting Detection Kit Applied Bioscience GmbH, Weiterstadt SMARTTM RACE cDNA Amplification Kit BD Bioscience Clontech, Heidelberg TNT®-coupled Reticulocyte Lysate System Promega Germany, Mannheim
IllustraTM plasmid spin Mini Kit GE healthcare, Buckinghamshire (UK) IllustraTM GFX PCR DNA and Gel Band
purification Kit
GE healthcare, Buckinghamshire (UK)
IllustraTM RNAspin Mini Kit GE healthcare, Buckinghamshire (UK) Plasmid Midi purification Kit Quiagen GmBH, Hilden
pGEM®-T and pGEM®-T Easy Vector Systems Promega Germany, Mannheim AminoLink© Plus Immobilisation Kit PIERCE, Rockford (US) High fidelity polymerase Kit MBI-Fermentas
Big Dye Terminator v.1.1 Cycle Sequenceing Kit Applied Biosystems, Weiterstadt
2.1.5 Antibodies
Sheep- anti- Digoxigenin- AP (11093274910) Roche Diagnostics, Mannheim Sheep- anti- Fluoreszein- AP (11426338910)anti- Fluoreszein- AP (11426338910)- Fluoreszein- AP (11426338910) Roche Diagnostics, Mannheim Mouse- anti- FlagM2- FITC (F4049)anti- FlagM2- FITC (F4049)- FlagM2- FITC (F4049) Sigma, DeisenhofenDeisenhofen
Mouse- anti- human Hsp47 (SR-B470)anti- human Hsp47 (SR-B470)- human Hsp47 (SR-B470)SR-B470) MoBiTec, Göttingen Goat- anti- mouse- Alexa 594 (A-11005)anti- mouse- Alexa 594 (A-11005)- mouse- Alexa 594 (A-11005) Invitrogen, Karlsruhe Goat- anti- rabbit- HRP (111-035-003)anti- rabbit- HRP (111-035-003) Dianova, Hamburg Mouse- anti- FlagM2 (F 3195)anti- FlagM2 (F 3195) Sigma, Deisenhofen Goat-anti-mouse-HRP (sc-2005) SantaCruz
Goat-anti-rabbit-FITC Sigma, Deisenhofen
Rabbit-anti-malectin Biosystems, Göttingen
2.1.6 Antibiotics
Ampicillin 100 mg/ml in dH2O (use 50 µg/ml)50 µg/ml) Kanamycin 10 mg/ml in dH2O (use 50 µg/ml)50 µg/ml) Penicillin/ Streptomycin 10 000 U/ml penicillin,
10 mg/ml streptomycin in 0.9% (w/v) NaCl (use 10 U/ 10 µg/ml)10 U/ 10 µg/ml)
2.1.7 Oligonucleotides 2.1.7.1 Morpholinos
Morpholino antisense oligonucleotides were purchased from Gene Tools (Philomath, USA). Translation intitiation side is marked in brackets.
name sequence 5��5�� 3�
XHNF1β- Mo1 GCAAAGGCGATAGCTTGGACAC(CAT)
XHNF1β- Mo2β- Mo2- Mo2 C(CAT)TTTCAAGGGGAAAAAAGAAGG
