Aim of the studies - Insights into NEDD8 function and the regulation of its conjugation system

1. Introduction

1.4 Aim of the studies

NEDD8 (Neural precursor cell‐Expressed Developmentally Down‐regulated 8) was originally identified as a developmentally down‐regulated ubiquitin‐like protein. Moreover, it was found to be involved in cell cycle regulation by being covalently conjugated to cullins. In the meantime, several additional substrates for NEDD8 have been identified being involved in various cellular functions like e.g. transcriptional regulation, cell growth or apoptosis. Similar to ubiquitin, covalent attachment of NEDD8 to substrates involves three consecutive steps catalyzed by activating enzymes E1, conjugating enzymes E2, and ligases E3. For NEDD8, one E1 enzyme (APPBP1/UBA3 heterodimer), two E2 enzymes (Ubc12 and Nce2), and several substrate specific E3 enzymes have been identified so far. However, only little is known about if and how these enzymes are regulated. Furthermore, the specificity of Ubc12 and Nce2 for most of the NEDD8 substrates remains elusive. Especially, functions of Nce2 other than the NEDDylation of Cullin5 have not been identified yet.

Recent proteomics data reveal a variety of further possible substrates for NEDDylation, playing roles in mRNA splicing, DNA replication and repair, chromatin remodeling and proteasomal degradation. Thus, it seems that there are many yet unknown and uncharacterized substrates for the NEDDylation pathway in the cell.

This study therefore aimed at:

1. Identifying new substrates and interaction partners of NEDD8 2. Investigating the regulation of the NEDD8‐conjugation cascade 3. Characterizing a second isoform of Nce2

In conclusion, this work shall not only contribute to a better understanding of physiological functions of NEDD8 but also of the NEDDylation pathway in general. Currently, this field is of special interest since MLN4924, an inhibitor of the NEDD8‐activating enzyme, is tested in clinical trials for the treatment of several types of cancer such as acute myeloid leukemia and lymphoma.

2. Material and Methods

2.1 Material

2.1.1 Solutions and media

Name Composition

Laemmli loading buffer (2x) 125 mM Tris‐HCl pH 6.8, 200 mM DTT, 4 % SDS, 0.001 % Bromphenol‐blue

10x Ergänzungspuffer 7.15 M β‐Mercaptoethanol, 40 % (v/v) Glycerol, 100 mM Tris‐HCl, Orange G, pH 7.5

Urea loading buffer (2x) 6 M Urea, 4 % (v/v) SDS, 125 mM Tris‐HCl pH 6.8, 20 % (v/v) Glycerol

Laemmli running buffer (10x) 250 mM Tris‐HCl, 2 M Glycin, 1 % SDS, pH 8.4

Stacking gel buffer 0.5 M Tris‐HCl pH 6.8, 0.4 % SDS Separating gel buffer 1.5 M Tris‐HCl pH 8.8, 0.4 % SDS

Transfer buffer (20x) 12.5 mM Tris‐HCl, 100 mM Glycine, pH 8.3

TNE ‐T 10 mM Tris‐HCl, 2.5 mM EDTA, 50 mM NaCl,

0.1 % Tween 20, pH 7.5

Stripping buffer for western blots 62.5 mM Tris‐HCl pH 6.8, 2 % SDS, 100 mM β‐Mercaptoethanol

Coomassie Blue staining solution 2 g/L Coomassie Brilliant Blue R250 in Coomassie Destain Solution

SDS gel fixation solution / Destain solution 40 % Methanol, 10 % Acetic Acid

DNA loading buffer (10x) 60 % Saccharose, 0.25 M EDTA, Bromphenol‐blue

TAE buffer (50x) 2 M Tris‐HCl, 950 mM Acetic Acid, 50 mM EDTA

Affinity pulldown buffer 20 mM TEA, 50 mM NaCl, 1 mM EDTA, 0,5 % NP40, 10 % glycerol, pH 7.4

TNN lysis buffer 100 mM Tris‐HCl, 100 mM NaCl, 1 % NP‐40, 1 mM Pefabloc, 1 μg/mL Aprotinin/Leupeptin, 1 mM DTT, pH 8.0

RIPA lysis buffer 25 mM Tris‐HCl, 50 mM NaCl, 0.5 %

NP40, 0.5% Deoxycholate, 0.1 % SDS, 1 mM Pefabloc, 1 μg/mL Aprotinin/Leupeptin, pH 8.8

Guanidinium lysis buffer 100 mM Na2HP04/NaH2PO4,

6 M Guanidinium‐Hydrochloride, 10 mM Imidazole, 10 mM β‐Mercaptoethanol, pH 8.0

HP buffer (cellular fractionation) 10 mM HEPES‐NaOH, 20 mM NaCl, 10 mM MgCl2, 0.5 mM ATP, pH 7.4

2x KE buffer (cellular fractionation) 4 g Saccharose, 40 mM HEPES‐NaOH, 1 mM MgCl2, 1 mM ATP, pH 7.4

Buffer Z (β‐gal assay) 100 mM NaH2PO4, 10 mM KCl, 1 mM MgS04, 50 mM β−Μercaptoethanol, pH 7.0

ONPG 4 mg/mL in 100mM Na2HPO4, pH 7.0

Luria Broth medium (LB) 10 g/L NaCl, 5g/L yeast extract

10g/L Bacto‐Tryptone, pH 7.5 (complemented with 100 μg/mL ampicillin, 25 μg/mL

kanamycin or 170 μg/mL chloramphenicol final concentrations)

SOC medium 20 g/L Tryptone, 5 g/L yeast Extract, 0.5 g/L

NaCl, 20 mM Glucose, pH 7

NMM medium 7.5 mM (NH4)2SO4, 8.5 mM NaCl, 22 mM

KH2PO4, 50 mM K2HPO4, 1 mM MgSO4, 1 mg/L CaCl2, 1 mg/L FeCl2, 1 μg/L CuCl2, 1 μg/L MnCl2, 1μg/L ZnCl2, 20 mM Glucose, 10 mg/L thiamine hydrochloride, 10 mg/L d‐biotin,

S1 50 mM Tris‐HCl, 10 mM EDTA,

100 μg/mL RNaseA, pH 8.0

S2 200 mM NaOH, 1 % SDS

S3 2.8 M KAc, pH 5.1

T25N50 25 mM Tris‐HCl, 50m M NaCl, pH 8.0

Washing buffer (antibody purification) 20 mM Tris‐HCl, 500mM NaCl, 0.2 % Triton‐X‐

100, pH 7.5

Elution buffer (antibody purification) 150 mM NaCl, 200mM Glycin, pH 2.3

2.1.2 Chemicals and Reagents

Name Company

Amplifyer GE Healthcare

Aprotinin/Leupeptin SIGMA

Ammonium persulfate ROTH

ATP SIGMA

β‐Mercaptoethanol Merck

BIO‐RAD protein assay BIORAD

Cycloheximide SIGMA

DAPI SIGMA

DTT ROTH

EDTA ROTH

Ethidiumbromide ROTH

Glutathione Sepharose 4B GE Healthcare

Glycine ROTH

Guanidinium Hydrochloride ROTH

HA‐beads (monoclonal anti‐HA agarose conjugate)

SIGMA

HEPES (1M) Gibco

Imidazole USB

IPTG ROTH

Lipofectamine 2000 Invitrogen

MG132 SIGMA

MgCl2 ACROS organics

Milk powder ROTH

MLN4924 Active Biochem

Na2HPO4 SIGMA

NaH2PO4 Merck

Ni‐NTA‐Agarose Qiagen

NP‐40 MP Biomedicals

NP‐40 for cellular fractionation Fluka

ONPG SIGMA

PBS Gibco

PefaBloc Boehringer Ingelheim

Protein A‐Sepharose GE Healthcare

Q Sepharose Fast Flow GE Healthcare

5x Roti Blue ROTH

Rotiphorese Gel 30 ROTH

SDS ROTH

Sepharose CL‐4B GE Healthcare

SulfoLink Coupling Gel Pierce

TEMED ROTH

Triton‐X‐100 ROTH

Trizma Base (Tris) SIGMA

TRIZOL Reagent Invitrogen

Turbofect Fermentas

Tween‐20 ROTH

Western Lightning ECL Perkin Elmer

2.1.3 Bacterial strains

E. coli DH5α:

F^‐ endA1 glnV44 thi‐1 recA1 relA1 gyrA96 deoR nupG Φ80dlacZΔM15 Δ(lacZYAargF)U169, hsdR17(rK‐ mK+), λ–

E. coli BL21‐CodonPlus‐RIL competent cells:

B F^– ompT hsdS(rB– mB–) dcm⁺Tet^r gal endA Hte [argU ileY leuW Cam^r] (Stratagene)

E. coli BL21 (DE3):

F^– ompT gal dcm lon hsdSB(rB‐ mB‐) λ(DE3 [lacI lacUV5‐T7 gene 1 ind1 sam7 nin5])

E. coli B834 (DE3):

F^‐ ompT hsdSB(rB‐ mB‐) gal dcm met (DE3)

E. coli XL10‐Gold:

Tetr D(mcrA)183 D(mcrCBhsdSMRmrr)173 endA1 supE44 thi1 recA1 gyrA96 relA1 lac Hte [F¢

proAB lacI ^qZDM15 Tn10 (Tet^r) Amy Cam^r] (Stratagene)

2.1.4 Mammalian cell lines

H1299: non‐small cell lung carcinoma, p53^‐/‐ ; HEK293T: human embryonal kidney cells;

Cells were cultured in DMEM (Gibco) containing 10 % FCS (Gibco) and 50 µg/mL Normocin (Invivogen) or Penicillin/Streptomycin (1:100, Gibco) on CellStar plates (Greiner).

2.1.5 Antibodies

Primary antibodies

protein name species & type company dilution

HA‐tag α HA 1.1 mouse,

monoclonal

Covance 1:2500

6x His‐tag α His mouse,

monoclonal

Qiagen 1:1000

Myc‐tag α c‐Myc 9E10 rabbit, monoclonal

Abcam 1:1000

Nce2

Abgent 1:100 (IF)

Nce2

NEDD8 α NEDD8 rabbit,

polyclonal

Alexis 1:1000

NEDD8 α NEDD8 rabbit,

monoclonal

Epitomics 1:1000

PCNA α PC10 mouse,

monoclonal

Abcam 1:5000

Secondary Antibodies

name species company dilution

HRP‐coupled α mouse goat Dianova 1:20000

HRP‐coupled α rabbit goat Dianova 1:20000

AlexaFluor568 α mouse donkey Invitrogen 1:1000

AlexaFluor488 α mouse goat Invitrogen 1:1000

2.1.6 Primers

Name Sequence

AR28 ggggatccttacccacctctgagacggag

AR31 ggcagggatccttatcctcctctaagagccaacaccaggtg AR64 gcggtcgacttatttcaggcagcgctc

AR84 gtcggatccatgctaacgctagcaagtaaactg AR89 gtccatatgctaacgctagcaagtaaactg AR95 cacctcgagtcatctggcataacgtttgat

AR109 cccggatcctcagtgatggtgatggtgatgtctggcataacgtttgatgtagt AR111 gacaggggaaatatCtctgagtttattgag

AR112 ctcaataaactcagagatatttcccctgtc AR113 gacaggggaaataGCtctgagtttattgag AR114 ctcaataaactcagagctatttcccctgtc AR121 gtcggatccatgactcggagggtttctgtgagag

AR130 GagatatacatATGcatcaccatcaccatcacatgctaattaaagtgaagacg

AR131 GagatatacatATGcatcaccatcaccatcacATGCAGATCTTCGTCAAGACC AR190 ggcGGATCCatgctaattaaagtgaagacg

DP7 CAAGATCTGGCACCCCGCCATCACAGAGACAGG

DP8 CCTGTCTCTGTGATGGCGGGGTGCCAGATCTTG

DP9 CAATGGTCTATCACCCCGCCATTGACCTCGAGGGC DP10 GCCCTCGAGGTCAATGGCGGGGTGATAGACCATTG DP24 TAACGCTAGCAAGTAGACTGAGGCGTGACGATGGTCT DP25 AGACCATCGTCACGCCTCAGTCTACTTGCTAGCGTTA

DP26 ATGATCAGGCTGTTCTCGCTGAGGCAGCAGAGGAAGGAGGAGGAGTC DP27 GACTCCTCCTCCTTCCTCTGCTGCCTCAGCGAGAACAGCCTGATCAT DP28 GGCAGATCTATGCTAATTAAAGTGAAGACGC

DP31 TTGGCTCTGAGAGGAGTAATGATCAAGCTGTTCTCG DP32 CGAGAACAGCTTGATCATTACTCCTCTCAGAGCCAA DP46 GTCGGATCCATGCTAACGCTAGCAAGTAG

DP59 CTTTTGCACTGAGGTTCCTGAACTTCTTTAC DP60 GTAAAGAAGTTCAGGAACCTCAGTGCAAAAG

DP68 GACTTGTCCCGCAAATGATG

DP69 CATCATTTGCGGGACAAGTCCCCAATGCTGTTACTCCACAGGAG DP70 CATCCACTTTATTCCGGAAGTCCTCCTGTGGAGTAACAGCATT DP71 GACTTCCGGAATAAAGTGGATGACTACATCAAACGTTATGCCAG

Name Sequence

DP72 CTGCAATCGTCCCCTTTTATTATCTGGCATAACGTTTGATGTAGT DP73 ATAATAAAAGGGGACGATTGCAGGCCCATGGACTGTGTTACA DP74 AACTCGAGTCATGTTAGAGACAAACTGTAACACAGTCCATGGGC

DP75 CCGGATCCTCAGTGATGGTGATGGTGATGTGTTAGAGACAAACTGTAACAC DP76 GGCCTCGAGTTATCTTAGTCTTAAGACAAG

DP77 CTGTGGAGTAACAGCATTGG

2.1.7 Plasmids constructed and used in this study

Name Insert Vector Primers

Dana1 His‐NEDD8 pET3a AR130/AR31

Dana4 His‐Ubiquitin pET3a AR131/AR28

Dana7 Nce2 wt‐His pET3a AR89/AR109

Dana19

His‐Nce2 N108A pET3a Mutagenesis

(DP7/DP8)

Dana20 His‐Ubc12 N103A pET3a Mutagenesis

(DP9/DP10)

Dana45 Ubc12 K3R/K8R/K11R pcDNA 3HA Mutagenesis (DP 26/DP27)

Dana46 Ubc12 K3R/K8R/K11R‐

His pET3a Mutagenesis

(DP 26/DP27)

Dana48 Nce2 K7R/K9R pcDNA 3HA DP46/AR95

(from Dana52)

Dana49 Nce2 K7R/K9R‐His pET3a Mutagenesis

(DP24/DP25)

Dana51 Fusion Nedd8 G76V ‐

Ubc12 pcDNA 3HA DP31/DP32

DP28/AR64

Dana54 Fusion Nedd8 G76V ‐ Nce2 pcDNA 3HA AR190/AR95 (from Dana‐58)

Dana77 His‐PCNA Y211F pcDNA

3.1/Genestorm Mutagenesis DP59/DP60

Dana95 His‐Nedd8 M50A G76M

(for click reaction)

pGDR11 subcloned from pMA‐T

(Geneart) EcoRI/BamHI

Dana97 HA‐ Nce2 isoform 2 pcDNA3HA subcloned from

Dana99 (pGEX2TK‐

Nce2 isoform2) BamHI/XhoI

Dana98 Nce2 isoform 2‐His pET3a AR89/DP75

Dana104 ΔN26 Nce2 isoform2 pcDNA3HA AR121/DP74

Dana105 Nce2 isoform2 C116S pcDNA3HA Mutagenesis

AR111/AR112

Dana106 Nce2 isoform2 C116A pcDNA3HA Mutagenesis

AR113/AR114

Dana107 Nce2 isoform 2 C116S‐His pET3a Mutagenesis

AR111/AR112

Dana108 Nce2 isoform 2 C111A‐His pET3a Mutagenesis

AR113/AR114

2.1.8 Other plasmids used in this study

Name Insert Vector Reference

ARF41 NEDD8 pcDNA3HA M. Scheffner

ARF56 Ubc12 ΔN26‐His pET3a M. Scheffner

ARF123 Nce2 wt pcDNA3HA M. Scheffner

ARF129 Nce2 C116A pcDNA3HA M. Scheffner

ARF134 Ubc12 wt pcDNA3HA M. Scheffner

ARF135 Ubc12 C111S pcDNA3HA M. Scheffner

ARF136 Ubc12 C111A pcDNA3HA M. Scheffner

ARF137 Ubc12 ΔN26 pcDNA3HA M. Scheffner

ARF139 Nce2 C116S pcDNA3HA M. Scheffner

ARF140 Nce2 ΔN26‐His pET3a M. Scheffner

ARF144 Ubc12‐His pET3a M. Scheffner

ARF145 UbcH5b‐His pET3a M. Scheffner

ARF162 Nce2 ΔN26 pcDNA3HA M. Scheffner

ARF175 Nce2 pcDNA4TOmycHisB M. Scheffner

ARF181 Ubc12 pcDNA4TOmycHisB M. Scheffner

β‐gal β‐galactosidase pRcCMV M. Scheffner

Click NEDD8 His‐NEDD8 M50A

G76M pMA‐T ordered from Geneart

(Invitrogen) Click Ubiquitin His‐Ubiquitin

G76M

pGDR11 S. Eger (AG Marx,

University of Konstanz)

GST ‐ pGEX2TK GE Healthcare

GST‐NEDD8 NEDD8 pGEX2TK M. Scheffner

GST‐Ubiquitin Ubiquitin pGEX2TK M. Scheffner

HA‐Ubiquitin Ubiquitin pcDNA3HA M. Scheffner

His‐Nedp1 Nedp1 pcDNA3.1/V5‐His R. Hay (SCILLS,

University of Dundee)

His‐SUMO1 His‐SUMO1 pSG5.0‐Spl M. Scheffner

His‐Ub His‐myc‐ubiquitin pcDNA3.1 M. Scheffner

Myc‐Rad18 Myc‐Rad18

(human) pCAGGS Satoshi Tateishi

(Kumamoto University, Japan)

N31,N32 His‐NEDD8 pSG5.0‐Spl

M. Scheffner

PCNA for click reaction (164TAG)PCNA (yeast),

tRNA (M. barkeri)

pET11a M. Rubini (AG Marx,

University of Konstanz) PCNA‐SV5‐His wt PCNA‐SV5‐His

(human) pcDNA3.1 Genestorm S. Jentsch

(MPI,Martinsried) PCNA K164R‐SV5‐His PCNA K164R‐

SV5‐His (human) pcDNA3.1 Genestorm S. Jentsch

(MPI,Martinsried)

pGSTHsAPPBP1rbsUBA3 GST‐

APPBP1/UBA3 pGST (Huang and Schulman,

2005)

PylS Pyrrolysine

Synthetase

pRcCMV ‐ pRcCMV Invitrogen

2.1.9 DNA‐ and protein markers

‐GeneRulerTM 1kb Plus DNA Ladder (MBI Fermentas):

20000, 10000, 7000, 5000, 4000, 3000, 2000, 1500, 1000, 700, 400, 300, 200, 75 [bp]

‐ PageRulerTM Prestained Protein Ladder (MBI Fermentas):

170, 130, 95, 72, 55, 43, 34, 26, 17, 10 [kDa]

‐ PageRulerTM Unstained Protein Ladder (MBI Fermentas):

200, 150, 120, 100, 85, 70, 60, 50, 40, 30, 25, 20, 15, 10 [kDa]

2.2 Methods

2.2.1 PCR and cloning

2.2.1.1 Polymerase chain reaction (PCR)

For cloning, Phusion Hot Start II High Fidelity DNA Polymerase (Finnzymes) was used according to manufacturer´s instructions. For colony PCR, Taq polymerase (AG Scheffner) and Thermo Pol 10x buffer (New England Biolabs) were employed. 10 µM primers and 0.2 mM of all dNTPs were used for each reaction.

2.2.1.2 Gene synthesis

To synthesize cDNA of the specific part of Nce2 Isoform2, 3 µl of primers DP69‐DP74 (10 µM each) were pooled and 1 µl of the oligo pool was used for touch down PCR (7 cycles starting from 60 °C annealing temperature decreasing to 57.9 °C; 3 cycles with 57.9 °C) with Phusion polymerase (Finnzymes). For gene synthesis PCR, 1 µl of the assembly PCR was applied as template and DP69 and DP74 as primers (27 cycles touch down PCR starting from 60 °C annealing temperature and decreasing in 0.3 °C steps each cycle; 3 cycles with 52 °C annealing temperature). In a PCR using AR84 and DP74, the obtained product was fused to the unspecific part of Nce2 which was amplified before with primers AR84 and DP68.

2.2.1.3 Site directed mutagenesis

Point mutations were introduced using QuickChange Site‐Directed Mutagenesis (Stratagene) according to manufacturer´s instructions. Complementary primers containing mutations were used for performing PCR. 10 µl of PCR product were digested with DpnI (NEB) and one fifth of the digest was transformed into supercompetent XL10 gold E. coli cells.

2.2.1.4 Restriction digest

All restriction enzymes were obtained from NEB and incubated with DNA in the recommended buffer in a volume of 50 µl for 2 h at 37 °C. Vectors cut with only one enzyme were additionally treated for 1 h with 1 µl Antarctic Phosphatase (NEB) in the appropriate buffer. Before ligation, DNA was purified using NucleoSpin Extract II kit (Clontech).

2.2.1.5 Agarose gel electrophoresis

To prepare 1 % or 2 % (w/v) agarose gels, agarose was boiled in TAE buffer. Subsequently, ethidium bromide (ROTH) was added to a final concentration of 0.5 µg/mL. Gels were submerged in TAE buffer in a horizontal gel electrophoresis chamber and run at 3 V/cm.

Agarose gels were analyzed with a UV transilluminator and photographed using the LAS‐3000 imaging system (Fujifilm).

2.2.1.6 Purification of DNA from agarose gels

After gel electrophoresis, desired DNA fragments were excised from the agarose gel under a UV transilluminator and purified using NucleoSpin Extract II kit (Clontech).

2.2.1.7 Ligation

Purified vector and insert were ligated using T4 ligase and either 5x rapid ligation buffer or 10x ligation buffer (Fermentas). The whole reaction was transformed into supercompetent E. coli XL10 gold cells.

2.2.1.8 Transformation of DNA into chemical competent E. coli

Plasmid DNA (whole ligation reaction or 100 ng of purified DNA) was mixed with 100 µl chemical competent bacteria and incubated on ice for 30 min. After a heat shock for 45 sec at 42 °C, cells were cooled down for 10 min on ice. Transformants containing Ampicillin resistance were directly plated on LB agar plates. Transformants carrying Chloramphenicol, Kanamycin or Zeocin resistance were incubated for 1 h in SOC medium at 37 °C to allow expression of the resistance genes. After plating, selection plates were incubated over night at 37 °C.

2.2.1.9 Preparation of DNA in low and high scale

Small scale plasmid purification was performed using alkaline lysis (Birnboim and Doly, 1979).

Preparation of higher amounts of DNA was carried out using 100 mL overnight culture and PureYield Plasmid Midiprep System (Promega).

2.2.1.10 Measurement of DNA and RNA concentrations

DNA and RNA concentration was measured using a nanophotometer (NorthStar Scientific) according to manufacturer’s instructions.

2.2.1.11 DNA sequencing

All sequencing reactions were performed by GATC (Konstanz/Köln).

2.2.2 Maintenance of bacterial cultures and mammalian cell lines

2.2.2.1 Bacterial cultivation and preparation of glycerol stocks

Glycerol stocks of BL21 RIL bacteria containing plasmids for protein expression were prepared by mixing 600 µl sterile glycerol and 1.4 mL overnight culture. Cryovials containing glycerol stocks were stored at ‐80 °C.

2.2.2.2 Maintenance of mammalian cell lines

Mammalian cells were kept in the Heraeus CO2 incubator BBD 6220 (Thermo Fisher Scientific) at 37 °C, 95 % humidity and 5 % CO2. All cell lines were cultured with DMEM (Gibco) supplemented with 10 % FCS (v/v) (Gibco) and 50 µg/mL Normocin (Invivogen) or Penicillin/Streptomycin (1:100, Gibco).

To split cells, 90 % confluent dishes were washed with PBS and trypsinized with 0.05 % trypsin‐

EDTA (Gibco). After a short incubation at 37 °C, detached cells were collected with DMEM containing 10 % FCS to stop the trypsin reaction, and transferred into a Falcon tube. Cells were spun down at 1000 rpm for 1 min. The obtained cell pellet was resuspended and distributed in new dishes according to requirements.

2.2.2.3 Freezing of cells in liquid nitrogen

90 % confluent cells were trypsinized and collected by centrifugation. The cell pellet was resuspended in 1 mL FCS containing 10 % DMSO (v/v) and transferred into a cryovial. The vial was kept in the freezing container Cryo 1°C (Nalgene) at ‐80 °C overnight and finally stored in liquid nitrogen.

2.2.3. Protein expression and ‐purification

2.2.3.1 Expression and purification of GSTfusion proteins in E. coli

A distinct volume of LB medium containing 100 mg/mL ampicillin and 170 µg/mL chloramphenicol was inoculated with bacteria from a LB agar plate or a glycerol stock and kept overnight at 37 °C and 200 rpm. The overnight culture was diluted to OD600nm=0.1 the next

morning. After growing to an OD600nm=0.6‐0.8, protein expression was induced by the addition of IPTG to a final concentration of 0.4 mM. The bacterial culture was incubated at 37 °C and 200 rpm for 4‐6 h and then centrifuged at 5000 rpm for 15 min. The obtained pellet was resuspended with PBS/1 % Triton‐X‐100 (v/v). Bacterial lysate was then sonicated 2x with 40 pulses (duty cycle: 30‐40 %, output control: 3‐4) using BRANSON sonifier 250 and centrifuged at 13000 rpm for 15 min. Supernatant was transferred into a fresh tube and incubated with 200 µl Glutathione Sepharose 4B (GE Healthcare) in PBS/1 % Triton‐X‐100 per 200 mL diluted overnight culture for 2 h at 4 °C. Beads were washed three times with 5 mL PBS/1 % Triton‐X‐

100 and once with T25N50. Proteins were eluted from the beads using 10 mM Glutathione in 50 mM Tris‐HCl pH 8 or used bound to beads for GST‐pulldown (2.2.5.2).

GST‐APPBP1/UBA3 was prepared according to (Huang and Schulman, 2005).

2.2.3.2 Expression and purification of Histagged proteins in E. coli

Bacterial lysate containing the desired protein was prepared as described in 2.2.3.1. Lysate was incubated with 10 mM Imidazole and 100 µl Ni‐NTA‐Agarose (Qiagen) in PBS/1 % Triton‐X‐100 per 200 mL diluted overnight culture for 4 h or overnight at 4 °C. Beads were washed three times with 5 mL PBS/1 % Triton‐X‐100 containing 20 mM Imidazole and once with T25N50.

Elution was performed with 300 mM Imidazole in T25N50.

2.2.3.3 Expression and purification of NEDD8 and Ubiquitin for click reactions

Methionine auxotrophic E. coli B834 (DE3) containing His‐Ubiquitin G76M in pGDR11 were kindly provided by Silvia Eger (AG Marx, University of Konstanz). His‐NEDD8 M50A G76M was cloned into pGDR11 and transformed into chemical competent methionine auxotrophic E. coli B834 (DE3) provided by AG Marx, University of Konstanz. To express His‐Ubiquitin or His‐

NEDD8, 10 mL LB medium containing 100 mg/mL ampicillin were inoculated with the respective bacteria and incubated overnight. 500 µl overnight culture were added to 500 mL new minimal media (NMM) containing 0.4 mM methionine and grown to an OD600nm of 0.8.

Medium was then changed to NMM with 0.5 mM azidohomoalanine (provided by AG Marx, University of Konstanz). After 30 min, protein expression was induced with 1 mM IPTG. After growing for 4‐6 h, bacteria were centrifuged and the pellet was stored at ‐80 °C until further use.

His‐Ubiquitin G76M (Aha) and His‐NEDD8 M50A G76M (Aha) were purified as described in 2.2.3.2 and dialyzed using Slide‐A‐Lyzer MINI Dialysis Devices (3.5 MWCO) to exchange the buffer to 20 mM Tris‐HCl (pH 7.5), 20 mM NaCl, 5 % glycerol.

2.2.3.4 Expression and purification of PCNA for click reaction

Plasmids containing tRNA synthetase PylS, pyrrolysine tRNA and (164TAG) PCNA were kindly

plasmids into E. coli BL21 (DE3), several colonies were tested for expression of PylS and truncated PCNA. The colony with the best expression was used to create a glycerol stock.

10 mL LB medium containing 10 mg/mL ampicillin and 25 µg/mL kanamycin were inoculated with the before mentioned glycerol stock and incubated at 37 °C and 200 rpm overnight. Cells were diluted 1:100 the next morning and at OD600nm= 0.3, Plk (provided by AG Marx, University of Konstanz) was added to a final concentration of 1 mM. Protein expression was induced with 1 mM IPTG at OD600nm= 0.8. After 6 h, cells were harvested by centrifugation.

The pellet was resuspended in lysis buffer (50 mM Tris‐HCl, 1 mM EDTA, 0.2 mg/mL lysozyme, 1 µg/mL aprotinin, 1 µg/mL leupeptin, 1 mM PefaBlock, 5 % glycerol, pH 7.5) and incubated on ice for 30 min. Afterwards, 0.02 % IGEPAL was added and the lysate was sonicated 2x 40 pulses (duty cycle: 30‐40 %, output control: 3‐4) using BRANSON sonifier 250.

After centrifugation (13000 rpm, 15 min), 150 mM ammonium sulfate and polyethyleneimine (400 µl 5 % PEI for 10 mL lysate) were added to the supernatant and stirred for 10 min at room temperature. In a next step, lysate was centrifuged at 15000 rpm for 40 min. Additional ammonium sulfate (0,23 g/mL) was added to the supernatant, stirred for 1 h at room temperature and then centrifuged at 15000 rpm for 30 min. The same procedure was repeated with 0,24 g/mL ammonium sulfate and the obtained pellet was resuspended in buffer A (20 mM Tris/HCl; 20 mM NaCl; 1 mM EDTA; 1 mM DTT; 5 % glycerol, pH 7.5). The protein was the loaded on a Q sepharose column (3 mL beads/1L culture) (Q sepharose Fast Flow, GE Healthcare) and eluted with a NaCl gradient in buffer A from 100 mM‐1 M NaCl (elution of PCNA at 300‐500 mM). Fractions containing pure protein were pooled and dialyzed (Spectra/Por MWCO 6‐8kDa, 14.6 mm, Serva) against buffer A containing 0.5 mM EDTA.

2.2.3.5 In vitro translation

In vitro translation was performed using TNT coupled Reticulocyte Lysate System (Promega) and S³⁵‐labeled methionine (Perkin Elmer) according to manufacturer´s instructions.

2.2.4 Protein analysis

2.2.4.1 Bradford assay

Bio‐Rad Protein Assay (Bio‐Rad) was used to normalize total protein amounts according to manufacturer´s instructions. 200 µl Bradford reagent were mixed with 1 µl cell lysate and absorption was measured at 595 nm using a micro plate reader (Wallac 1420 VICTOR Multilabel Plate Reader).

2.2.4.2 SDSpolyacrylamide gel electrophoresis (SDSPAGE)

SDS‐PAGE was performed according to the protocol of (Laemmli, 1970). Dependent on the size of proteins, 12.5 %, 15 % or 5‐15 % (gradient gels) final concentration of acrylamide in separating gels was used. For cellular assays, protein amounts were equalized either by β‐

galactosidase or Bradford assay. Samples were incubated with 5x or 2x loading buffer (reducing conditions) for 5 min at 95 °C or 2x Urea buffer (non‐reducing conditions) for 15 min at RT.

Electrophoresis was performed at a constant current of 50 mA (or 25 mA for thioester assays).

Gels were analyzed by Coomassie blue staining, western blot or fluorography.

2.2.4.3 Coomassie Blue and colloidal Coomassie staining

After SDS‐PAGE, gels were stained with Coomassie for 15 min at room temperature and destained with destain solution for several hours. For Colloidal Coomassie staining, 5x Roti‐Blue (ROTH) was used according to manufacturer´s manual.

2.2.4.4 Fluorography

To detect S³⁵‐labeled proteins, gels were fixed for 15‐30 min in 40 % methanol and 10 % acetic acid. Signals were enhanced by incubating gels for 15‐30 min in Amplify (Amersham Biosciences). After drying for 2 h at 80 °C, gels were applied to an Imaging plate BASIIIs (Fuji) and signals were detected using BASReader (Raytest).

2.2.4.5 Western Blot

Protein samples were separated by SDS‐PAGE and gels were equilibrated in transfer buffer.

PVDF membrane (Millipore) was activated in methanol and consecutively washed in transfer buffer. Western blotting was performed in a wet transfer apparatus (BIO‐RAD) for 90 min at 60 V. Afterwards, membranes were incubated in 5 % milk (w/v) in TNE‐T for 30 min and washed with TNE‐T two times for 10 min. After incubation with the primary antibody for 1 h, membranes were washed three times for 10 min. Secondary antibody coupled to horse radish peroxidase was applied for 45 min. Blots were washed three times and developed using Western Lightning‐Plus ECL (Perkin Elmer) in the imaging system LAS‐3000 (Fujifilm).

When necessary, blots were stripped using stripping buffer for 30 min at room temperature.

Afterwards, blots were washed several times with TNE‐T, blocked again and incubated with another antibody.

2.2.5 In vitro assays

2.2.5.1 MethanolChloroform precipitation of proteins

Proteins were precipitated according to (Wessel and Flugge, 1984). The protein solution was mixed with the same volume Methanol: Chloroform (4:1) by vortexing. After centrifugation at 13200 rpm for 5 min at room temperature, supernatant was removed and Methanol was added

Im Dokument Insights into NEDD8 function and the regulation of its conjugation system (Seite 32-136)