Population and molecular genetic analyses of persistent right aortic arch and primary cataracts in the German Pinscher

(1)

Tierärztliche Hochschule Hannover

Population and molecular genetic analyses of persistent right aortic arch and primary cataracts

in the German Pinscher

INAUGURAL-DISSERTATION

zur Erlangung des Grades einer Doktorin der Veterinärmedizin - Doctor medicinae veterinariae –

(Dr. med. vet.)

vorgelegt von Julia Menzel

Stuttgart

Hannover 2010

(2)

Wissenschaftliche Betreuung: Prof. Dr. Ottmar Distl

Institut für Tierzucht und Vererbungsforschung

1. Gutachter: Prof. Dr. Ottmar Distl 2. Gutachter: Prof. Dr. Sabine Kästner

Tag der mündlichen Prüfung: 20.05.2010

(3)

(4)

Teile dieser Arbeit sind bei folgenden Zeitschriften zur Veröffentlichung angenommen:

1. The Veterinary Journal 2. Veterinary Ophthalmology

(5)

The German Pinscher is an old breed and is included in the origins of the Doberman Pinscher, the Miniature Pinscher, the Affenpinscher, the Miniature Schnauzer, the Standard Schnauzer and the Giant Schnauzer. The Wired Haired and Smooth Haired Pinschers, as the Standard Schnauzer and German Pinscher were originally called, were shown in dog books as early as 1884. Following both World Wars, the breed was nearly lost. There were no new litters registered in West Germany from 1949 to 1958. At this time, Werner Jung searched the farms in Germany for typical Pinschers and used these dogs along with four oversized Miniature Pinschers and a black and red bitch from East Germany. Most German Pinschers today are descendants of these dogs.

The modern German Pinscher has therefore a relatively small gene pool. Attention to potential health concerns is very important for the breed in the future. With increasing knowledge on prevalence and pathogenesis of eye diseases and vascular ring anomalies, breeding guidelines need to be developed for reducing the prevalences of presumed inherited diseases. Therefore, it is of particular importance to clarify the population and molecular genetic background of these diseases.

Vascular ring anomalies (VRAs) are developmental anomalies of the embryonic aortic arches. Persistent right aortic arch (PRAA) is the most common VRA in dogs.

Because vascular rings cause oesophageal compression, regurgitation soon after eating solid food is the principal clinical sign of PRAA in young dogs. In PRAA- affected dogs, the aorta is formed by the right fourth aortic arch instead of the left fourth aortic arch. In the German Pinscher, a rare combination of anomalies occurs.

This type of PRAA (PRAA-SA-LA) is characterized by a left retrooesophageal subclavian artery in combination with a ligamentum arteriosum originating at the aberrant left subclavian artery, and has only been reported in two isolated cases of other dog breeds before. Surgical treatment is the only effective treatment for this disease, and therefore prevention is very important for animal welfare.

Primary cataracts are characterized as a focal or diffuse opacity of the eye lens. It is a very common eye disease in the dog, and reported prevalences range between 1.8

(13)

Introduction

and 88.0%. The age of onset of inherited cataracts may be congenital, juvenile or senile. Usually inheritance is presumed, based on the typical appearance and age in a breed known to be predisposed to cataracts. In the majority a recessive mode of inheritance is existent, but also dominant pattern are described. Given the limited success of medical treatment and the invasiveness of surgical treatment of cataracts, prophylactive measures should be considered more closely. At this time, many kennel clubs have developed selection programs to reduce the prevalences of primary cataracts in their breed.

In the future, the most successful method to reduce primary cataracts as well as PRAA would be to identify the genetic background and the causal mutations of both diseases in the affected breeds. Genetic tests can be used to select breeding animals that do not carry and transmit defect alleles. Especially in a small population as the German Pinscher is, a DNA test, showing if the dog is homozygous for a primary cataract-causing or PRAA-causing mutation or a heterozygous carrier or free from primary cataract-causing or PRAA-causing mutations would be very helpful.

Combined with an adequate breeding program, the prevalence of primary cataracts and PRAA could be more effectively decreased, and in addition, the risk of a selection-caused bottle-neck-phenomenon could be minimized.

The purpose of this study was to analyse the population and molecular genetic background of primary cataracts and persistent right aortic arch in German Pinschers and to describe a specific form of persistent right aortic arch which has only been reported in two isolated cases of other dog breeds before.

The contents of the present thesis are presented in single papers as allowed by § 8 (3) of the Rules of Graduation (Promotionsordnung) of the University of Veterinary Medicine Hannover, Germany. The report of the specific form of persistent right aortic arch in German Pinschers is presented in chapter 2, while chapter 3 comprises the results of evaluation of TBX1 as a candidate gene for this rare form of persistent right aortic arch in German Pinschers. The study of prevalence and formation of primary cataracts in the German Pinscher population in Germany is presented in chapter 4. The results of molecular genetic analyses of primary cataracts in German

(14)

Pinschers are presented in chapter 5. Finally, the results of the present thesis are generally discussed and summarised in chapter 6 to 8.

(15)

CHAPTER 2

Unusual vascular ring anomaly associated with a

persistent right aortic arch and an aberrant left subclavian artery in German Pinschers

Julia Menzel, Ottmar Distl

Institute for Animal Breeding and Genetics, University of Veterinary Medicine Hannover, Foundation, Bünteweg 17p, 30559 Hannover, Germany

Accepted for publication in: The Veterinary Journal

(16)

2 Unusual vascular ring anomaly associated with a persistent right aortic arch and an aberrant left subclavian artery in German Pinschers

2.1 Abstract

The objective of this study was to describe a specific form of persistent right aortic arch (PRAA) in three German Pinschers and to analyse the mode of inheritance in this dog breed. This type of PRAA is characterized by a left retrooesophageal subclavian artery in combination with a ligamentum arteriosum originating at the aberrant left subclavian artery (PRAA-SA-LA). This rare combination of anomalies has only been reported in two isolated cases of other dog breeds before. In the German Pinscher, the occurrence of any form of PRAA was not previously known. In this study, 18 cases of this congenital anomaly were ascertained and their high degree of relatedness and inbreeding could be shown through pedigree analysis.

Three of the affected dogs underwent further clinical investigations and for two of them, post-mortem findings and, for one dog, findings at the surgery verified the diagnosis of PRAA-SA-LA. In this third dog, the PRAA-SA-LA was successfully corrected by surgery and after this intervention normal development was observed. A monogenic autosomal recessive mode of inheritance was not likely. Further research is required for unravelling a possible involvement of genes located within the syntenic canine DiGeorge region.

2.2 Introduction

Vascular ring anomalies (VRAs) are developmental anomalies of the embryonic aortic arches. The result of these anomalies is a complete or partial circle around the trachea and the oesophagus formed by blood vessels and associated structures, which may lead to a compression of the encircled structures. Persistent right aortic arch (PRAA) is recognized as the most common VRA (Helphrey, 1979; Ellison, 1980;

Muldoon et al., 1997), representing 95 % of all VRAs diagnosed in dogs (Buchanan, 2004). In PRAA affected dogs, the aorta is formed by the right fourth aortic arch

(17)

Unusual vascular ring anomaly associated with a persistent right aortic arch and an aberrant left subclavian artery in German Pinschers

instead of the left fourth aortic arch (Kim et al., 2006). PRAA is a common cause of regurgitation and usually results in a dilated oesophagus in young dogs (Muldoon et al., 1997, Kim et al., 2006). In this anomaly, the ligamentum arteriosum typically joins the pulmonary artery to the abnormally positioned aorta and creates the VRA around the oesophagus and the trachea. PRAA with an aberrant left subclavian artery (PRAA-SA) is observed in 33% of all dogs with PRAA (Buchanan, 2004). In cases of a PRAA-SA, the oesophagus is compressed by the vascular ring comprised of the persistent right aortic arch with left subclavian artery and by a partial ring formed by the aberrant left subclavian artery (Ellison, 1980). Only in two reported cases of PRAA-SA, the ligamentum arteriosum extended from the main pulmonary artery to the aberrant left subclavian artery instead of the aortic arch (PRAA-SA-LA) (House et al., 2005). This rare course of the ligamentum arteriosum enforces the compression of the oesophagus by the aberrant left subclavian artery.

Initially, no clinical signs are visible in the newborn puppies affected by PRAA, PRAA-SA or PRAA-SA-LA. The first clinical symptoms appear with the ingestion of solid food and consist of postprandial regurgitation of food in both types of vascular ring anomalies (Buchanan, 2004; VanGundy, 1989). Because of the constriction of the oesophagus at the level of the heart base, transport of ingesta is not possible or markedly decreased, leading to regurgitation. In addition, part of the ingested food remains cranial to the constriction in the oesophagus, resulting in enlargement of the oesophagus in the precardiac area. Affected puppies retard in growth and lose weight despite great appetite. Contrast radiographies of the thorax show oesophageal dilatation cranial to the heart with constriction at the level of the heart base (Buchanan, 1968; VanGundy, 1989). The extent of the oesophageal constriction varies with some puppies not able to ingest paste-like food and others puppies regurgitating only after solid food intake.

Surgical treatment is required to eliminate the oesophageal constriction (Ellison, 1980). The postoperative treatment includes feeding slurry of canned food in a vertical position. The earlier the diagnosis and the surgical intervention, the better are

(18)

the chances for complete recovery and the absence of a precardiac dilatation of the oesophagus (Ellison, 1980; VanGundy, 1989; House et al., 2005; Fingeroth and Fossum, 1987). Reports of long-term outcome following surgical correction are variable: a recent study found that 92% of the dogs had a complete resolution of clinical signs even though mild cranial oesophageal dilation persisted (Muldoon et al., 1997). Epidemiologic studies as well as breeding studies have shown that German Shepherds, Irish Setters and Greyhounds are genetically predisposed to the development of PRAA (Patterson, 1968; Gunby et al., 2004), the mode of inheritance being complex and polygenic in its basis (Patterson, 1989).

There are no reports of any forms of PRAA in German Pinschers. However, in the last 6 months PRAA-SA-LA has been diagnosed in three German Pinscher puppies from Germany and The Netherlands. Fifteen other cases of PRAA have been reported by breeders or veterinarians and therefore have to be regarded partly as presumptive diagnoses. This number of cases shows a high prevalence in German Pinschers and raises the suspicion of a genetic cause. The objectives of this study were to describe the congenital conotruncal anomalies and to examine if PRAA could be an inherited defect in German Pinschers.

2.3 Materials and methods

The Pinscher-Schnauzer-Klub (PSK) in Germany contacted the Institute for Animal Breeding and Genetics of the University of Veterinary Medicine, Hannover because of several recent cases of PRAA in German Pinschers. A total of 18 cases from 16 different litters were reported in the last ten years. Three of them underwent further investigations at the Hannover Institute for Animal Breeding and Genetics.

In the three German Pinschers, the cause of oesophageal constriction was a persistent right aortic arch, an aberrant left subclavian artery and a left ligamentum arteriosum with its origin on the left subclavian artery (PRAA-SA-LA). The 15 remaining cases were reported by veterinarians or breeders and dog owners from

(19)

Germany and the Netherlands. One of these 15 puppies was examined in a private institute for pathology in the Netherlands with the diagnosis of PRAA-SA-LA. Another dog underwent corrective surgery at the Faculty of Veterinary Medicine at the Ludwig-Maximilians-University in Munich ten years ago with a diagnosis of PRAA without further specification and lives now without any complications. In the other 13 dogs, diagnoses were made on the basis of clinical signs, radiographies and contrast oesophagrams, and therefore have to be regarded as presumptive diagnoses. One female dog which is now seven years old lives since the age of eight months with the presumptive diagnosis of PRAA (not specified). As the owner reported, this PRAA- affected dog was the smallest puppy of the litter and always a bit too thin. The clinical signs started soon after weaning with intermitted postprandial regurgitation though showing a great appetite. The veterinarian made the presumptive diagnosis of PRAA using radiographies, clinical symptoms and contrast oesophagram. The owner started to feed this dog about six to eight times daily with small amounts of slurry of pureed soft dog food mixed with water in an upright position after this time and kept this feeding regime up to now. The dog is doing more or less well with this treatment, regurgitation occurs at a maximum of two times/month, mostly after having obtained pieces of normal dog food or something similar. At present, the dog has a normal weight for his size. All in all, 2/18 dogs ascertained underwent a corrective surgery, 15/18 dogs were euthanized as puppies mainly because of poor body condition, and 1/15 dog is living without surgical treatment.

The pedigrees of the affected dogs were provided by the PSK and were used for segregation analysis to test whether the data were compatible with the respective simple Mendelian model, a recessive mode of inheritance. The Singles method is a very straightforward method of simple segregation analysis (Davie, 1979). The test involves a statistical comparison of the estimated segregation frequency P (probability that an offspring is affected by the respective disease) with the hypothesized value (P0) arising from the particular model of inheritance being tested.

If a recessive mode of inheritance is assumed, both parents in each of a set of full sib families are unaffected, the null hypothesis is that the true value of P0 = 0.25. The

(20)

most straightforward use of the Singles method can be made when the investigator is certain that all families with affected offspring are included in the data. Then the segregation frequency can be estimated as P = (A - A1) / (T - A1) and its estimated variance is given by Est. Var. (P) = (T - A) / (T - A1)³[A - A1 + 2A2 (T - A) / (T - A1)]

where A is the total number of affected offspring in the available data, T is the total number of all examined offspring in the available data, A1 is the total number of families with just one affected offspring, and A2 is the total number of families with two affected offspring. Then the null hypothesis is tested using: Z² = (P - P0)² / Est.

Var. (P). If the calculated value Z²is not significant at α = 0.05, the data are consistent with a simple recessive mode of inheritance.

The mean coefficient of relationship was calculated using OPTI-MATE (Wrede and Schmidt, 2003) for the group of German pinschers with PRAA affected offspring (n = 27) and a contemporary group of dogs born in 2008 (n = 555). The mean coefficient of inbreeding was compared among PRAA affected dogs and the same contemporary group of dogs. Pedigree information over eight generations was considered, the completeness of pedigrees was larger then 95% in all eight generations. The mean number of puppies per litter was calculated for the group of litters with PRAA affected offspring (n = 16) and a contemporary group of all litters in 2005 – 2009 (n = 415). P values were calculated using t tests.

2.4 Results

Case reports

The first actual case was a three week-old female German Pinscher puppy (puppy 1) of a German breeder which was euthanized because of constant regurgitation and poor body condition. Contrast oesophagram with barium sulphate made by the referral veterinarian revealed a precardiac mega oesophagus and oesophageal constriction at the level of the heart base. After euthanasia, puppy 1 was presented to the Hannover Institute for Pathology to investigate the cause of oesophageal constriction. A severe dilatation of the oesophagus cranial to the heart base and

(21)

constriction at the level of the heart base was found. The diameter of the oesophagus cranial to the heart was four times larger than that at the level of the heart base. The oesophagus was present between a persistent right aortic arch, a left subclavian artery, the heart base and the ligamentum arteriosum which extended from the main pulmonary artery to the left subclavian artery, attaching approximately one cm cranial to the point of origin of the aberrant left subclavian artery. The main cause of the constriction seemed to be the aberrant left subclavian artery in combination with the ligamentum arteriosum, the aortic arch made only a minor contribution to the constriction.

In cases 2 and 3, a Dutch breeder of German Pinschers contacted the Hannover Institute for Animal Breeding and Genetics because of two suspected PRAA affected male puppies (puppy 2 and 3) in one of their litters. The referral veterinarian had made radiographies and contrast oesophagrams of both puppies at an age of four weeks and suspected PRAA because of the radiographic findings and clinical signs (postprandial regurgitation and growth retardation). The two puppies were presented to the Hannover Small Animal Clinic where a complete clinical examination, radiographies, contrast oesophagrams, and ultrasonography of the heart were performed. The contrast oesophagram of puppy 2 showed the oesophagus highly dilated cranial to the heart base (Fig. 1), the contrast oesophagram of puppy 3 showed only a mild dilatation cranial to the heart base. In the ultrasonographic examination of puppy 2, a ventricle septum defect was also diagnosed. The ultrasonographic examination of puppy 3 revealed no abnormalities.

Because of the complicated medical findings in puppy 2 and the poor prognosis for the ventricle septum defect, puppy 2 was euthanized and sent to post-mortem examination. Puppy 3 was submitted to a surgical treatment on the next day. The thoracic cavity was entered through a left lateral thoracotomy incision at the level of the fourth left intercostal space. The oesophagus was found compressed by a complete ring formed with a aberrant persistent left ligamentum arteriosum joining the left subclavian artery and the pulmonary artery and their left subclavian artery.

After ligation and transsection of the ligamentum arteriosum, the oesophagus was no more compressed by the aberrant left subclavian artery; therefore this vessel was not

(22)

manipulated. One day after surgery, the dog looked alert and eager to eat. Feeding in an upright position was resumed from the second postoperative day with small amount of a slurry of soft dog food 7-8 times daily, after then the dog was fed with small amounts of normal soft dog food mixed with a little water 4-5 times daily in a normal position. No episodes of regurgitation were noticed neither during the upright position feeding interval nor the feeding interval at a normal position. Six weeks after the surgery, the puppy lives at his new owner family, and no problems like regurgitation have occurred since the surgical treatment. He gained weight quickly and is now nearly as big as his littermates.

In the autopsy of puppy 2 (Fig. 2 + 3), the diagnostic findings were very similar to the findings in puppy 1. The oesophagus was found highly dilated in the precardiac region; the diameter in this region was five times larger than at the level of the heart base. The postcardiac region showed no abnormalities. The oesophagus was found in the same position as in puppy 1, between a persistent right aortic arch, a left aberrant subclavian artery, the heart base and the ligamentum arteriosum which extended again from the main pulmonary artery to the left subclavian artery, attaching 1.5 cm cranial to the point of origin of the aberrant left subclavian artery.

The aberrant left subclavian artery in combination with the ligamentum arteriosum seemed to be the main cause of constriction. The persistent right aortic arch was also involved in the constriction, but only in a minor degree.

Pedigree analysis

Investigation of the pedigrees showed relationships among all 18 affected dogs (Fig.

4). The mean coefficient of inbreeding of PRAA affected German Pinschers was 6.76

% which is significantly higher than the mean coefficient of inbreeding of the contemporary group (3.56 %, Table 1). The mean coefficient of relationship among parents with at least one PRAA affected progeny was with a value of 11.04 % higher than the mean coefficient of relationship of the contemporary group (7.44 %). The mean number of puppies per litter calculated for the group of litters with PRAA affected offspring was 6.20 ± 2.33 which was not significantly different from the mean number of puppies per litter calculated for the contemporary group (6.47 ± 2.59). All

(23)

affected dogs had unaffected parents and the proportion of affected males (n = 8) and females (n = 7) was almost equal (sex unknown: n = 3). Therefore, an X-linked mode of inheritance was excluded as well as a monogenic autosomal dominant mode and a mitochondrial mode. The result of the simple segregation analysis using the Singles method revealed a Z² of 29.51 which was significant at α = 0.05.

Therefore the observed distribution of PRAA was not consistent with a simple recessive mode of inheritance.

2.5 Discussion

The left retrooesophageal subclavian artery in combination with the left ligamentum arteriosum with its origin on the left subclavian artery was the main cause of oesophageal constriction in the examined three German Pinscher puppies. Even if the other cases reported could not be verified in post-mortem examinations, the close relationships among the cases suggest that the same VRA may have caused the dilatation of the oesophagus. The extremely rare combination of anomalies that occurred in the three German Pinscher puppies has been described in dogs in only two cases before, in one German Shepherd dog and one Great Dane (House et al., 2005). This combination of anomalies is similar to an inherited anomaly reported in humans in whom a diverticulum is present in addition at the origin of the left subclavian artery (Kommerell’s diverticulum) (Cina et al., 2000).

The only definitive treatment for VRAs is surgery. Medical therapy alone without surgery, consisting of feeding in an upright position and slurry diets, is considered as not being effective and in most cases leads to worsening of oesophageal dilation and aspiration pneumonia. Nevertheless, the seven year-old female German Pinscher reported here lives since the age of eight months with the presumptive diagnosis of PRAA. The dog has a normal weight for his size and aspiration pneumonia never appeared until today.

The six most commonly reported heart defects in dogs are patent ductus arteriosus, pulmonic stenosis, subaortic stenosis, ventricular septal defect, tetralogy of Fallot, and PRAA. All of them have been proven to be heritable through genetic studies

(24)

(Patterson 1989). In the case of PRAA, breeding studies (German Shepherds) as well as epidemiologic studies (German Shepherds, Irish Setter) have demonstrated that German Shepherds and Irish Setters are genetically predisposed to its development; and that the mode of inheritance of PRAA is likely complex and polygenetic (Patterson, 1968; Patterson, 1989). Investigation of the heritability of congenital heart diseases started with epidemiologic studies at first; the results indicated that the number of PRAA affected dogs in the German Shepherd and Irish Setter breeds is significantly higher than in other breeds. In breeding studies involving matings between two German Shepherd dogs with PRAA, there was a higher frequency of this anomaly in the offspring, and the type of PRAA in those puppies was identical or closely related to that of the parents (Patterson, 1968).

The close relationships and high inbreeding coefficients suggest that PRAA in German Pinschers is an inherited defect. The higher the coefficient of inbreeding, the more likely an inherited recessive defect may be evident in the offspring. The coefficient of inbreeding of the group of German Pinschers with PRAA affected offspring is significantly higher than in the contemporary group. We could not determine the exact mode of inheritance for PRAA in German Pinschers. Using the Singles method for segregation analysis, a monogenic autosomal recessive inheritance could be rejected. The proportion of affected puppies per litter was clearly below 0.25 and only in two litters this proportion was close to 0.25 (2/7 = 0.286 and 2/9 = 0.22). Even differences in litter sizes among litters with PRAA affected and without PRAA affected puppies were small and did not seem to influence the segregation ratio of affected individuals. Therefore, this mode of inheritance did not appear plausible. Thus, an oligogenic or polygenic mode of inheritance or the contribution of a larger number of mutations of a genomic region appeared to be more likely.

Comparative genetic research revealed that conotruncal heart defects in humans have been associated with deletion of the chromosome 22q11.2 region which is also known as the DiGeorge critical region (DGCR) (Rauch et al., 2004; Lee et al., 2006).

(25)

Monosomy 22q11.2 was found in 46% of patients with a PRAA but in only 30% of patients with left aortic arch (Rauch et al., 2004). The microdeletion was also found in 81% of patients with, but only in 17% of patients without subclavian artery anomalies (SAAs) (Rauch et al., 2004). Thus, the incidence of monosomy 22q11.2 was associated rather with the presence of SAAs than with the laterality of the aortic arch (Rauch et al., 2004). The 3-Mb interval encompassing the DGCR contains 30 genes that are deleted in patients with 22q11.2 deletion syndrome (del22q11.2) which includes diagnoses of DiGeorge syndrome, velo-cardio-facial syndrome and conotruncal anomaly face syndrome. Cardiovascular anomalies found in these patients include tetralogy of Fallot, aortic-arch anomalies, persistent truncus arteriosus and ventricular septal defects. The genes located within the DGCR on 22q11.2 are almost completely conserved on mouse chromosome 16. Mice with a heterozygous deletion of a 1.5-Mb homologous DiGeorge region show defects similar to those seen in del22q11.2 patients. Among the T-box genes important for cardiomorphogenesis, the TBX1 gene is located in the DGCR. TBX1^-/- mice exhibited many of the cardiovasular malformations seen in del22q11.2 syndrome patients (Lindsay et al., 2001). These observations made TBX1 a candidate gene for the cardiovascular manifestations of del22q11.2 syndrome. However, only three TBX1 mutations have been identified that accounted for < 1% of conotruncal malformations in these populations (Gong et al., 2001; Yagi et al., 2003; Stoller et al., 2005).

A study in which comparative mapping of the DGCR region in the dog (Keeshond) has been performed revealed that this region mapped to the telomeric end of chromosome 26 and appeared to be conserved in the dog (Werner et al., 1999).

However, in the same study linkage was not evident between conotruncal heart defects in Keeshonds and the canine gene loci mapped within this region.

2.6 Conclusions

Monosomy 22q11.2 is strongly associated with the presence of SAAs which were found in all three puppies examined. Linkage analyses of canine gene loci mapped in the DiGeorge region with PRAA in German pinschers could help clarify whether

(26)

mutations in this region are responsible for this anomaly. The reported German Pinscher families may be useful to unravel genes involved in PRAA-LA-SA.

2.7 Conflict of interest statement

None of the authors of this paper has a financial or personal relationship with other people or organisations that could inappropriately influence or bias the content of the paper.

2.8 Acknowledgements

We thank the Pinscher-Schnauzer-Klub e. V. (PSK) in Germany for support in collecting pedigrees and cases of PRAA and all German Pinscher breeders for providing data and diagnoses from their dogs.

(27)

2.9 References

Buchanan, J.W., 2004. Tracheal signs and associated vascular anomalies in dogs with persistent right aortic arch. Journal of Veterinary Internal Medicine 18, 510- 514.

Buchanan, J.W., 1968. Patent ductus arteriosus and persistent right aortic arch surgery in dogs. Journal of Small Animal Practice 9, 409-428.

Cina, C.S., Arena, G.O., Bruin, G., Clase, C.M., 2000. Kommerell’s diverticulum and aneurismal right sided aortic arch: a case report and review of literature. Journal of Vascular Surgery 32, 1208-1214.

Davie, A.M., 1979. The singles method for segregation analysis under incomplete ascertainment. Annals of Human Genetics 42, 507-512.

Ellison, G.W., 1980. Vascular ring anomalies in the dog and cat. Compendium on Continuing Education for the Practicing Veterinarian 2, 693-705.

Fingeroth, J.M., Fossum, T.W., 1987. Late-onset regurgitation associated with persistent right aortic arch in two dogs. Journal of the American Veterinary Medical Association 191, 981-983.

Gong, W., Gottlieb, S., Collins, J., Blescia, A., Dietz, H., 2001. Mutation analysis of TBX1 in non-deleted patients with features of DiGeorge Syndrom/Velocardiofascial Syndrom or isolated cardiovascular defects. Journal of Medical Genetics 38, E45.

Gunby, J.M., Hardie, R.J., Bjorling, D.E., 2004. Investigation of the potential heritability of persistent right aortic arch in Greyhounds. Journal of the American Veterinary Medical Association 224, 1120-1121.

Helphrey, M.L., 1979. Vascular ring anomalies in the dog. Veterinary Clinics of North America 9, 207-218.

House, A.K., Summerfield, N.J., German, A.J., Noble, P.J.M., Ibbarola, P., Brockmann D.J., 2005. Unusual vascular ring anomaly associated with a persistent right aortic arch in two dogs, Journal of Small Animal Practice 6, 585- 590.

(28)

Kim, N.S., Alam, M.R., Choi, I.H., 2006. Persistent right aortic arch and aberrant left subclavian artery in a dog: a case report. Veterinarni Medicina 51, 156-160.

Lee, M.-L., Chen, H.-N., Chen, M., Tsao, L.-Y., Wang, B.-T., Lee, M.-H., Chiu, I.-S., 2006. Persistent fifth aortic arch associated with 22q11.2 deletion syndrome.

Journal of the Formosan Medical Association 105, 284-289.

Lindsay, E.A., Vitelli, F., Su, H., Morishima, M., Huynh, T., 2001. Tbx1 haploinsufficiency in the DiGeorge syndrome region causes aortic arch defects in mice. Nature 410, 97-101.

Muldoon, M, Birchard, S.J., Ellison, G.W., 1997. Long-term results of surgical correction of persistent right aortic arch in dogs: 25 cases (1980-1995). Journal of the American Veterinary Medical Association 210, 1761-1763.

Patterson, D.F., 1968. Epidemiologic and Genetic Studies of Congenital Heart Disease in the dog. Circulation Research 23, 171-2002.

Patterson, D.F., 1989. Hereditary congenital heart defects in dogs. Journal of Small Animal Practice 30, 153-165.

Rauch, R., Rauch, A., Koch, A., Zink, S., Kaulitz, R., Girisch, M., Singer, H., Hofbeck, M., 2004. Laterality of the aortic arch and anomalies of the subclavian artery – reliable indicators for 22q11.2 deletion syndromes? European Journal of Paediatrics 163, 642-645.

Stoller, J.Z., Epstein, J.A., 2005. Identification of a novel nuclear localization signal in TBX1 that is deleted in DiGeorge syndrome patients harbouring the 1223delC mutation. Human Molecular Genetics 14, 885-892.

VanGundy, T., 1989. Vascular ring anomalies. Compendium on Continuing Education for the Practicing Veterinarian 2, 36-48.

Yagi, H., Furutani, Y., Hamada, H., Sasaki, T., Asakawa, S., 2003. Role of TBX1 in human del22q11.2 syndrome. Lancet 362, 1366-1373.

Werner, P., Raducha, M.G., Prociuk, U., Budarf, M., Henthorn, P.S., Patterson, D.F., 1999. Comparative mapping of the DiGeorge region in the dog and exclusion of linkage to inherited canine conotruncal heart defects. The Journal of Heredity 90, 494-498.

(29)

Wrede, J., Schmidt, T. 2003. OPTI-MATE Version 3.81. A management programme useful to minimize inbreeding in endangered populations. Programme Manual.

Institute for Animal Breeding and Genetics, University of Veterinary Medicine Hannover, Germany.

(30)

2.10 Appendix

Table 1: Comparison of coefficients of inbreeding among PRAA affected and a contemporary group of German Pinscher as well as and relationship coefficients among parents with PRAA affected progeny and a contemporary group of German Pinschers

Parameter Contemporary group PRAA affected or German pinschers with PRAA affected offspring

P value

Mean coefficient of relationship (%)

7.44 ± 7.45 11.04 ± 10.14 0.088

Mean coefficient of inbreeding (%)

3.56 ± 2.98 6.76 ± 4.86 0.005

(31)

Fig. 1: Contrast oesophagram of puppy 2 (ventro-dorsal projection): Highly dilated oesophagus (A) cranial to heart base.

(32)

Fig. 2 + 3: Findings in the autopsy of puppy 2. The oesophagus (A) is highly dilated cranial to the heart. The left subclavian artery (B) originated in the distal right aortic arch (C), coursed dorsal to the oesophagus and crossed over to the left side. The ligamentum arteriosum (D) joins the pulmonary artery with the aberrant subclavian artery.

Figure 2:

(33)

Fig. 2 + 3: Findings in the autopsy of puppy 2. The oesophagus (A) is highly dilated cranial to the heart. The left subclavian artery (B) originated in the distal right aortic arch (C), coursed dorsal to the oesophagus and crossed over to the left side. The ligamentum arteriosum (D) joins the pulmonary artery with the aberrant subclavian artery.

Figure 3:

(34)

Fig. 4: Pedigree showing the German Pinschers affected by PRAA. In puppies 1-3 the specific form of PRAA with an aberrant left subclavian artery with a ligamentum arteriosum joining the left subclavian artery and the main pulmonary artery was diagnosed.

(35)

CHAPTER 3

Evaluation of the canine TBX1 gene as candidate for a rare form of persistent right aortic arch in the German Pinscher

Julia Menzel, Ute Philipp, Ottmar Distl

Institute for Animal Breeding and Genetics, University of Veterinary Medicine Hannover, Foundation, Bünteweg 17p, 30559 Hannover

(36)

3 Evaluation of the canine TBX1 gene as candidate for a rare form of persistent right aortic arch in the German Pinscher

3.1 Abstract

Persistent right aortic arch (PRAA) is a congenital vascular ring anomaly and common in several dog breeds. In the German Pinscher, a rare form of this disease occurs in which the persistent right aortic arch is associated with an aberrant left subclavian artery and a ligamentum arteriosum originating at the aberrant left subclavian artery (PRAA-SA-LA). In the present study, we analyzed the canine t-box gene TBX1 for association with PRAA-SA-LA in the German Pinscher. We genotyped 37 microsatellite markers on canine chromosome 26 (CFA26) in two German Pinscher families and tested them for linkage and association. We found a genome-wide significant genomic region on CFA26 which co-segregates with the PRAA-phenotype in the German Pinschers. We also sequenced the whole genomic sequence of the candidate gene TBX1 on CFA26. In addition, we sequenced partly 14 other genes located within the canine DiGeorge critical region (DGCR). The search for single nucleotide polymorphisms (SNPs) within these genes revealed a total of 23 polymorphisms. Two of these SNPs located within the canine TBX1 gene were found to be associated with the PRAA-phenotype in the German Pinscher.

Additionally, we found 13 interbred SNPs in the TBX1 gene. All SNPs were located in intronic regions.

3.2 Introduction

Persistent right aortic arch (PRAA) represents the most common vascular ring anomaly in dogs (Buchanan, 2004). Abnormal blood vessels and associated structures form a complete circle around the trachea and the oesophagus. This anomaly leads to a compression of the encircled structures and often causes regurgitation in young dogs. In the German Pinscher, a rare form of PRAA occurs which is associated with an aberrant left subclavian artery and a ligamentum

(37)

Evaluation of the canine TBX1 gene as candidate for a rare form of persistent right aortic arch in the German Pinscher

arteriosum that extended from the main pulmonary artery to the aberrant subclavian artery instead of the aortic arch (Menzel and Distl, 2010). This additional anomaly enforces the compression of the oesophagus and has only been reported in two cases of other dog breeds before (House et al., 2005). Epidemiologic studies as well as breeding studies have shown that German Shepherds, Irish Setters, Greyhounds and German Pinschers are genetically predisposed to the development of PRAA (Patterson, 1968; Patterson, 1989; Gunby et al., 2004; Menzel and Distl, 2010).

Comparative genetic research revealed that conotruncal heart defects in humans have been associated with deletion of the chromosome 22q11.2 region which is also known as the DiGeorge critical region (DGCR) (Rauch et al., 2004; Lee et al., 2006).

Monosomy 22q11.2 was found to be strongly associated with the presence of subclavian artery anomalies (SAAs) (Rauch et al., 2004). The DiGeorge/velocardiofascial syndrome (DGS/VCFS) is a relatively common human disorder characterized by a wide range of developmental anomalies including cardiovascular defects and defects of glands and facial structures. Investigations of the potential role of one candidate gene for the DGS, TBX1, revealed that mice heterozygous for a targeted mutation in the TBX1 gene had a high incidence of cardiac outflow tract anomalies, one of the major abnormalities of the human syndrome (Lindsay et al., 2001; Jerome and Papaioannou, 2001).

The TBX1 gene is a member of the t-box gene family of DNA binding transcription factors. T-box genes have been shown to play an important role in the regulation of developmental processes in humans and animals including angiogenesis, artery morphogenesis, blood vessel development and remodelling, determination of left and right symmetry, heart development and morphogenesis and mesoderm development (Papaioannou and Silver, 1998; Smith, 1999). Haploinsufficiency of two other t-box genes, TBX3 and TBX5, are associated with the human genetic diseases ulnar- mammary syndrome and Holt-Oram syndrome (Bamshad et al., 1997; Basson et al., 1997). The TBX1 gene is conserved in human, chimpanzee, mouse, rat, zebrafish and Caenorhabditis elegans. A study in which comparative mapping of the DGCR in the dog has been performed revealed that this region is mapped to the telomeric end of chromosome 26 and appeared to be conserved in the dog (Werner et al., 1999).

(38)

In the present study, we evaluated the whole genomic structure of the canine TBX1 gene and 13 other genes located within the DGCR conserved in the dog and screened exons with their flanking intronic regions for polymorphisms to be used for linkage and association tests with the PRAA-phenotype in the German Pinscher.

3.3 Material and Methods

Animals, phenotypic data and DNA specimens

The Pinscher-Schnauzer-Klub e.V. (PSK) supplied pedigree data and we identified pedigrees with PRAA-affected dogs. For the present analysis, we chose 45 dogs from two different German Pinscher families. Altogether this study included 3 PRAA- affected German Pinschers with the same rare form of PRAA (PRAA-SA-LA). After first results of the linkage and association analyses (Table 1), we decided to classify all available full-sibs of these affected puppies (n=10) as genetic carriers to reach more reliable results. We also tested three unaffected dogs from other breeds as control animals.

Two millilitres of EDTA blood (BIOTA) was obtained from each dog and DNA was extracted using QIAamp 96 DNA Blood kit (Qiagen, Hilden, Germany).

Genotyping of microsatellites

We genotyped 37 microsatellite markers on canine chromosome 26 (CFA26) starting at 11.90 Mb up to 37.90 Mb. Microsatellites were obtained by searching the Pubmed database (dog genome assembly 2.1) (http://www.ncbi.nlm.nuh.gov/

entrez/query.fcgi) for known microsatellites with a distance of about 0.5 Mb to each other. PCR primers are shown in Table 2. The PCR for genotyping of the microsatellites started at 94°C for 4 min, followed by 38 cycles at 94°C for 30 sec, optimum annealing temperature for 1 min, 72°C for 30 sec, and at 4°C for 10 min. All PCR reactions were performed in 11.5-µl reactions using 6 pmol of each primer, 0.2 µl dNTPs (100 µM) and 0.1 µl Taq-DNA-Polymerase (5 U/µl) (Q-Biogen, Heidelberg, Germany) in the reaction buffer supplied by the manufacturer for 2 µl template DNA.

The forward primers were labelled fluorescently with IRD700 or IRD800. For the

(39)

analysis of the marker genotypes, PCR products were size-fractionated by gel electrophoresis on an automated sequencer (LI-COR, Lincoln, NE, USA) using 4%

polyacrylamide denaturing gels (Rotiphorese Gel40, Carl Roth, Karlsruhe). Allele sizes were detected using an IRD700- and IRD800-labeled DNA ladder; the genotypes were assigned by visual examination.

Non-parametric linkage analysis

A non-parametric multipoint linkage analysis was employed for the two German Pinscher families using the MERLIN 1.1.2 software (Abecasis et al. 2002). This analysis is based on allele sharing among affected individuals by identical-by- descent methods (Kong and Cox 1997). Haplotypes were estimated using MERLIN 1.1.2 with the option “best”. A case-control analysis based on χ²-tests for genotypes, alleles and trend of the most prevalent allele was also performed for the German Pinschers. The CASECONTROL and ALLELE procedures of SAS/Genetics were used for association tests, tests for Hardy-Weinberg equilibrium of genotype frequencies and the estimation of allele frequencies (SAS Institute, 2005).

Structural and mutation analysis of TBX1 and 13 other genes

The dog-expressed sequence tag (EST) archive (http://www.ncbi.nlm.nih.gov/genome/seq/CfaBlast.html) was searched for ESTs by

cross-species BLAST searches with the corresponding human reference mRNA sequence for TBX1 (NM_080647.1). We found two canine ESTs (DN269432.1 and DN_399703.1) isolated from lymph node and aorta tissue with 89% and 92% identity to the human TBX1 mRNA sequence. A significant match to these canine ESTs was found on canine chromosome 26 by means of BLASTN searches of the canine ESTs against the dog genome assembly (Dog genome assembly 2.1). The genomic structure of the canine TBX1 gene was determined with the Spidey mRNA-to- genomic alignment program (http://www.ncbi.nlm.nih.gov/IEB/Research/

Ostell/Spidey/index.html).

For evaluation of TBX1 as candidate gene for PRAA in the German Pinscher, we sequenced the whole genomic sequence of the canine TBX1 gene including more

(40)

than 400 bp upstream of the start codon and 3 kb downstream of the stop codon for 3 affected and 8 unaffected German Pinschers out of the two families mentioned above. In addition, we sequenced partly the exons with flanking intronic regions of 13 other genes located within the DGCR conserved in the dog. All genes were located on the telomeric end of canine chromosome 26 (CFA26), where the DGCR in the dog is mapped to.

We used the genomic sequences of the canine genes (TBX1, ARVCV, COMT, TXNRD2, GNBL1, SEP5, CDC45L, UFD1, MRPL40, HIRA, CLTCL1, SLC25A1, GSC2 and DGS14) of the current dog genome assembly (dog genome assembly 2.1) together with the mRNA sequences of human TBX1 gene to localize the exon/intron boundaries of these genes in the dog. PCR primers were designed using the Primer3 program (http://frodo.wi.mit.edu/cgi-bin/primer3_www.cgi) based on the genomic sequence for canine TBX1 (LOC60821) and the other 13 genes. The PCR primers for the amplification of the genomic sequences are listed in Table 3. Sequence data were analysed with Sequencher version 4.7 (GeneCodes, Ann Arboer, MI, USA).

All PCRs were performed in 50-µl reactions using 20 pmol of each primer, 40 µM dNTPs, 0.5 U PeqLab-DNA-Polymerase (PeqLab, Erlangen, Germany) in the reaction buffer supplied by the manufacturer, 5x PCR Enhancer 1 (PeqLab, Erlangen, Germany), and 5% DMSO for 3 µl template DNA. The PCR conditions were: 95°C for 5 min followed by 38 cycles of 95 °C for 30 s, optimum annealing temperature for 30 s, 72°C for optimum elongation time, and 4°C for 10 min. All PCR products were cleaned using the Nucleo-Fast PCR purification kit (Macherey-Nagel) and directly sequenced with the DYEnamic ET Terminator kit (GE healthcare, München, Germany) and a MegaBACE 1000 capillary sequencer (GE Healthcare).

3.4 Results and Discussion

Non-parametric linkage analysis

Table 4 shows the results of the non-parametric linkage analysis for all 37 microsatellite markers on CFA26 after classification of full sibs of affected animals as genetic carriers. The highest and the only significant LOD scores of 0.93 and 0.81

(41)

were obtained for the markers 26_31.48 and 26_31.99 which are located in a distance of 0.5 to 1 Mb to the candidate gene TBX1. The maximum achievable Zmean was 2.47 indicating that the power of the analysis was high enough to detect significant linkage. The error probabilities for linked markers ranged from 0.013 to 0.03. The polymorphism information content of the individual markers was between 48 and 73%.

Structural and mutation analysis of TBX1 and 13 other genes

The canine ESTs for TBX1 (DN269432.1 and DN399703.1), which were found by cross-species BLAST searches with the corresponding human reference mRNA sequences, mapped to the same position as the annotated gene for TBX1 (LOC608214). We performed a mutation analysis for the TBX1 gene due to the significant linkage of the markers nearby. The canine TBX1 gene (LOC) consists of seven exons interrupted by six introns. We sequenced the whole coding sequence of the canine TBX1 gene. In addition, we sequenced 13 other genes partly which were located in the former canine DiGeorge region: ARVCV, COMT, TXNRD2, GNB1L, TBX1, SEP5, CDC45L, UFD1, MRPL40, HIRA, CLTCL1, SLC25A1, GSC2 and DGS14. The search for sequence variations within these 14 genes revealed a total of 18 SNPs. Of these 18 SNPs, four were located in the intronic sequence of TBX1 while the other were located in the intronic sequences of GNBL1, TXNRD2, CDC45L, UFD1, MRPL40, CLTCL1, SLC25A1 and GSC2. Additionally, we found 13 interbred SNPs in the German Pinscher for the TBX1 gene which were all located in intronic regions (Table 6).

Table 5 shows the results of the non-parametric linkage analysis for all these 18 SNPs. The χ² –test statistics for distributions of genotypes between cases and controls ranged from 0.24 to 10.00 and their error probabilities from 0.80 to 0.006.

The highest and only significant χ² of 10.00 and 6.87 with error probabilities of 0.006 and 0.03 were detected for LOC608214:g.537G>A and LOC608214:g.4714C>T.

Therefore, it is very likely that the candidate gene TBX1 is involved in the pathogenesis of PRAA in the German Pinscher. Sequencing of the TBX1 gene of more affected dogs should be performed in order to confirm these results.

(42)

3.5 Acknowledgements

The authors would like to thank the Pinscher-Schnauzer-Klub e.V. (PSK) for providing the data and the blood samples.

(43)

3.6 References

Abecasis GR, Cherny SS, Cookson WO, Cardon LR. Merlin-rapid analysis of dense genetic maps using sparse gene flow trees. Nature Genetics 2002; 30: 97-101.

Bamshad, M., Lin, R.C., Law, D.J., Watkins, W.J., Krakowiak, P.A., Moore, M.W., Francescjini, P., Lala, R., Holmes, L.B., Gebuhr, T.C., Bruneau, B.G., Schinzel, A., Seidmann, J.G., Seidmann, C.E., Jorde, L.B., 1997. Mutations in human TBX3 alter limb, aprocine and genital development in ulnar-mammary syndrome.

Nature Genetics 15, 21-29.

Basson, C.T., Bachinsky, D.R., Lin, R.C., Levi, T., Elkins, J.A., Soults, J., Grayzel, D., Kroumpuzou, E., Traill, T.A.,Leblanc-Straceski, J., Renault, B., Kucherlapati, R., Seidmann, J.G., Seidmann, C.E., 1997. Mutations in human cause limb and cardiac malformation in Holt-oram syndrome. Nature Genetics 15, 30-35.

Buchanan, J.W., 2004. Tracheal signs and associated vascular anomalies in dogs with persistent right aortic arch. Journal of Veterinary Internal Medicine 18, 510- 514.

Clark LA, Tsai KL, Steiner JM, Williams DA, Guerra T, Ostrander EA, Galibert F, Murphy KE. Chromosome-specific microsatellite multiplex sets for linkage studies in the domestic dog. Genomics 2004; 84: 550–554.

Gunby, J.M., Hardie, R.J., Bjorling, D.E., 2004. Investigation of the potential heritability of persistent right aortic arch in Greyhounds. Journal of the American Veterinary Medical Association 224, 1120-1121.

Guyon R, Lorentzen TD, Hitte C, Kim L, Cadieu E, Parker HG, Quignon P, Lowe JK, Renier C, Gelfenbeyn B, et al. A 1-Mb resolution radiation hybrid map of the canine genome. Proceedings of the National Academy of Sciences of the United States of America 2003; 100: 5296–5301.

House, A.K., Summerfield, N.J., German, A.J., Noble, P.J.M., Ibbarola, P., Brockmann D.J., 2005. Unusual vascular ring anomaly associated with a persistent right aortic arch in two dogs, Journal of Small Animal Practice 6, 585- 590.

(44)

Jerome, L.A., Papaioannou, V. E., 2001. DiGeorge syndrome phenotype in mice mutant for the T-box gene TBX1. Nature Genetics 27, 286-291.

Kong A, Cox NJ. Allele-sharing models: LOD scores and accurate linkage tests. The American Journal of Human Genetics 1997; 61: 1179-1188.

Lee, M.-L., Chen, H.-N., Chen, M., Tsao, L.-Y., Wang, B.-T., Lee, M.-H., Chiu, I.-S., 2006. Persistent fifth aortic arch associated with 22q11.2 deletion syndrome.

Journal of the Formosan Medical Association 105, 284-289.

Lindsay, E.A., Vitelli, F., Su, H., Morishima, M., Huynh, T., 2001. Tbx1 haploinsufficiency in the DiGeorge syndrome region causes aortic arch defects in mice. Nature 410, 97-101.

Menzel, J, Distl, O., 2010. Unusual subclavian artery associated with a persistent right aortic arch and an aberrant left subclavian artery in German Pinschers. The Veterinary Journal, Epub ahead of print.

Papaioannou, V.E., Silver, L.M., 1998. The T-box gene family. Bioessays 20, 9-19.

Patterson, D.F., 1968. Epidemiologic and Genetic Studies of Congenital Heart Disease in the dog. Circulation Research 23, 171-2002.

Patterson, D.F., 1989. Hereditary congenital heart defects in dogs. Journal of Small Animal Practice 30, 153-165.

Rauch, R., Rauch, A., Koch, A., Zink, S., Kaulitz, R., Girisch, M., Singer, H., Hofbeck, M., 2004. Laterality of the aortic arch and anomalies of the subclavian artery – reliable indicators for 22q11.2 deletion syndromes? European Journal of Paediatrics 163, 642-645.

SAS Institute. SAS/Genetics, Version 9.1.3. Cary, NC, USA, 2005

Smith, J., 1999. T-box genes. What they do and how they do it. Trends in Genetic 15, 154-158.

Werner, P., Raducha, M.G., Prociuk, U., Budarf, M., Henthorn, P.S., Patterson, D.F., 1999. Comparative mapping of the DiGeorge region in the dog and exclusion of linkage to inherited canine conotruncal heart defects. The Journal of Heredity 90, 494-498.

(45)

3.7 Appendix

Table 1: Non-parametric test statistics Zmean and LOD Score, their error probabilities (PZ, PL), polymorphism information content (PIC), χ²-tests for allele and genotype distribution of the case-control analysis, degrees of freedom (DF) and their corresponding error probabilities (P) for the microsatellite markers on canine chromosome 26 (CFA26) in the German Pinscher (full-sibs were not classified as genetic carriers)

Test for linkage Test for association Marker Position

on CFA26

PIC (%)

Zmean P_Z LOD score

P_L χ² genotype

DF P genotype

χ² allele

DF P allele

DTR26.9 11.90 0.37 -0.99 0.8 -0.23 0.8 7.84 3 0.04 5.59 2 0.06 26_20.49 20.49 0.20 -1.40 0.9 -0.30 0.9 0.16 1 0.68 0.13 1 0.71 26_21.14 21.14 0.75 -1.41 0.9 -0.30 0.9 24.22 14 0.04 19.80 6 0.002 26_21.69 21.69 0.66 -0.91 0.8 -0.22 0.8 17.09 11 0.10 2.53 5 0.77 REN131L06 22.30 0.54 -0.71 0.8 -0.18 0.8 10.90 5 0.05 3.40 2 0.18 26_22.49 22.49 0.67 0.70 0.2 0.17 0.2 27.61 9 0.001 14.53 5 0.1 26_22.92 22.92 0.73 -0.87 0.8 -0.21 0.8 25.98 18 0.10 22.43 9 0.007 REN01O23 23.40 0.29 -1.26 0.9 -0.28 0.9 0.70 2 0.70 0.19 2 0.66 CRYBB2_26_23.50 23.50 0.58 -1.37 0.9 -0.29 0.9 12.44 7 0.08 4.34 7 0.22

26_23.54 23.54 0.46 -1.41 0.9 -0.30 0.9 3.58 5 0.60 3.68 2 0.15 CRYBB_26_23.59 23.59 0.61 -1.33 0.9 -0.29 0.9 13.62 9 0.13 5.63 4 0.22

26_24.11 24.11 0.68 -0.62 0.7 -0.16 0.8 6.22 6 0.39 8.96 5 0.11 26_24.49 24.49 0.32 -0.38 0.6 -0.10 0.8 8.31 3 0.03 5.20 2 0.07

Evaluation of the canine TBX1 gene as candidate for a rare fomr of persistent right aortic arch in the German Pinscher

35

(46)

DGN10 26.10 0.75 -0.68 0.8 -0.17 0.8 26.43 14 0.02 17.41 9 0.04 26_26.46 26.46 0.36 -0.60 0.7 -0.15 0.8 8.19 3 0.04 5.69 2 0.05 26_26.98 26.98 0.37 -0.50 0.7 -0.13 0.8 2.30 2 0.31 0.44 1 0.50 26_28.01 28.01 0.54 -0.39 0.7 -0.11 0.8 9.94 7 0.19 11.13 3 0.01 26_29.04 29.04 0.04 -0.27 0.6 -0.08 0.7 0.87 1 0.34 0.85 1 0.35 26_29.57 29.57 0.59 -0.21 0.6 -0.06 0.7 15.57 7 0.02 7.53 3 0.05 26_30.00 30.00 0.59 -0.17 0.6 -0.05 0.7 25.24 8 0.001 19.67 4 0.0005

26_30.92 30.92 0.58 -0.06 0.5 -0.02 0.6 14.50 7 0.04 9.75 3 0.02 26_31.48 31.48 0.73 -0.00 0.5 -0.00 0.5 29.18 16 0.02 26.88 8 0.0007

26_31.99 31.99 0.48 0.15 0.4 0.04 0.3 15.52 4 0.003 11.07 3 0.01 REN88N03 32.67 0.58 0.79 0.2 0.19 0.2 20.78 6 0.002 14.08 3 0.002 26_32.70 32.70 0.35 0.94 0.2 0.22 0.2 11.61 6 0.07 12.30 4 0.01 26_32.84 32.84 0.27 1.18 0.12 0.26 0.14 1.22 2 0.54 1.09 2 0.57

26_33.03 33.03 0.44 1.34 0.09 0.29 0.12 8.57 4 0.07 7.58 3 0.05

26_33.10 33.10 0.67 1.41 0.08 0.30 0.12 22.65 11 0.01 16.67 5 0.005 REN276I22 33.40 0.37 1.39 0.08 0.30 0.12 3.95 2 0.13 1.20 1 0.27

26_33.44 33.44 0.04 1.39 0.08 0.30 0.12 0.87 1 0.34 0.85 1 0.35

26_33.95 33.95 0.51 1.36 0.09 0.29 0.12 16.99 7 0.01 12.81 3 0.005 26_34.51 34.51 0.31 1.33 0.09 0.29 0.12 2.94 4 0.56 2.80 3 0.42

26_35.13 35.13 0.64 1.30 0.10 0.28 0.13 27.47 8 0.0005 12.92 3 0.004 FH2130 35.50 0.58 1.28 0.10 0.28 0.13 8.20 7 0.31 3.06 4 0.54

gene as candidate for a rare form of persistent right aortic arch in the German Pinscher

36

(47)

Table 2: PCR primers, their position, product size and annealing temperature (Ta) for the amplification of microsatellite markers on canine chromosome 26 (CFA26)

Primer Sequence (5’ – 3’) of primers Position on CFA26 (Mb) Ta (°C) Product size (bp) DTR26.9_F TAAGCACTAAAGTTTCCCCA 11.551630 – 1.551934

DTR26.9_R GATAAAGACCATTGTGAGCC

58 294 - 314

26_20.49_F CCTAAGCTAGACATTGCGCCC 20.492686 – 20.492734 26_20.49_R CCCGAATGACCTTGACAAAT

60 281

REN299M21_F AAAGTTGCCCACCTGTTGAC 20430405 - 20430646 REN299M21_R GACTTGGAGAGGACTGTGCC

60 242

26_21.14_F AATTCCTCATTCTGATTCTCCAC 21.148368 – 21.148443 26_21.14_R CGGATGTTATGATATGCAAATAAGC

60 187

26_21.69_F CAGCCAGAGGACAAACTCTATCTA 21.699561 – 21.699692 26_21.69_R GGGTTTGTATTCAAGAGCTCCA

60 230

REN131L06 GCTGTCCTGCACTTTTCCTC 23.083557 – 23.083675 REN131L06 GTTAAGGAATAGTTGGGGGTCC

54 117

26_22.49_F CTTAGGGCATTCCGTTACCA 22.491459 – 22.491547 26_22.49_R TAGCTCCTGGCACGATTCTT

60 222

26_22.92_F TTGGGGTCTGGAGTTGTCTC 22.928417 – 22.928553 26_22.92_R TGTGTCCTGTGACTCCCAAA

60 319

REN01O23_F TTCCCTGCAGCCCTTCCTCA 32.676461 – 32.676611 REN01O23_R TGTGCCTCATTCCTTTTTAT

60 149 - 167

37

Population and molecular genetic analyses of persistent right aortic arch and primary cataracts in the German Pinscher

Table of contents