Mechanism of pFGE and FGE Retention in Endoplasmic Reticulum

(1)

Mechanism of pFGE and FGE

Retention in Endoplasmic Reticulum

Dissertation

zur Erlangung des Doktorgrades

der Mathematisch-Naturwissenschaftlichen Fakult¨ aten der Georg-August-Universit¨ at G¨ ottingen

vorgelegt von Santosh Lakshmi Gande aus Secunderabad (Indien)

G¨ ottingen 2006

(2)

D7

Referent: Prof. Dr. Dr. hc Kurt von Figura Koreferent: Prof. Dr. Ralf Ficner

Tag der m¨undlichen Pr¨ufung: 16.01.2007

(3)

To my parents for their unconditional support in all aspects of my life and without them I would not be

the person I am today.

(4)

(5)

Abbreviations

3AT 3-amino-1,2,4-triazole

oC Degree celcius

µ micro, -(x10⁻⁶)

35S Sulphur 35

Ade Adenine

Amp Ampicillin

APS Ammonium peroxide sulfate

ASA Arylsulfatase A

BLAST The basic local alignment search tool

bp Base pairs

BPa p-benzoyl phenylalanine

BPB Bromophenol blue

BSA Bovine serum albumin

C69S ASA 65-80 C69S peptide

cDNA Complementary DNA

Ci Curie

CSS-Palm Clustering and Scoring Strategy for Palmitoylation sites Prediction

Da Dalton

DBC Deoxy big chaps

ddH₂O double distilled H₂O

DMSO Dimethylsulfoxide

DNA Deoxyribonucleic acid

dNTPs Deoxyribonucleoside 5’-triphosphate

DTT Dithiothreitol

E.coli Escherichia coli

EDTA ethylenediaminetetraacetic acid

eq equivalents

ER Endoplasmic reticulum

et al et alteri (and others)

vii

(12)

viii Abbreviations FGE Cα-Formylglycine generating enzyme

FGly-residue Formylglycine residue

g gram

Gal-6-S Galactose-6-Sulfatase

GApp Golgi apparatus

GM130 Golgi matrix protein 130

His Histidine

HPLC High perfomance liquid chromatography

hr hour

HT1080 Human fibrosarcoma cells

Ig Immunoglobulin

Kan Kanamycin

Kb kilobase

l liter

LB-medium Luria-Broth medium

Leu Leucine

LiAc Lithium acetate

m meter

M molar

mA milliampere

MALDI TOF-MS Matrix Assisted Laser Desorption Ionization Time-of-flight Mass Spectrometry

MgCl₂ Magnesium chloride

min minute

MSD Multiple sulfatase deficiency Ni-NTA Nickel-nitrilotriacetic acid

OD Optical density

P23 ASA 60-80

PAGE Polyacrylamide gel electrophoresis PBS Phosphate-buffered saline

PCR Polymerase chain reaction PDI Protein disulphide isomerase PEG 3350 Polyethylene glycol

pFGE paralog of Cα-Formylglycine generating enzyme

RNA Ribonucleic acid

rpm Rotation per minute

RT Room temperature

SD Synthetic minimal medium

(13)

Abbreviations ix SDS Sodium dodecyl sulfate

sec second

ssDNA Salmon/Herring sperm DNA SUMF1 Sulfatase modifying factor 1 SUMF2 Sulfatase modifying factor 2 TAE Tris-acetate-EDTA-buffer Taq Thermophilius aquatics

TE Tris-EDTA

TEMED N,N,N,N-tetramethylethylenediamine Tris Tris-(hydroxymethyl)-aminomethane

Trp Tryptophan

UV Ultraviolet

V Volt

v/v Volume per volume

w/v Weight per volume

wt Wild type

Y2H Yeast two-hybrid

(14)

(15)

Chapter 1 Introduction

1.1 Sulfatases and Multiple Sulfatase Deficiency

Sulfatases represent a large family of enzymes that share structural and functional similarities. In eukaryotes they are involved in the hydrolysis of sulfate ester bonds in a wide variety of substrates ranging from complex molecules, such as glycosaminoglycans to sulfolipids and steroid sulfates. Mutations in the functional genes of sulfatases result in reduced activity of the respective sulfatases. Reduced sulfatase activity is linked either to severe lysosomal storage disorders such as mucopolysaccharidoses (MPS) and metachromatic leukodystrophy (MLD) or to non-lysosomal disorders such as X-linked ichthyosis and chondrodysplasia punctata [Hopwood and Ballabio, 2001]. Apart from the above single sulfatase deficiency syndromes there exists a special case namely, multiple sulfatase deficiency (MSD) syndrome, in which the activity of all the known sulfatases is severely reduced.

MSD is a rare human autosomal recessive disorder, with a prevalence of about 1 in 1.4 million births. The clinical phenotype of MSD combines the features of the single sulfatase deficiencies such as MLD with that of MPS as a result of the impaired lysosomal catabolism of sulfated glycolipids and glycosaminoglycans.

In addition, an ichthyosis can develop owing to the deficiency of the microsomal steroid sulfatase [Kolodny and Fluharty,1995].

Studies in cultured cells from MSD patients have shown that the synthesis of sulfatase polypeptides is normal, while the catalytic activity of all sulfatases is severely decreased. Further, expression of sulfatase cDNAs in MSD fibroblasts leads to synthesis of inactive sulfatases, while expression of the same cDNAs in fibroblasts of a non-MSD genotype yields active sulfatases [Rommerskirch and von Figura, 1992] suggesting that sulfatases share a common post-translational modification machinery that is required for their catalytic activity and which is defective in MSD.

1

(16)

2 Chapter1. Introduction

1.1.1 Absence of a novel protein modification in MSD

Biochemical data [Dierks et al., 1998a,b,1997; Miech et al., 1998;Schmidt et al., 1995; Selmer et al., 1996; Szameit et al., 1999] and crystal structures of human [Bond et al., 1997; Hernandez-Guzman et al., 2003; Lukatela et al., 1998]

and bacterial sulfatases [Boltes et al., 2001] revealed the presence of 2-amino-3- oxopropionic acid (i.e., Cα-formylglycine, FGly) at a position where the cDNAs of sulfatases predict either cysteine (pro- or eukaryotes) or serine (prokaryotes). The FGly residue generated from cysteine forms part of an highly conserved hexapep- tide L/V-FGly-X-P-S-R carrying a hydroxyl or thiol group on residue X, which is frequently found near the N-terminus of all eukaryotic sulfatases. Analysis of the sulfatase polypeptides synthesized in MSD fibroblasts revealed that they lack the FGly residue, instead contains a cysteine as predicted by the cDNA [Schmidt et al., 1995], indicating that FGly constitutes the crucial catalytic residue in the active site of sulfatases that is involved in the hydrolysis of sulfate esters.

1.1.2 Formation of FGly by FGE in the endoplasmic reticulum

Mammalian cells synthesize sulfatases at ribosomes bound to the endoplasmic reticulum. During or shortly after protein translocation in the ER and while the sulfatase polypeptides are still largely unfolded, FGly residues are generated by the co-translational modification of the conserved cysteine residues [Dierks et al., 1998b,1997] by luminal components of the endoplasmic reticulum (Fig. 1.1) [Fey et al.,2001].

Apart from cysteine other residues close to it are essential for or increase FGly

CH2

SH C

H O Formylglycine (FGly)

ER

growing sulfatase

H2N

COOH

CTPSR Cysteine

FGE MSD

Figure 1.1: Modification of cysteine to FGly in sulfatases in the ER lumen. Sulfatases translocating into the lumen of ER undergo co- or post-translational modification of their cysteine residue to FGly by FGE. In MSD, FGE lacks this catalytic activity.

formation, as shown for arylsulfatase A (ASA) (Fig. 1.2) [Dierks et al.,1999].

(17)

1.1. Sulfatases and Multiple Sulfatase Deficiency 3

0% 100%

critical for FGly formation

P V S LC T P S R A A L L T G R

Figure 1.2: Critical residues for FGly formation in sulfatases. The 16 mer sequence (residues 65-80) of the human arylsulfatase A demonstrates the residues that are both necessary and sufficient to direct the modification of conserved Cys69. Intensity of the red color indicates the importance of the residue, higher the intensity greater is its significance.

In vitro FGly formation can be measured on peptidic substrates (sulfatase- derived synthetic peptides lodging the conserved residues) with MALDI-TOF-MS (matrix-assisted laser desorption/ionization time-of-flight mass spectrometry) (Fig. 1.3) [Dierks et al.,2003] and the presence of the aldehyde group was proved by a reaction with hydrazine during MALDI-TOF-MS [Peng et al.,2003].

Figure 1.3: FGly Modification of P23. 6 pmol of P23 (a 23mer peptide which corresponds to ASA peptide 60-80 residues) were incubated under standard conditions for 10 min at 37^oC in the absence (top) or presence (bottom) of 1 µl of microsomal extract. The samples were prepared for MALDI-TOF mass spectrometry (see Materials and methods). The monoisotopic masses MH⁺ of P23 (2526.28) and its FGly derivative (2508.29) are indicated [Dierks et al., 2003].

A similar peptide containing a serine residue instead of cysteine was used to construct an affinity matrix that allowed purification of FGly-generating enzyme (FGE) from bovine testis reticuloplasm. It led to the discovery of FGE, which is catalyzing the co-translational modification of cysteines to FGly in sulfatases [Cosma et al.,2003;Dierks et al.,2003]. Genetic defects of FGE encoding cDNA is the cause for MSD (Fig. 1.1) [Cosma et al.,2003;Dierks et al.,2003].

(18)

1.2 FGE and its salient features

The gene encoding human FGE, designated asSUMF1(sulfatase modifying factor 1) is located on chromosome 3p26. It belongs to a new gene family with orthologous members in pro- and eukaryotic sulfatase expressing organisms. Some distant FGE- related homologs seem to have distinct oxygenase and other functions [Landgrebe et al.,2003].

1.2.1 Expression and localization of endogenous and recombi- nant FGE

FGE is ubiquitously expressed. Northern blot analysis of total RNA from skin fibroblasts and polyA⁺ RNA from various tissues (Fig. 1.4B) shows a single transcript of 2.1 kb. Relative to actin RNA, the abundance varies by one order of magnitude and is highest in pancreas, kidney and lowest in brain.

Studies on localization of FGE by indirect immunofluorescence and immuno-

kb

Figure 1.4: FGE and pFGE expression profile in various tissues. Northern blot analysis of poly A⁺RNA from human tissues for expression of pFGE (upper), FGE (middle) and β-actin (lower)[Dierks et al.,2003;Mariappan et al.,2005].

electron microscopy in human fibroblasts have shown the expression of endogenous FGE to be largely localized in the lumen of the endoplasmic reticulum (Fig. 1.5A) [Preusser-Kunze et al.,2005]. Even variously tagged forms of FGE colocalize with PDI, a luminal protein of the endoplasmic reticulum (Fig. 1.5B) [Dierks et al., 2003].

Immunofluorescence analysis with Golgi marker GM130 or the endosomal marker LAMP1 showed no co-localization, while by electron microscopy some FGE

(19)

1.2. FGE and its salient features 5

PDI FGE Merge

A

30µm 100µm

B

^MergeFGE-HA and PDI

Figure 1.5: Subcellular localization of endogenous or C-terminally tagged FGE.Indirect immunofluorescence of FGE (red) and PDI (green). The merge reveals the co-localization of PDI and endogenous FGE (A) or C-terminally tagged FGE-HA (B). (A: Mariappan M., unpublished data), B: Dierks et al., 2003.

was detected in Golgi, endosomes and lysosomes. Upon overexpression FGE is secreted into the medium [Preusser-Kunze et al.,2005].

1.2.2 Structural properties of FGE

Derived from the gene SUMF1, human FGE is predicted to have 374 residues.

The protein contains a cleavable signal sequence of 33 residues, which indicates translocation of FGE into the endoplasmic reticulum, and contains a single N- glycosylation site at asparagine 141. FGE contains eight cysteines, six of them forming three disulfide bridges (50-52, 218-365, 235-346) (Fig. 1.6). The cysteines 50 and 52 of the first bridge however, are partially reduced (about 30%) or engaged in an intermolecular disulfide bond resulting in FGE homodimers. Cysteines 336 and 341, are found in reduced form but also disulfide bonded (see below).

Residues 87-367 of FGE are listed in the PFAM protein motif database as a domain of unknown function (PFAM: DUF323). Phylogenetic sequence conservation analysis has revealed that FGE is composed of three highly conserved subdomains (I, II and III in Fig. 1.6). In human FGE the generally non-conserved N-terminal region harbors two highly conserved cysteines (50 and 52) (see above).

Subdomain I (residues 91-154) has a sequence identity of 39% and a similarity of 85% within the six known full-length eukaryotic FGE orthologs. This domain

(20)

N C

S S S S

HS SH

N C C C CCC

CC

Man GlcNAc GlcNAc Man Man Man

Man Man Man Man Man

I II III

SP Cleavage site

34 141

50 52 218 235

336 341 346 365 33

Figure 1.6: FGE domain architecture. FGE protein sequence shows three highly conserved subdomains (I, II and III) determined by phylogenetic sequence conservation analysis. Binding between residue 33 and 34 represents signal peptide (SP) cleavage site. FGE possess a single glycosylation site at residue Asn141 and eight cysteine residues represented as (C) show specific disulfide bridging.

carries the glycosylation site at Asn141, which is conserved in all orthologs. The N- glycosylation of FGE in the intracellular and secreted FGE is different. Intracellular FGE contains a high mannose-type while the extracellular FGE contains a complex- type oligosaccharide side chain [Preusser-Kunze et al., 2005]. The middle part of FGE (residues 179-308) determined by the tryptophan-rich subdomain II contains two cysteines which form two disulfide bridges to subdomain III. The identity of this subdomain in eukaryotic orthologs is 48%, the similarity 72%. Subdomain III (residues 327-366) is the most highly conserved sequence within the FGE family.

The sequence identity in eukaryotic orthologs is 85%, the similarity 100%. This subdomain carries four cysteine residues of which 336, 341 and 365 are fully conserved.

Limited proteolysis with thermolysin and elastase revealed that FGE is made up of two protease-resistant domains [Preusser-Kunze et al.,2005]. The first protease- resistant domain coincides with subdomain I and the cleavage site between the protease-resistant domains is located in the linker region separating subdomain I and II. Moreover, subdomains II and III are in fact part of one protease-resistant domain that is stabilized by the two intersubdomain disulfide bonds (see above).

However, from the crystal structure data [Dierks et al., 2005](see Section 1.2.4) FGE is found to be a compact molecule without obvious domain boundaries that has been suggested from sequence comparisons [Landgrebe et al.,2003] and proteolytic experiments [Preusser-Kunze et al.,2005].

1.2.3 Mutations in SUMF1 are the cause of MSD

Deficiency to generate FGly residues in sulfatases by FGE is the cause for MSD.

The FGE encoding SUMF1 gene is therefore a candidate gene for MSD. Mutations

(21)

1.2. FGE and its salient features 7 of SUMF1 gene were identified in all patients, that including missense, nonsense, microdeletion and splicing mutations. A total of 18 missense mutations over 17 different residues of mature FGE have been found to date, of which 12 have been published [Cosma et al.,2003,2004;Dierks et al.,2003]. These missense mutations found in MSD patients is explained by the FGE structure, providing a molecular basis of MSD [Dierks et al.,2005]. Most of the mutations appear to cluster in subdomain III of FGE, suggesting that this domain is crucial for FGE activity.

1.2.4 Substrate binding site of FGE

Photoaffinity labeling experiments with an ASA-derived peptide carrying a photoreactive p-benzoyl-phenylalanine (Bpa) showed a crosslink between the substrate and proline 182, which is located close to the N-terminal end of subdomain II of FGE.

In accordance with that, a yeast two-hybrid assay showed that subdomain II is sufficient for binding a sulfatase fragment harboring the FGly modification motif [Preusser-Kunze et al., 2005]. However, resolving the crystal structure of FGE revealed a single domain monomer without further subdivisions in subdomains [Dierks et al., 2005]. According to the crystal structure FGE shows a surprising paucity of secondary structure and adopts a unique fold, called FGE fold [Dierks et al., 2005] (Fig. 1.7A). Main features of FGE structure include two stabilizing calcium ions, N-glycosylation at Asn 141, two cis-peptide bonds at Pro115 and Pro266, and three disulfide bonds. The N-terminal residues up to Gln85 including cysteine 50 and 52 are missing in the crystal structure. Two disulfide bonds, Cys218- Cys365 and Cys235-Cys346, are permanently present in FGE and contribute to its stability. Cysteines 336 and 341 have varying redox states depending on reducing or oxidizing conditions during crystallization and have therefore been considered to be candidates for catalytically active residues. Indeed, a surface representation of FGE shows an oval-shaped groove that is bordered by these cysteines at one end and Pro182 at the other end constituting a functionally bipartite binding/active site for the unfolded sulfatase substrates (Fig. 1.7B).

Later, by co-crystalization of FGE Cys336Ser and the ASA-derived peptide LCTPSRA containing the FGly motif it could be shown that this groove indeed constitutes the binding site for the CTPXR motif of sulfatases (Fig. 1.7C). Based on the structural and biochemical data a mechanism has been proposed for FGE, ascribing a key role to Cys336 and Cys341 during catalysis of FGly formation in sulfatases (Fig. 1.8).

(22)

A B C

Figure 1.7: Crystal structure of FGE with and without bound substrate peptide. A) Diagram of FGE with the secondary structure elements and calcium ions as spheres. B) Surface representation of FGE showing the groove with the redox-active cysteine pair Cys336/Cys341 at one end. Pro 182 marks the site of a cross-link with a photoreactive substrate peptide and hence this site to be close to the substrate-binding site. C) FGE-peptide complex. The peptide LCTPSRA binds to Cys341 via an intermolecular disulfide bond (not seen in the figure [Dierks et al.,2005;Roeser et al.,2006].

H₂S R-CH₂-SH

O₂

H₂O

R-CH₂-S-OH

FGE

S-CH₂-R S₃₄₁

336S H

FGE S₃₄₁

336S

XH₂ X 1

2

3 4

5

OH FGE

S-CH₂-R S₃₄₁

336S

FGE

S-CH₂-R S₃₄₁

336S H OO

5 H

S R C H₂O

H O R C H₂O

Figure 1.8: Possible catalytic mechanism of FGE. Color code: Black - FGE; Green - Sulfatase; Oxygen(O) in red - from molecular oxygen and in blue - from water molecule.

1. Binding of substrate and formation of a mixed disulfide intermediate between the substrate and Cys341 of FGE.

2. Binding of molecular oxygen and formation of a hydroperoxide at Cys336.

3. Generation of a sulfenic acid at Cys336 and the oxidation of a reducing factor (XH2).

4. Transfer of the hydroxyl group from Cys336 to the substrate cysteine residue, regeneration of the Cys336-SS-Cys341 disulfide of FGE and release of the substrate as sulfenic acid.

5. Elimination of water (β-elimination) from the sulfenic acid forming a thioaldehyde intermediate and spontaneous hydrolysis to FGly [Dierks et al.,2005].

(23)

1.3. Identification of pFGE: paralog of FGE 9

1.3 Identification of pFGE: paralog of FGE

Data base searches of the human genome revealed a coding region highly similar to FGE (48% sequence identity, 62% similarity), which was designated as SUMF2 and the protein as paralog of FGE (pFGE) [Cosma et al., 2003;Dierks et al.,2003;

Landgrebe et al., 2003]. In human, SUMF2 gene is located on chromosome 7q11.

Deuterostomia, including vertebrates and echinodermata, also express a paralog of FGE. Gene duplication of a common SUMF ancestor has obviously occurred at the level of a single exon gene after the evolution of insects and before that of deuterostomia [Landgrebe et al., 2003]. pFGE along with FGE belongs to a large protein family currently comprising 164 members sharing the common domain of unknown function DUF323.

1.3.1 Characteristic features of pFGE

1.3.1.1 Expression and localization of endogenous and recombinant pFGE pFGE like FGE is ubiquitously expressed. A single SUMF2 transcript of 2.0-2.1 kb is detectable by Northen blot analysis of polyA⁺ RNA from various tissues and of total RNA from skin fibroblast (Fig. 1.4A) [Mariappan et al.,2005]. The expression pattern is quite similar to that of SUMF1 encoded FGE. Relative to β-actin RNA, the abundance of SUMF2RNA varies by one order of magnitude, being highest in pancreas, kidney and lowest in brain.

The nucleotide sequence of human pFGE predicts a protein of 301 residues.

An N-terminal signal peptide (residues 1-26, Fig. 1.10) directs translocation of the nascent polypeptide into the lumen of endoplasmic reticulum. Indirect immunofluorescence of endogenous pFGE in human skin fibroblasts revealed it to be in the lumen of endoplasmic reticulum colocalizing with the ER marker protein PDI (Fig. 1.9A). However, recombinant pFGE with C-terminal HA or His tag showed co-localization not only with PDI but also with GM130, a Golgi marker protein (Fig. 1.9B and C). This was substantiated by immunoelectron microscopy, which showed localization of pFGE in the ER and Golgi stacks, sparsely in endosomes and lysosomes [Mariappan et al.,2005]. However, a small fraction of endogenous pFGE escapes from the ER into secretions. Overexpression of pFGE results in its massive secretion [Mariappan et al.,2005].

(24)

PDI

PDI pFGE

pFGE-HA

Merge

Merge GM 130

A

B

C

Figure 1.9: Subcellular localization of endogenous and C-terminally tagged pFGE.

Indirect immunofluorescence of pFGE (red) and PDI or GM130 (green). The merge reveals the co-localization of PDI and endogenous pFGE (A) and C-terminally tagged pFGE-HA either with PDI (B) or with GM130 (C). A and B [Mariappan et al.,2005], C: Mariappan M., unpublished data.

1.3.1.2 Structural properties of pFGE

pFGE has a single N-glycosylation site at Asn191. Intracellular pFGE was shown to have a high mannose type oligosaccharide, which becomes processed during secretion to hybrid and complex type structures containing fucose and sialic acid residues.

The phylogenetic sequence analysis ofSUMF2encoded pFGE has revealed that pFGE has three highly conserved regions forming three subdomains of a DUF323 domain (Fig. 1.10), analogous to FGE (seeFig. 1.6). In pFGE these subdomains make up more than 85% of the molecule. Digestion with elastase, a serine proteinase, or thermolysin, a zinc proteinase, generated two stable fragments by cleavage within the short linker sequence connecting the first and second subdomain. However, the crystal structure of pFGE revealed a novel fold with a strikingly low degree of secondary structure, as it has been determined for FGE (see Section 1.2.4).

The tertiary structure is characterized by an asymmetric partitioning of secondary structure elements and is stabilized by two calcium cations and a disulphide bond

(25)

1.3. Identification of pFGE: paralog of FGE 11

Man GlcNAc GlcNAc

Man Man Man

Man Man Man Man

Man

SP

I II III

SS

C N C

156 290

1

26

Figure 1.10: pFGE domain structure. Phylogenetic sequence conservation analysis of pFGE has revealed three highly conserved subdomains (I, II and III). SP represents the cleavage site for signal peptide, ‘C’ represents the cysteines which are involved in disulfide bonding and ‘N’

represents glycosylation site at Asn191.

between Cys156 and Cys290 (Fig. 1.11) [Dickmanns et al., 2005]. This disulfide bond is also conserved in FGE, underscoring its stabilizing function. However, pFGE lacks other cysteine residues which are found in FGE. pFGE structure was used to determine the crystal structure of FGE, revealing a high structural similarity [Dierks et al.,2005].

pFGE and FGE structures represent the first three-dimensional models of a

Oligosaccharide side chain on

ASN191

Ca⁺⁺

Disulfide bond between Cys156 & Cys290 Cys156

Cys290

PDB: 1Y4J

Figure 1.11: Crystal structure of pFGE. Secondary structural elements showing two Ca²⁺

ions (red spheres), part of oligosaccharide sidechain at N191 (sticks) and disulfide bond (yellow stick) between C156 and C290 [Dickmanns et al.,2005].

(26)

12 Chapter1. Introduction DUF323 domain containing protein. Due to the close relation of pFGE to the well- characterized FGE, the novel fold of the DUF323 domain is denoted as ”FGE” fold.

In addition, the structure point to a possible cellular function of pFGE. Indeed, the active site cleft in FGE showed a high similarity to pFGE. Many of the residues (Ala149, Ser155, Trp299, Ser356, Asn360 and Leu361) lining the substrate-binding groove in FGE are conserved in pFGE (Fig. 1.12). The crystal structure also predicts the possibility of a pFGE/FGE dimer. In fact pFGE but not FGE formed a homodimer in the asymmetric unit of the crystal.

pFGE FGE

Figure 1.12: Comparison of the peptide binding cleft of pFGE and FGE. Left: pFGE in gray with the cleft (greenish yellow) most likely to be involved in the binding of a sulfatase polypeptide chain. Pro120, colored in blue, corresponds to Pro182 of FGE that has been shown to cross-link to a photoaffinity labeled substrate peptide. Right: the FGE cleft is shown in greenish yellow. The residues different to pFGE are highlighted in red and are predominantly located in the region of the active centre, close to the catalytically active cysteines 336 and 341 which are absent in pFGE [Dickmanns et al.,2005].

1.3.1.3 Probable biological role for pFGE

Localization, carbohydrate processing, and secretion upon overexpression as well as the protease sensitivity of the linker region between the first two subdomains and the general structure are the properties that pFGE shares with FGE. Moreover, the relative abundance of their RNAs in different tissues is rather similar. In addition, by photoaffinity labeling and yeast two-hybrid assay it was demonstrated that pFGE shows interaction with ASA derived peptides [Mariappan et al., 2005]. All these observations suggested that pFGE and FGE fulfill similar functions. But so far, no

(27)

1.4. ER retention mechanisms 13 mutations in the pFGE-encoding SUMF2 gene have been found in MSD patients.

Indeed,in vitropFGE shows no FGly generating activity on all the peptides derived from 16 sulfatases under conditions appropriate for the FGly generating activity of FGE [Mariappan et al.,2005].

Interestingly, in vivo overexpression of pFGE interferes with FGly formation in sulfatases [Mariappan et al., 2005]. This effect may be due to binding of sulfatases to pFGE, thereby sequestering them from FGE. However, the effects of pFGE on FGE are also conceivable in an indirect manner, e.g. by dislocating FGE from the endoplasmic reticulum (ER) due to competition for a common retention mechanism, or directly by heterodimerization.

1.4 ER retention mechanisms

Endoplasmic reticulum constitutes a major compartment of the complex endomem- brane system that makes up the secretory pathway. It is the central port for the entry of proteins into the secretory pathway for their distribution to different target organelles via trans-Golgi network or their secretion. It provides an optimized environment favorable for proper protein folding and maturation. The co- or post- translational modifications of secretory, luminal and integral membrane proteins are facilitated by soluble and membrane-bound ER-resident proteins such as BiP, calreticulin, calnexin and PDI. They function not only as chaperones but also as the components of quality control machinery for the forward transport of the proteins, by serving as retention anchors for immature proteins. The transport- competent mature cargo protein usually corresponds to the compactly folded native conformation that has undergone correct co- or post-translational processing. Cargo proteins need to be sorted from the ER-resident proteins by gaining access to the COPII-coated vesicle-forming site of the ER, designated as ER exit site or transitional ER.

Packing of the cargo proteins into the budding vesicles from the ER could be by bulk flow or by a selective process. Some soluble and membrane cargo proteins are actively recruited into the vesicles where they become concentrated, this enrichment is achieved by interaction of the cytoplasmic coat with distinct sorting signals on the cytoplasmic domain of the membrane protein. However, soluble cargo protein and GPI-anchored membrane proteins that do not present any cytoplasmic signal interact with specific trans-membrane receptors that serve to link these luminal substrates to the cytoplasmic coat e.g. lectin chaperones such as calnexin and calreticulin and ERGIC53. Moreover, at the site of budding vesicles

(28)

14 Chapter1. Introduction ER-resident soluble proteins without exit signals can also get packaged. Similarly, high concentrations of secretory proteins may facilitate export without the help of sorting receptors.

Sar1, a small GTP-binding protein of the COPII coatomer complex assembly at the budding vesicle, enables delivering the cargo proteins from the ER to Golgi by anterograde transport via the putative intermediate compartment formed by the vesicular tubular clusters (VTC) also known as ER-Golgi intermediate compartment (ERGIC).

1.4.1 ER retention by retrieval

ER-resident proteins in the VTC or Golgi that escaped ER retention are retrieved back to the ER in the retrograde transport from Golgi, mediated by COPI coatomer complex and ADP ribosylation factor (ARF), a small GTP-binding protein based on the ER retrieval signals. Resident ER membrane proteins bear a specific retrieval signal, which act as sorting signal. The well-characterized sorting signal is the di- lysine motif found at the C-terminus of type I transmembrane proteins (KKXX or KXKXX, where X is any amino acid). The di-lysine motif shows direct interaction with specific subunits of the COPI coatomer complex that mediates retrieval to ER from Golgi [Letourneur et al., 1994]. Similarly, di-arginine motifs (RR) found at the N-terminus of type II transmembrane proteins are also retrieved by COPI, recognized by different binding pockets of the coat complex. Whereas soluble ER- resident proteins bear a specific retrieval signal (KDEL in mammals, HDEL in yeast) that mediate interaction with the KDEL receptor (ERD2 in yeast and the homologous human receptors designated as KDELR1 and KDELR2 also known as hERD2.1 and hERD2.2 respectively) [Lewis and Pelham, 1990, 1992; Semenza et al., 1990].

KDELR3 is the third member of the family to be identified, and it encodes a protein highly homologous to KDELR1 and KDELR2 proteins. Two transcript variants of KDELR3 arise by alternative splicing, and encode different isoforms of KDELR3 receptor. The KDEL receptor itself presents a cytoplasmic di-lysine retrieval motif that contributes to interaction with the COPI coat in conjugation with a phosphoserine residue that is also important for ER-Golgi retrieval [Cabrera et al.,2003]. Although the precise mechanism by which KDEL receptor binds its ligands is not known, a number of point mutations on the luminal surface of the receptor inhibits binding to KDEL peptides, implying that these residues contribute to a ligand binding pocket [Scheel and Pelham, 1998]. Furthermore, ligand binding to the KDEL receptor is thought to leads to conformational changes that trigger uptake of the assembly complex into ARF and COPI vesicles [Lewis and Pelham, 1992]. This regulated

(29)

1.4. ER retention mechanisms 15 transport may be driven by the ligand-induced oligomerization of the receptor, which in turn stimulates interaction with COPI coat complex [Majoul et al.,2001].

Biochemical characterization of the receptor showed that it specifically binds the ligand in pH-dependent manner, suggesting that subtle differences in the luminal environment will allow release of KDEL-containing proteins upon fusion with the ER [Wilson et al.,1993].

1.4.2 Direct ER retention

Some of the endogenous proteins are found to lack detectable post-ER modifications like calreticulin, a luminal ER protein with C-terminal KDEL, and UDP-glucuronyl- transferase, an ER type I membrane protein with di-lysine motif. ER retention of calreticulin was suggested to occur by a KDEL-based retrieval system and by a calcium dependent direct retention [Sonnichsen et al., 1994]. Moreover, there is evidence that the resident ER proteins form a dynamic network stabilized by weak interactions modulated by the high lumenal calcium ion concentration [Kreibich et al.,1978]. Such a matrix may contribute to the retention of incompletely folded proteins [Tatu and Helenius,1997].

1.4.3 Thiol-mediated ER retention

A special mechanism of ER retention involves exposed free cysteines. This was first described for the retention of unassembled immunoglobulin chains [Sitia et al., 1990] by forming intermolecular disulfide-bonding with ER-resident thiol oxidore- ductases such as PDI and ERp72 [Reddy and Corley, 1998]. Thiol mediated retention has also been shown for unassembled subunits of acetylcholinesterase [Kerem et al., 1993] and Ero1 (an oxidoreductase that lacks known ER retention motifs). Recently, it was found that ERp44 mediates ER localization of Ero1 or IgM subunits by formation of reversible mixed disulfides.

1.4.4 Retention by aggregation

Newly synthesized proteins may also be retained in the ER by mutual interactions with each other, resulting in the formation of large aggregates which are transport- incompetent. Many of the aggregates are cross-linked by non-native interchain disulfide bonds. Thyroglobulin, major histocompatibility complex (MHC) class II, and procollagen form transient aggregates before acquiring their native structures.

(30)

1.4.5 Other possible retention mechanisms

Some of the resident ER proteins are found to lack canonical retention signals and to be retained by formation of hetero-oligomers with proteins containing H/KDEL- containing proteins. Mouse liver-Glucuronidase is retained within the ER via complex formation with esterase-22 (egasyn), which in turn has a carboxyl-terminal HTEL ER-retention sequence [Zhen et al.,1995].

In summary, exceptions to the general ER retention mechanisms do exist paving path for the identification of new retention or sorting signals that are essential for the correct localization of the proteins to places where their biological activity is required.

1.5 Aim of the study

The physiological function of FGE encoded by SUMF1 is to perform the co-/post- translational modification in the active centre of the sulfatases. The function of SUMF2-encoded pFGE is still ill defined, however high similarity of the structure and the expression pattern to that of FGE indicates a cellular function in assisting or regulating FGE activity in the ER. The topological distribution of both proteins, FGE and pFGE, has indeed shown them to be localized in the lumen of the ER.

The mechanism of selective segregation of FGE and pFGE from other proteins that follow the secretory pathway is still unclear.

Most soluble proteins that reside in the lumen of the ER carry a specific tetrapeptide signal sequence like KDEL that prevents their secretion. However, human FGE and pFGE were found to lack the intrinsic ER retention signals like the prototype KDEL. Therefore, it remains unclear how these proteins are selectively segregated from other proteins that follow the secretory pathway and retained in the ER lumen. Consequently, we investigated the mechanism of FGE and pFGE retention in the ER, which could be based on one of the known general retention mechanism or by a new mechanism.

(31)

Chapter 2 Materials and Methods

2.1 Materials

2.1.1 Laboratory equipment

Analytic balances type 1602 MP and 1265 MP Sartorius, G¨ottingen Analytical HPLC:

SMART-system with the following columns: Amersham Biosciences Gel filtration columns:

Superdex 200 PC 3.2/30 (2.4 ml) Amersham Biosciences Anion exchange columns:

MonoQ PC 1.6/5 (0.1 ml) Amersham Biosciences

µPeak C2/C18 PC 3.2/3 (C2/C18, 2.1 x 30 mm) Amersham Biosciences UV-detectors for SMART-system:

µPeak Detector Amersham Biosciences

UV-Detector for Vision Workstation:

FLUOR-305 PerSeptive Biosystems

Intelligent Dark Box II, Las-1000+ Fuji, Japan

Ice machine Ziegra, Isernhagen

Centrifuges:

Eppendorf centrifuge Type 5415C and 5402 Eppendorf, Hamburg

Table ultracentrifuge TL-100 Beckmann, M¨unchen

Ulracentrifuge L8-70M Beckmann, M¨unchen

Cold Centrifuge J-21C and J2-MC Beckmann, M¨unchen

Labofuge GL Heraeus Sepatech

Rotors:

JA10, JA 20 Beckmann, M¨unchen

17

(32)

18 Chapter2. Materials and Methods

Ti 45, Ti 60, Ti 70 Beckmann, M¨unchen

TLA 45, Beckmann, M¨unchen

TLA-100.3 Beckmann, M¨unchen

Electrophoresis chambers for agarose gels Workshop of the Institute Electrophoresis chambers for polyacrylamide gels Workshop of the Institute Liquid scintillation counter 1900TR Packard, Frankfurt/Main

Gel dryer Bio-Rad, Hilden

Magnetic mixer IKA, Works, INC.

MALDI-TOF Mass Spectrometer, REFLEX III Bruker Daltonics, Bremen

Microwave oven Siemens, M¨unchen

pH-meter Beckmann, M¨unchen

Photometer, UV 160 A Shimadzu, Kioto/Japan

UV-hand lamp (365/254nm), Type 5415 and 5402 Eppendorf, Hamburg Vacuum concentrator model 100H Bachhofer, Reutlingen

Vortex-Genie Scientific Industries, USA.

DNA-Sequencer Type 310 ABI, PE Biosystems

Electroporator 1000 (used for bacteria) Stratagene, USA Confocal Laser Scanning Microscope Leica, Bensheim Leica TCS SP2 AOBS

(Ar: 488, 514 nm; He/Ne: 543 nm; 63x Oil Objective)

Incubators Innova 4230 and 4330 New Brunswick Scientific

Phosphoimager Fujix BAS1000 Fuji, Japan

Ultra turrax T8 IKA Labortechnik, Staufenv

Supersignal Chemiluminiscent Substrate Pierce, Illinois Thermocycler GeneAmp PCR system 9600 Perkin-Elmer Cetus

2.1.2 Chemicals, plasticware and membranes

Chemicals Boehringer/Roche, Mannheim,

Merck, Darmstadt, Roth, Karlsruhe, Serva, Heidelberg, Sigma, Deisenhofen Cell culture plasticware Greiner, Frickenhausen

Nalge Nunc International, Denmark Nitrocellulose membrane Schleich and Sch¨ull, Dassel

PVDF membrane, 0.2µM Schleich and Sch¨ull, Dassel Hybond-N Nylon membrane Amersham Biosciences, UK

(33)

2.1. Materials 19 Whatman GB002 paper Schleich and Sch¨ull, Dassel

Whatman GB003 paper extra thick Schleich and Sch¨ull, Dassel

2.1.3 Kits, spin columns and reagents

2.1.3.1 DNA

HiSpeed Plasmid Midi kit Qiagen Omniscript Reverse Transcription kit Qiagen

PCR purification kit Qiagen

QIAprep Spin Miniprep kit Qiagen QIAquick Gel Extraction kit Qiagen Effectene Transfection kit Qiagen Fugene Transfection reagent Roche

Lipofectamine 2000 Invitrogen

2.1.3.2 Protein

Bio-Rad Protein Assay Bio-Rad

DAKO fluorescent mounting medium DakoCytomation, USA

ECL Plus Amersham Biosciences

Ni-NTA agarose Qiagen

Protease Inhibitor Cocktail Sigma Supersignal Chemiluminescence Kit Pierce, USA Roti-blue Colloidal Coomassie Brilliant Blue Roth

PEFA Bloc Roth

Bovine Serum Albimin (BSA) Serva Iodoacetamide, Iodoacetic acid Sigma

PANSORBIN cells Calbiochem

Prestained Marker Biorad

2.1.4 Enzymes, nucleotides and standards

Restriction endonucleases New England Biolabs Klenow DNA polymerase New England Biolabs

DNA ligase New England Biolabs

TaqDNA polymerase Amersham Pharmacia Biotech Alkaline phosphatase Boehringer

Ultrapure dNTP Set Amersham Pharmacia Biotech

(34)

20 Chapter2. Materials and Methods Adenosine 5-triphosphate (ATP) Sigma

Oligonucleotide NAPS, G¨ottingen

Pfupolymerase Stratagene

1-kb DNA ladder Gibco BRL

2.1.5 Vectors

pBI BD CLONTECH

pSB 4.7 pA Transkaryotic Therapies Inc, Cambridge, MA pSV-pac gift from Prof. Stefan H¨oning

pUB/Bsd Invitrogen life technologies

pGBKT7-53 BD Bioscience

pGBKT7 This study

pGADT7 BD Bioscience

pLamC gift from Prof. Peter Schu pCMV2-Lys-cmyc-KDEL gift from Prof. H.D. S¨oling

2.1.6 Antibiotics and drugs

Ampicillin Serva

Neomycin (Gentamycin sulfate or G418) Gibco

Penicillin/Streptomycin Gibco

(100x =10,000 U/ml)

Kanamycin Serva

2.1.7 Radioactive substances

[³⁵S]-Cysteine, 10 mCi/ml Amersham Pharmacia Biotech 6-Sulfo-GalNAc-β(1-4)-GlcUA-β(1-3)

-6-sulfo-N-Acetyl-galactosamine (1-³H) in H₂O

2.1.8 Antibodies

2.1.8.1 Primary antibodies

antigen type Western blot reference

RGS-His₆ tag mouse mAb 1:2000 Qiagen

HA tag mouse mAb 1:2000 Covance Inc., Princeton

(35)

2.1. Materials 21

pFGE rabbit pAb 1:2500 this study

pFGE mouse mAb 1:2500 this study

FGE rabbit pAb 1:2500 this study

FGE mouse mAb 1:2500 this study

Galactose-6-sulfatase mouse mAb 1:1000 Transkaryotic Therapies, Inc, USA

FKBP12 rabbit pAb

FKBP13 rabbit pAb

2.1.8.2 Secondary antibodies

Goat anti-rabbit Horseradish peroxidase conjugate Goat anti-mouse Horseradish peroxidase conjugate

2.1.9 Yeast and Bacterial strains

2.1.9.1 Yeast strains

Strain Genotype Reporters Transformation

markers AH109 MATa,trp1-901, leu2-3, 112, HIS3, trp1,leu2

ura3-52,his3-200, gal4∆, gal80∆, ADE2, LYS2::GAL1U AS-GAL1T AT A-HIS3, MEL1, GAL2U AS-GAL2T AT A-ADE2 lacZ URA3::MEL1_{U AS}-MEL1_{T AT A}-lacZ

MEL1

Y187 MATα,Ura3-52, His3-200, MEL1, trp1,leu2 ade2-101,trp1-901,leu2-3,112, lacZ

gal4∆, gal80∆,met

URA3::GAL1_{U AS}-GAL1_{T AT A}-lacZ MEL1

2.1.9.2 Bacterial strains DH5α, Gibco BRL, Eggenstein

(36)

2.1.10 Stock solutions and buffers

1 M Sodiumphosphate buffer

1M solution of sodium di-hydrogen phosphate was slowly added to 1 M di-sodium hydrogenphosphate solution with constant mixing on a magnetic stirrer till the pH reached 7.4.

10 x PBS

100 mM sodium phosphate pH 7.4 9 % sodium chloride

Dissolved in 800 ml water and pH was adjusted to 7.4 with HCl, volume was made up to 1000 ml and autoclaved. Stored at room temperature.

1 x TBS

10 mM Tris/ HCl pH 7.4 150 mM Sodium chloride 1 x TAE 0.04 M Tris-acetate 1mM EDTA (pH 8.0)

50x TAE 242 g Tris base

57.1 g glacial acetic acid

100 ml of 0.5 M EDTA (pH 8.0)

Dissolved in water and the final volume was made upto one litre.

TE Buffer

10 mM Tris/ HCl pH 7.5 1 mM EDTA

2.1.11 Media for E.coli

2.1.11.1 Luria Bertani (LB) medium

Ingredients Amount

Glucose 1 g

Bacto-yeast extract 5 g

NaCl 5 g

Bacto-Tryptone 10 g

The medium was autoclaved and stored at room temperature.

(37)

2.1. Materials 23 2.1.11.2 LB-Agar Plates

1.5% of Agar was added to the LB medium, autoclaved and the medium was let to cool down to around 50^oC. 100 µg/ml Ampicillin or 50 µg/ml of Kanamycin was added to the medium and poured into Petri dishes.

2.1.12 Media for S.cerevisiae

2.1.12.1 YAPD medium

Ingredients For 1 liter

Amount or volume Yeast extract 10 g

Peptone 20 g

Adenine Sulfate 0.04 g

Glucose 2% (Stock 20%, Sterilized) Agar (for plates) 15 g

2.1.12.2 Synthetic minimal medium (SD)

Ingredients For 1 liter

Amount or volume Yeast Nitrogen base 1.7 g

Ammonium sulfate 5.0 g SC drop out mix (10 X) 10 ml

20% Glucose 100 ml

Agar (for plates) 15 g 2.1.12.3 SC drop mix (DO)

Supplements 10X Concentration

(mg/L) L-Adenine hemi sulfate 200

L-Arginine HCl 200

L-Histidine HCl monohydrate 200

L-Isoleucine 300

L-Leucine 1000

L-Lysine HCl 300

L-Methionine 200

(38)

L-Phenylalanine 500

L-Threonine 2000

L-Tryptophan 200

L-Tyrosine 300

L-Uracil 200

L-Valine 1500

10X dropout supplements may be autoclaved and stored at 4^oC for up to 1 year.

For making selection medium, made dropout mix lacking the appropriate amino acids. Therefore, a combination of a SD base and a DO supplement will produce a synthetic, defined minimal medium lacking one or more specific nutrients. The specific nutrients omitted depends on the selection medium desired.

2.2 Molecular Biology Methods

2.2.1 Preparation of electrocompetent E.coli (DH5α) cells

A singleE.colicolony was inoculated into 20 ml of LB medium, and allowed to grow overnight at 37ôC in a incubator at 250 rpm. 1% of this preculture was inoculated into LB medium and allowed to grow in 37ôC incubator at 250 rpm to an OD₆₀₀ of 0.4-0.6. Cells were pre-chilled on ice for 15 min and then pelleted in JA-10 rotor at 7,000 rpm for 15 min at 4ôC. Pellet was resuspended in 40 ml of pre-chilled water and centrifuged as mentioned above. This washing step with water was repeated two more times. Subsequently resuspended the pellet in 20 ml of 10% glycerol (pre-chilled) and centrifuged at 7000 rpm for 15 min at 4ôC. Finally, to the pellet an equal volume of 10% pre-chilled glycerol was added and resuspended. Aliquots of 50µl and 100µl were stored at -80ôC.

2.2.2 Transformation of electrocompetent E.coli cells

Electroporation cuvettes were chilled on ice before transformation. For each transformation 50 µl of electrocompetent E.coli cells was used. 0.5 ng of pDNA was added to the cells and the contents were transferred into the pre-chilled sterile cuvette. The cuvette was placed in the electroporater and a pulse of 2,250 V was applied. Immediately after the pulse pre-chilled LB liquid medium was added. Cells were allowed to recover in sterile eppendorfs for 40-60 min at 250 rpm in a 37 ^oC

(39)

2.2. Molecular Biology Methods 25 incubator. Later cells were plated on LB plates containing appropriate antibiotics and allowed to grow overnight at 37^oC.

2.2.3 Glycerol stocks of bacterial strains

A single bacterial colony was allowed to grow overnight at 250 rpm in a 37^oC incubator. 0.3 ml of sterile 100% glycerol was taken in freezing vials to which 700 µl of the overnight culture grown to exponential stage was added. The contents were gently mixed, freezed in liquid nitrogen and stored in -80^oC.

2.2.4 Isolation of plasmid DNA

Small amounts of plasmid DNA (pDNA) were isolated using Qiagen. A single colony was inoculated into 4-5 ml of LB medium with appropriate antibiotics. pDNA was isolated according to the instructions of the manufacturer.

Buffer P1 50 mM Tris/Hcl pH 8.0 (Suspension buffer) 10 mM EDTA

100µg/ml RNase A

Buffer P2 0.2 M NaOH

(Lysis buffer) 1% SDS

Buffer P3 3 M Potassium acetate pH 5.5

Cells were pelleted in a table-top centrifuge at 3,000 rpm for 5 min. Cell pellet was resuspended in 250 µl of buffer P1 and 250 µl of buffer P2 was added, mixed gently by inverting the tube 4-6 times. To this, 350 µl of buffer P3 was added and gently mixed by inverting the tube 4-6 times and centrifuged for 10 min at 13,000 rpm to pellet down the cell debris. The supernatant was applied onto a QIAprep spin column and centrifuged for 1 min at 13,000 rpm. Flow through was discarded, the column was washed with 0.75 ml on buffer PE and centrifuged again for 1 min. Flow through was discarded and the column was centrifuged for an additional 1 min to remove any residual was buffer. The column was placed in a clean eppendorf tube and 50 µl of warm distilled water was added directly to the centre of the column. The column was let to stand for 1 min and pDNA was eluted by centrifuging at 13,000 rpm for 1 min.

Large amounts of pDNA were isolated either by using HiSpeed plasmid midi kit (Qiagen) or PureYield^{T M} plasmid midiprep system. pDNA was isolated according to the instructions of the manufacturer.

(40)

2.2.5 Determination of DNA concentration

Purity and concentration of the pDNA was determined by measuring the absorbance at 260 and 280 nm against the blank. Absorbance or optical density (OD) of one at 260 nm corresponds to ∼50 µg/ml of double stranded DNA or ∼40 µg/ml of single stranded DNA or RNA and ∼20 µg/ml of oligonucleotides. The ratio between the readings at 260 nm and 280 nm provides a relative measure of purity of the nucleic acid. Ratios less than 2.0 for DNA or 1.8 for RNA mean that the solution is contaminated with proteins or phenol or other organic contaminants.

2.2.6 Restriction endonuclease digestion of DNA

Restriction enzymes of type II recognize and cleave specific palindrome sequences of double stranded DNA. If the cleavage occurs between the opposite phosphodiester bonds, the resulting fragments have blunt ends. If the cleavage is asymmetric, fragments have 3’ or 5’ sticky ends. The activity of restriction endonucleases is expressed in Units (U). One unit of activity means that this amount of enzyme can totally digest 1µg of DNA standard (mainly Lambda-Phage DNA) in one hour. The restriction enzymes were used according to the instructions of the producers (New England Bio Labs Beverly U.S.A) with appropriate buffers and temperature. For the preparative hydrolysis usually 4-5 units of enzyme per µg of DNA were taken and incubated at least for 2 hours.

2.2.7 Agarose gel electrophoresis of DNA

The size and purity of DNA is analyzed by agarose gel electrophoresis. Concentra- tion of agarose used for analysis is inversely proportional to the size of the DNA of interest, that is, the larger the DNA the lower the concentration of agarose.

Agarose concentration DNA size

% (w/v) (kb)

0.6 20 - 1.0

0.9 7 - 0.5

1.2 6 - 0.4

1.5 4 - 0.2

2.0 3 - 0.1

(41)

2.2. Molecular Biology Methods 27 Gel loading buffer (10x):0.25% (w/v) Bromophenol blue + 40% Saccharose in 1x TAE.

Agarose was weighed and dissolved in 1 x TAE by boiling in microwave oven.

The agarose solution was cooled to 60^◦C and ethidium bromide was added to a final concentration of 0.5 µg/ml. This was poured into the agarose gel cassette and allowed to polymerize completely. The sample DNA was mixed with gel loading buffer and loaded onto the gel. The gel electrophoresis was carried out at 100 V. Ethidium bromide is a fluorescent dye which contains a planar group that intercalates between the stacked bases of the DNA. The fixed position of this group and its close proximity to the bases cause the dye to bound to DNA. It results in an increased fluorescent yield compared to that of the dye in free solution. Ultraviolet radiation at 254 nm is absorbed by the DNA and transmitted to the dye; radiation at 302 nm and 366 nm is absorbed by the bound dye itself. In both cases, the energy is re-emitted at 590 nm in the red orange region of the visible spectrum. Hence DNA can be visualized under a UV transilluminator. The gel was photographed using a gel documentation system.

2.2.8 Cloning of FGE subdomains in pGBKT7 vector

pGBKT7-p53 (BD Biosciences), is a Gal4 DNA-binding domain vector with p53 cDNA. It is a shuttle vector with kanamycin resistance gene and tryptophan coding sequence. Based on domain mapping predictions of FGE, fusion constructs of FGE bait cDNA were generated in-frame with Gal4 DNA-binding domain sequence in pGBKT7 bait vector (directional cloning of FGE was performed in pGBKT7 vector by removing p53 cDNA from pGBKT7-p53 vector using EcoR I and Sal I restriction enzymes). The cloned FGE cDNAs encoded aminoacids 87-374, 176-374, 87-157, 176-312, 320-374, which were designated as FGE bait I, bait I-III, bait II-III, bait I, bait II and bait III, respectively.

Name of the Primer Oligonucleotide

construct 5’→3’

FGE Bait I FGE-I-EcoRIc GGAATTCGCGCACTCAAAGATGGTCC FGE-I-SalInc ACGCGTCGACAAAGGAGTCGCCAAAC FGE Bait II FGE-II-EcoRIc GGAATTCGCTGCTCCCTGGTGGTTAC

FGE-II-SalInc ACGCGTCGACAGAATGATGAACAGTCCAC FGE Bait III FGE-III-EcoRIc GGAATTCGGTCCCCCTTCTGGGAAAG

FGE-III-SalInc ACGCGTCGACTCAGTCCATGGTGGGCAGG FGE Bait IV FGE-I-EcoRIc GGAATTCGCGCACTCAAAGATGGTCC

FGE-III-SalInc ACGCGTCGACTCAGTCCATGGTGGGCAGG

(42)

FGE Bait V FGE-II-EcoRIc GGAATTCGCTGCTCCCTGGTGGTTAC FGE-III-SalInc ACGCGTCGACTCAGTCCATGGTGGGCAGG

Note: c- coding or forward primer; nc-non-coding or reverse primer.

2.2.8.1 Cloning of pFGE in pGBKT7 or pGADT7 vector

The human pFGE cDNA (encoding residues 26-301) was cloned in-frame with Gal4 DNA-binding domain, encoding sequence in pGBKT7 bait vector (see above) or into the pGADT7 prey vector in-frame with Gal4 DNA-activating domain. The human FGE cDNA (encoding amino acids 87-374) was cloned into the pGADT7 prey vector in-frame with Gal4 DNA-activating domain.

Name of the Primer Oligonucleotide

construct 5’→3’

pFGE Bait vector pFGE-I-EcoRIc GGAATTCCAGGCTACTAGTATGGTCC pFGE-I-SalInc ACGCGTCGACTGTCACCACCCGGCTGC pFGE Prey vector pFGE-I-EcoRIc GGAATTCCAGGCTACTAGTATGGTCC

pFGE-II-XhoInc CCGCTCGAGTGTCACCACCCGGCTGC FGE Prey vector FGE-I-EcoRIc GGAATTCGCGCACTCAAAGATGGTCC

FGE-III-XhoInc CCGCTCGAGTCAGTCCATGGTGGGCAGG

Note: c- coding or forward primer; nc- non-coding or reverse primer.

2.2.8.2 Cloning of wt pFGE or its C-terminus variants in pBI vector

Human pFGE C-terminal variants or lysozyme C-terminal variants were constructed in pBI Tet vector (MCS I). It is a Tet responsive plasmid, that can express simultaneously two genes of interest from one bi-directional tet-responsive promoter, Clontech Tet-on^{T M} &Tet-off^{T M} Gene expression system.

For cloning wt pFGE or its C-terminal variants (PGEL tetrapeptide was either deleted or substituted by KDEL or SGEL), pLP plasmid containing wt pFGE served as a template for add-on PCR. pFGE-NheIc served as a forward primer while the reverse primers was either pFGE-EcoRVnc or pFGE-GRP-EcoRVnc, or pFGE-KDEL- EcoRVnc or pFGE-SGEL-EcoRVnc. Thus, addition of NheI site at the 5’ end and EcoRV at the 3’ end of the PCR product. Thus, facilitating directional cloning of the PCR product into MCS I of pBI Tet vector atNheI andEcoRV.

Mechanism of pFGE and FGE Retention in Endoplasmic Reticulum