2.2.1 Preparation of electrocompetent E.coli (DH5α) cells
A singleE.colicolony was inoculated into 20 ml of LB medium, and allowed to grow overnight at 37oC in a incubator at 250 rpm. 1% of this preculture was inoculated into LB medium and allowed to grow in 37oC incubator at 250 rpm to an OD600 of 0.4-0.6. Cells were pre-chilled on ice for 15 min and then pelleted in JA-10 rotor at 7,000 rpm for 15 min at 4oC. Pellet was resuspended in 40 ml of pre-chilled water and centrifuged as mentioned above. This washing step with water was repeated two more times. Subsequently resuspended the pellet in 20 ml of 10% glycerol (pre-chilled) and centrifuged at 7000 rpm for 15 min at 4oC. Finally, to the pellet an equal volume of 10% pre-chilled glycerol was added and resuspended. Aliquots of 50µl and 100µl were stored at -80oC.
2.2.2 Transformation of electrocompetent E.coli cells
Electroporation cuvettes were chilled on ice before transformation. For each trans-formation 50 µl of electrocompetent E.coli cells was used. 0.5 ng of pDNA was added to the cells and the contents were transferred into the pre-chilled sterile cuvette. The cuvette was placed in the electroporater and a pulse of 2,250 V was applied. Immediately after the pulse pre-chilled LB liquid medium was added. Cells were allowed to recover in sterile eppendorfs for 40-60 min at 250 rpm in a 37 oC
2.2. Molecular Biology Methods 25 incubator. Later cells were plated on LB plates containing appropriate antibiotics and allowed to grow overnight at 37oC.
2.2.3 Glycerol stocks of bacterial strains
A single bacterial colony was allowed to grow overnight at 250 rpm in a 37oC incubator. 0.3 ml of sterile 100% glycerol was taken in freezing vials to which 700 µl of the overnight culture grown to exponential stage was added. The contents were gently mixed, freezed in liquid nitrogen and stored in -80oC.
2.2.4 Isolation of plasmid DNA
Small amounts of plasmid DNA (pDNA) were isolated using Qiagen. A single colony was inoculated into 4-5 ml of LB medium with appropriate antibiotics. pDNA was isolated according to the instructions of the manufacturer.
Buffer P1 50 mM Tris/Hcl pH 8.0 (Suspension buffer) 10 mM EDTA
100µg/ml RNase A
Buffer P2 0.2 M NaOH
(Lysis buffer) 1% SDS
Buffer P3 3 M Potassium acetate pH 5.5
Cells were pelleted in a table-top centrifuge at 3,000 rpm for 5 min. Cell pellet was resuspended in 250 µl of buffer P1 and 250 µl of buffer P2 was added, mixed gently by inverting the tube 4-6 times. To this, 350 µl of buffer P3 was added and gently mixed by inverting the tube 4-6 times and centrifuged for 10 min at 13,000 rpm to pellet down the cell debris. The supernatant was applied onto a QIAprep spin column and centrifuged for 1 min at 13,000 rpm. Flow through was discarded, the column was washed with 0.75 ml on buffer PE and centrifuged again for 1 min. Flow through was discarded and the column was centrifuged for an additional 1 min to remove any residual was buffer. The column was placed in a clean eppendorf tube and 50 µl of warm distilled water was added directly to the centre of the column. The column was let to stand for 1 min and pDNA was eluted by centrifuging at 13,000 rpm for 1 min.
Large amounts of pDNA were isolated either by using HiSpeed plasmid midi kit (Qiagen) or PureYieldT M plasmid midiprep system. pDNA was isolated according to the instructions of the manufacturer.
26 Chapter2. Materials and Methods
2.2.5 Determination of DNA concentration
Purity and concentration of the pDNA was determined by measuring the absorbance at 260 and 280 nm against the blank. Absorbance or optical density (OD) of one at 260 nm corresponds to ∼50 µg/ml of double stranded DNA or ∼40 µg/ml of single stranded DNA or RNA and ∼20 µg/ml of oligonucleotides. The ratio between the readings at 260 nm and 280 nm provides a relative measure of purity of the nucleic acid. Ratios less than 2.0 for DNA or 1.8 for RNA mean that the solution is contaminated with proteins or phenol or other organic contaminants.
2.2.6 Restriction endonuclease digestion of DNA
Restriction enzymes of type II recognize and cleave specific palindrome sequences of double stranded DNA. If the cleavage occurs between the opposite phosphodiester bonds, the resulting fragments have blunt ends. If the cleavage is asymmetric, fragments have 3’ or 5’ sticky ends. The activity of restriction endonucleases is expressed in Units (U). One unit of activity means that this amount of enzyme can totally digest 1µg of DNA standard (mainly Lambda-Phage DNA) in one hour. The restriction enzymes were used according to the instructions of the producers (New England Bio Labs Beverly U.S.A) with appropriate buffers and temperature. For the preparative hydrolysis usually 4-5 units of enzyme per µg of DNA were taken and incubated at least for 2 hours.
2.2.7 Agarose gel electrophoresis of DNA
The size and purity of DNA is analyzed by agarose gel electrophoresis. Concentra-tion of agarose used for analysis is inversely proporConcentra-tional to the size of the DNA of interest, that is, the larger the DNA the lower the concentration of agarose.
Agarose concentration DNA size
% (w/v) (kb)
0.6 20 - 1.0
0.9 7 - 0.5
1.2 6 - 0.4
1.5 4 - 0.2
2.0 3 - 0.1
2.2. Molecular Biology Methods 27 Gel loading buffer (10x):0.25% (w/v) Bromophenol blue + 40% Saccharose in 1x TAE.
Agarose was weighed and dissolved in 1 x TAE by boiling in microwave oven.
The agarose solution was cooled to 60◦C and ethidium bromide was added to a final concentration of 0.5 µg/ml. This was poured into the agarose gel cassette and allowed to polymerize completely. The sample DNA was mixed with gel loading buffer and loaded onto the gel. The gel electrophoresis was carried out at 100 V. Ethidium bromide is a fluorescent dye which contains a planar group that intercalates between the stacked bases of the DNA. The fixed position of this group and its close proximity to the bases cause the dye to bound to DNA. It results in an increased fluorescent yield compared to that of the dye in free solution. Ultraviolet radiation at 254 nm is absorbed by the DNA and transmitted to the dye; radiation at 302 nm and 366 nm is absorbed by the bound dye itself. In both cases, the energy is re-emitted at 590 nm in the red orange region of the visible spectrum. Hence DNA can be visualized under a UV transilluminator. The gel was photographed using a gel documentation system.
2.2.8 Cloning of FGE subdomains in pGBKT7 vector
pGBKT7-p53 (BD Biosciences), is a Gal4 DNA-binding domain vector with p53 cDNA. It is a shuttle vector with kanamycin resistance gene and tryptophan coding sequence. Based on domain mapping predictions of FGE, fusion constructs of FGE bait cDNA were generated in-frame with Gal4 DNA-binding domain sequence in pGBKT7 bait vector (directional cloning of FGE was performed in pGBKT7 vector by removing p53 cDNA from pGBKT7-p53 vector using EcoR I and Sal I restriction enzymes). The cloned FGE cDNAs encoded aminoacids 87-374, 176-374, 87-157, 176-312, 320-374, which were designated as FGE bait I, bait I-III, bait II-III, bait I, bait II and bait III, respectively.
Name of the Primer Oligonucleotide
construct 5’→3’
FGE Bait I FGE-I-EcoRIc GGAATTCGCGCACTCAAAGATGGTCC FGE-I-SalInc ACGCGTCGACAAAGGAGTCGCCAAAC FGE Bait II FGE-II-EcoRIc GGAATTCGCTGCTCCCTGGTGGTTAC
FGE-II-SalInc ACGCGTCGACAGAATGATGAACAGTCCAC FGE Bait III FGE-III-EcoRIc GGAATTCGGTCCCCCTTCTGGGAAAG
FGE-III-SalInc ACGCGTCGACTCAGTCCATGGTGGGCAGG FGE Bait IV FGE-I-EcoRIc GGAATTCGCGCACTCAAAGATGGTCC
FGE-III-SalInc ACGCGTCGACTCAGTCCATGGTGGGCAGG
28 Chapter2. Materials and Methods
FGE Bait V FGE-II-EcoRIc GGAATTCGCTGCTCCCTGGTGGTTAC FGE-III-SalInc ACGCGTCGACTCAGTCCATGGTGGGCAGG
Note: c- coding or forward primer; nc-non-coding or reverse primer.
2.2.8.1 Cloning of pFGE in pGBKT7 or pGADT7 vector
The human pFGE cDNA (encoding residues 26-301) was cloned in-frame with Gal4 DNA-binding domain, encoding sequence in pGBKT7 bait vector (see above) or into the pGADT7 prey vector in-frame with Gal4 DNA-activating domain. The human FGE cDNA (encoding amino acids 87-374) was cloned into the pGADT7 prey vector in-frame with Gal4 DNA-activating domain.
Name of the Primer Oligonucleotide
construct 5’→3’
pFGE Bait vector pFGE-I-EcoRIc GGAATTCCAGGCTACTAGTATGGTCC pFGE-I-SalInc ACGCGTCGACTGTCACCACCCGGCTGC pFGE Prey vector pFGE-I-EcoRIc GGAATTCCAGGCTACTAGTATGGTCC
pFGE-II-XhoInc CCGCTCGAGTGTCACCACCCGGCTGC FGE Prey vector FGE-I-EcoRIc GGAATTCGCGCACTCAAAGATGGTCC
FGE-III-XhoInc CCGCTCGAGTCAGTCCATGGTGGGCAGG
Note: c- coding or forward primer; nc- non-coding or reverse primer.
2.2.8.2 Cloning of wt pFGE or its C-terminus variants in pBI vector
Human pFGE C-terminal variants or lysozyme C-terminal variants were constructed in pBI Tet vector (MCS I). It is a Tet responsive plasmid, that can express simultaneously two genes of interest from one bi-directional tet-responsive promoter, Clontech Tet-onT M &Tet-offT M Gene expression system.
For cloning wt pFGE or its C-terminal variants (PGEL tetrapeptide was either deleted or substituted by KDEL or SGEL), pLP plasmid containing wt pFGE served as a template for add-on PCR. pFGE-NheIc served as a forward primer while the reverse primers was either pFGE-EcoRVnc or pFGE-GRP-EcoRVnc, or pFGE-KDEL-EcoRVnc or pFGE-SGEL-pFGE-KDEL-EcoRVnc. Thus, addition of NheI site at the 5’ end and EcoRV at the 3’ end of the PCR product. Thus, facilitating directional cloning of the PCR product into MCS I of pBI Tet vector atNheI andEcoRV.
2.2. Molecular Biology Methods 29
Name of the Primer Oligonucleotide
construct 5’→3’
wt pFGE pFGE-NheIc CTAGCTAGCCACCATGGCCCGGCATGGGTTAC pFGE-EcoRV nc TCTAGAGATATCTACAGCTCCCCTGGCG truncated pFGE pFGE-NheI c CTAGCTAGCCACCATGGCCCGGCATGGGTTAC
pFGE-GRP-EcoRV nc TCTAGAGATATCTACGGCCGGCCTGCGTC pFGE-KDEL pFGE-NheI c CTAGCTAGCCACCATGGCCCGGCATGGGTTAC
pFGE-KDEL-EcoRV nc TCTAGAGATATCTACAGCTCGTCTTTCGGCCGGCCTG PFGE-SGEL pFGE-NheI c CTAGCTAGCCACCATGGCCCGGCATGGGTTAC
pFGE-SGEL-EcoRV nc TCTAGAGATATCTACAGCTCCCCGGACGGCC
Note: c- coding or forward primer; nc- non-coding or reverse primer.
To clone wt lysozyme or its C-terminal variants (hybrid variants of lysozyme either with PGEL or KDEL at the carboxy terminus), pCMV2 plasmid containing lysozyme cDNA appended with cMyc tag and KDEL at the carboxy terminus respectively (kind gift from Prof. Hans Dieter S¨oling), served as a template for add-on PCR. LYSwt-NheIc served as a forward primer while the reverse primers were either LYScMyc-EcoRVnc or LYScMyc-PGELEcoRVnc or LYScMyc-KDELEcoRVnc.
Therefore the PCR product would haveNheI site at the 5’ end andEcoRV site at 3’.
It facilitated directional cloning of the lysozyme in MCS I of pBI Tet vector.
Name of the Primer Oligonucleotide
construct 5’→3’
wt Lys LYSwtC GTCAGCTAGCCGGCCCGCCATGAGGTCTTTGCTAATC LYScmycNC CCGGATATCGATTCACTCACTATCGATGTTGAGGTC Lys-PGEL LYSwtC GTCAGCTAGCCGGCCCGCCATGAGGTCTTTGCTAATC
LYScmyc-PGELNC CCGGATATCGATTCATAGCTCCCCTGGCTCACTATC Lys-KDEL LYSwtC GTCAGCTAGCCGGCCCGCCATGAGGTCTTTGCTAATC
LYScmyc-KDELNC CCGGATATCGATTCATAGCTCGTCCTTCTCACT
Note: c- coding or forward primer; nc- non-coding or reverse primer.
2.2.9 Polymerase chain reaction (PCR)
PCR is a rapid and versatile in vitro method for amplifying defined target DNA fragments by DNA polymerase which occurs naturally in living organisms, where it duplicates DNA when cells divide. It is used to amplify a short, well-defined part of a DNA strand. Taq polymerase is widely used but the disadvantage is that it lacks
30 Chapter2. Materials and Methods 3’→5’ proof reading exonuclease activity, leading to mutations in the sequence. But polymerase such asPfuhave proof reading mechanism, so, combinations ofTaqand Pfuprovide high fidelity and accurate amplification of DNA.
Condition Temperature Time Denaturation 95oC 2 min Amplification 95oC 30 sec
55oC 30 sec
72oC 30 60 sec
Extention 72oC 10 min
End 4oC ∞
PCR Mix
Components Volume
10XTaqbuffer (100 mM Tris/HCl pH 9.0; 500 mM KCl) 10µl 2.5 mM dNTPs (Amersham, Stock 100 mM) 10µl
25 mM MgCl2 5µl
5-primer (Stock 100 pmol/µl) 2µl
3-primer (Stock 100 pmol/µl) 2µl
Template DNA (40 ng/µl) 1µl
Taqpolymerase + 1/10Pfu-Polymerase 1µl Final volume made upto 100 µl with HPLC water
2.2.10 Ligation
Joining linear DNA fragments together by a phosphodiester bond between the 3’
hydroxyl of one nucleotide and the 5’ phosphate of another is called ligation. T4 DNA ligase is used for this purpose, it ligates the cohesive ends of the fragments.
There are two types of ligation viz., cohesive end or sticky end ligation and blunt end ligation, depending on the restriction digestion of the DNA. For the blunt end ligation and also if digestion was with single sticky end enzyme, the vector should be dephosphorylated by alkaline phosphatase, and the ligation mix should be incubated overnight.
2.2. Molecular Biology Methods 31 For example:
xµl linearised vector DNA
yµl Insert DNA [1(vector DNA):10 (insert DNA)]
1.5µl 10x Ligase buffer
1.0µl T4-DNA-Ligase (400 U/µl)
Made upto 15µl with ddH2O, incubated overnight at 16oC and transformed into E.colicompetent cells.
2.2.11 Sequencing of the clones
DNA sequencing was done by Sanger’s method using a DNA sequencer. The plasmid DNA to be sequenced was supplied with a mixture of all four nucleotides plus four ddNTPs, each labeled with a tag that fluoresces different color. For sequencing reaction, clean DNA should be used (prepared by QIAprep-Spin-Miniprep-Kit).
For example:
xµl Plasmid-DNA (0.2 - 0.5µg)
3.2µl Forward primer or reverse primer (1 pmol/µl)
2.0µl ABI PRISM Dye Terminator Cycle Sequencing Ready Reaction Premix xµl HPLC-H2O (Make it upto 10µl)
Condition Temperature Time Denaturation 96oC 10 sec Amplification 96oC 10 sec
50oC 5 sec
60oC 4 min
25 cycles
End 4oC ∞
The PCR product for sequencing should be cleaned thoroughly to remove flu-orescently labeled free ddNTPs to avoid background. To the PCR product 2 µl of 3 M Sodium acetate (pH 5.2) and 50 µl 95 % ethanol (room temperature) was added, incubated at RT for 10 min and centrifuged for 20 min at 13000 rpm. The pellet was washed with 250µl of 70% ethanol for 10 min at 13000 rpm, dried and resuspended in 25µl of HPLC water and given for sequencing.
32 Chapter2. Materials and Methods