Biosynthesis of plant polyketides in yeast
vom Fachbereich Biologie
der Technischen Universität Darmstadt
zur Erlangung des Grades
Doctor rerum naturalium
(Dr. rer. nat.)
Dissertation von
Michael Oliver Eichenberger
Erstgutachterin: Prof. Dr. Beatrix Süß
Zweitgutachter: Prof. Dr. Heribert Warzecha
Drittgutachter: Dr. Michael Næsby
Eichenberger, Michael: Biosynthesis of plant polyketides in yeast Darmstadt, Technische Universität Darmstadt,
Jahr der Veröffentlichung der Dissertation auf TUprints: 2019 Tag der mündlichen Prüfung: 26.03.2018
Veröffentlicht unter CC BY-SA 4.0 International https://creativecommons.org/licenses/
Acknowledgments
This thesis would not have been possible without the help of many people, therefore I’m deeply grateful to…
…Michael for all the guidance, discussions, support, advice, and trust. …Prof. Dr. Beatrix Süß for the great collaboration and co-supersivion. …Prof. Dr. Heribert Warzecha for being co-referee.
…Prof. Dr. Johannes Kabisch and Prof. Dr. Eckhard Boles for being on the examination committee.
…David for injecting and analyzing thousands of samples.
…Rafael, Mounir, Maria, Diane, Caroline, Zina, Yvonne, Wijb, Lara, and Arésu for the great work, enthusiasm, and discussions.
…Philipp for his bioinformatics support.
…Anders, Sam, Roberta, and Corina for the great discussions, fun times, and good music in the labs.
…Beata, Ernesto, Klaas, Niels, Carlos, Nick, and Katherina for the fruitful collaborations across sites.
…Vicky for all the plates poured, medias prepared, and the awesome chocolate mousse. …Christophe and the whole AC team for all the debugging.
…Stefan for insightful discussions and inputs. …Cristina and Martin for the great Riboswitch work.
…The PROMYS consortium for all the inspiration and the great meetings. …Tim, Solvej, and Michael for the collaboration on transcription factors. …Chloé, Ernesto, and Luke for the relaxing and fun atmosphere at the desks. …Regina and Julie for making me fit.
…All Evolva people for the great work environment, helpfulness, and enjoyable events. …Family and friends for keeping me in balance.
Section 5.1 of this thesis was published in:
Eichenberger M, Lehka BJ, Folly C, Fischer D, Martens S, Simón E, Naesby M. Metabolic engineering of Saccharomyces cerevisiae for de novo production of dihydrochalcones with known antioxidant, antidiabetic, and sweet tasting properties. Metab Eng, 39:80-89, January 2017.
Table of Content
1 Summary ... 1
2 Zusammenfassung ... 2
3 Introduction ... 4
3.1 Industrial biotechnology in the age of synthetic biology ... 4
3.1.1 Brief history of industrial biotechnology ... 4
3.1.2 Impact of industrial biotechnology ... 5
3.1.3 Industry landscape and recent trends ... 6
3.2 Plant polyketides ... 10
3.3 Dihydrochalcones ... 12
3.3.1 Introduction to dihydrochalcones ... 12
3.3.2 Biosynthesis of dihydrochalcones ... 13
3.3.3 Metabolic engineering of microorganisms for production of dihydrochalcones ... 14
3.4 Anthocyanins ... 15
3.4.1 Introduction to anthocyanins ... 15
3.4.2 Biosynthesis of anthocyanins ... 15
3.4.3 Transport of anthocyanins ... 18
3.4.4 Metabolic engineering of microorganisms for production of anthocyanins .. 19
3.5 Scope of the thesis ... 19
4 Materials and Methods ... 20
4.1 Chemicals ... 20
4.2 Plasmids and enzymes ... 20
4.3 Yeast strains ... 26
4.4 Assembly of gene expression cassettes on multi-expression plasmids or into the genome by homologous recombination ... 27
4.5 Yeast growth and metabolite extraction ... 38
4.6 Quantification of compounds by UPLC-MS ... 38
5 Results and Discussion ... 40
5.1 Metabolic engineering of S. cerevisiae for de novo production of dihydrochalcones with known antioxidant, antidiabetic, and sweet tasting properties ... 40
5.1.1 Testing DBRs for production of phloretin in metabolically engineered
yeast ... 40
5.1.2 Characterization of the phloretin pathway in vivo ... 42
5.1.3 Using ScTSC13 for production of pinocembrin dihydrochalcone ... 45
5.1.4 Testing CHS from various plant species for more specific phloretin production ... 46
5.1.5 Production of the monoglycosylated dihydrochalcones phlorizin and nothofagin using known UGTs ... 49
5.1.6 Production of NDC using two substrate-promiscuous UGTs ... 49
5.1.7 Production of 3-hydroxyphloretin using a substrate promiscuous CYP ... 51
5.2 De novo biosynthesis of anthocyanins in S. cerevisiae ... 53
5.2.1 Pathway to naringenin and hydroxylation of the B and C rings. ... 53
5.2.2 DFRs are efficient in the biosynthetic pathways to flavan-3-ols ... 55
5.2.3 Biosynthesis of anthocyanins and testing of A3GTs ... 57
5.2.4 Production of flavonols is a common trait of ANS enzymes in yeast ... 59
5.2.5 In vivo flavonol production by ANS in yeast ... 61
5.2.6 Discussion ... 63
5.3 GSTs allow anthocyanin production without flavonol accumulation ... 67
5.3.1 Testing GSTs in pathways to the three core anthocyanins ... 67
5.3.2 Expression of plant transporters has no effect on anthocyanin production in yeast ... 69
5.3.3 Production of anthocyanins in slow glucose release medium ... 70
5.3.4 Modification of core anthocyanins results in various color formation ... 72
5.3.5 Discussion ... 74 6 Abbreviations ... 78 7 References ... 80 8 Publications ... 107 9 Patent applications ... 107 10 Poster presentations ... 107 11 Curriculum vitae ... 108 12 Ehrenwörtliche Erklärung ... 109
1 Summary
Industrial biotechnology aims to replace production processes based on petrochemicals with more sustainable biological processes based on renewable raw materials. With the rise of metabolic engineering and synthetic biology in the last decades, the range of products attainable by this technology has widened substantially. This thesis explores the potential of Saccharomyces cerevisiae for the production of two commercially interesting compound classes within the plant polyphenols.
The first part demonstrates heterologous production of various dihydrochalcones. A side activity of the native ScTsc13, the reduction of coumaroyl-CoA to p-dihydrocoumaroyl-CoA, was used for de novo production of phloretin, the first committed dihydrochalcone. By further extension of the pathway from phloretin, by employing decorating enzymes with known specificities for dihydrochalcones, and by exploiting substrate flexibility of enzymes involved in flavonoid biosynthesis, de novo production of the antioxidant molecule nothofagin, the antidiabetic molecule phlorizin, the sweet molecule naringin dihydrochalcone, and 3-hydroxyphloretin was achieved.
In the second part, yeast was engineered for de novo production of anthocyanins, molecules that are used in the food and beverage industries as natural colorants. Enzymes from different plant sources were screened and efficient variants were found for most steps of the pathways to the three main anthocyanins. However, as previously shown in vitro and in Escherichia coli, the shunt flavonol production by the anthocyanidin synthase was a major limitation.
In the third part, this flavonol by-product formation was eliminated by co-expression of glutathione-S-transferases. These enzymes, previously thought to be involved in vacuolar transport of anthocyanins in plants, were shown to be required for correct product formation by anthocyanidin synthases. By additional co-expression of glycosyltransferases and a malonyltransferase, the pathway was extended to various decorated anthocyanins with a range of different colors.
This thesis uncovers and describes important steps towards a sustainable biotechnological process for production of dihydrochalcones and anthocyanins. However, further optimization to increase titers will be required before such processes become commercially viable.
2 Zusammenfassung
Die industrielle Biotechnologie ermöglicht es, petrochemische Produktionsprozesse durch nachhaltigere biologische Prozesse auf Basis von nachwachsenden Rohstoffen zu ersetzen. In den letzten Jahrzehnten hat sich mit dem Aufkommen von Metabolic Engineering und der synthetischen Biologie das Produktspektrum der industriellen Biotechnologie erheblich erweitert. Diese Dissertation untersucht das Potenzial von S. cerevisiae zur Herstellung von zwei kommerziell interessanten Stoffklassen, die zu den pflanzlichen Polyphenolen gehören.
Der erste Teil zeigt die heterologe Produktion von verschiedenen Dihydrochalconen. Zur de novo Produktion von Phloretin, dem Ausgangsmolekül der meisten Dihydrochalconen, wurde die Reduktion von cumaryl-CoA zu p-dihydrocumaryl-CoA durch ScTsc13 verwendet, eine Nebenaktivität dieser endogenen Doppelbindungsreduktase. Der Stoffwechselweg wurde dann unter Verwendung von Enzymen mit bekannten Spezifitäten und durch Ausnutzung der Substratflexibilität von Enzymen, die an der Flavanoidbiosynthese beteiligt sind, zum antioxidativen Molekül Nothofagin, zum antidiabetischen Molekül Phloridzin, zum Süßstoff Naringin Dihydrochalcon und zu 3-Hydroxyphloretin erweitert.
Im zweiten Teil wurde gezeigt, dass Hefe zur de novo Produktion der drei wichtigsten Anthocyanen, welche in der Lebensmittel- und Getränkeherstellung Anwendungen als natürliche Farbstoffe haben, verwendet werden kann. Enzyme aus verschiedenen Pflanzen wurden getestet und effiziente Varianten für die meisten Schritte des Stoffwechselwegs wurden gefunden. Wie zuvor schon für in vitro Reaktionen und in E. coli gezeigt wurde, war die Akkumulation der Flavonol Nebenprodukte aufgrund der Anthocyanidinsynthase auch in Hefe das Hauptproblem.
Im dritten Teil wurde die Bildung der Flavonol Nebenprodukte durch die Koexpression von Glutathion-S-Transferasen eliminiert. Für diese Enzyme wurde vorher angenommen, dass sie am vakuolären Transport von Anthocyanen in Pflanzen beteiligt sind. Sie werden jedoch für die korrekte Produktbildung der Anthocyanidinsynthase benötigt. Durch zusätzliche Expression von Glykosyltransferasen und einer Malonyltransferase konnten wir die de novo Produktion von verschieden dekorierten Anthocyaninen mit unterschiedlichen Farben zeigen.
Diese Dissertation ist ein wichtiger Schritt zu einer nachhaltigeren biotechnologischen Produktion von Dihydrochalconen und Anthocyaninen in Hefe. Um
die notwendigen Produktionstiter für einen kommerziell umsetzbaren Prozess zu erreichen sind jedoch noch weitere Optimierungen erforderlich.
3 Introduction
3.1 Industrial biotechnology in the age of synthetic biology
3.1.1 Brief history of industrial biotechnology
Microorganisms have been used for preservation and enhancement of foods and beverages long before their exact nature was discovered. Earliest records of the use of fermentation date back to 7000BC, when in Sumeria and Babylonia the conversion of sugar to alcohol was used to brew beer (Demain, 2010). Ever since, all around the world, a plethora of fermented foods have been produced and consumed (Katz, 2012). The use of large-scale microbial fermentation for non-food products was pioneered during World War I, when in Germany yeast was used for conversion of sugars into glycerol and in the United Kingdom Clostridium was shown to produce acetone and butanol (Demain, Vandamme, Collins, & Buchholz, 2016).
In the following decades of the 20th century, industrial biotechnology mainly
focused on primary and secondary metabolites produced natively in various microorganisms, such as antibiotics, amino acids, nucleotides, vitamins, organic acids, or alcohols. While initial strain improvement was based on cycles of random mutagenesis and screening, selection strategies were introduced in the 1950s, in order to reduce the numbers of screened strains (Demain, 2010). In the late 1970s and 1980s, major breakthroughs in recombinant DNA technology enabled new approaches for production of chemicals, but also biotechnological production of protein biopharmaceuticals, such as human insulin, or of industrial enzymes, e.g. for food processing and as detergents (Demain, 2010; Headon & Walsh, 1994). Further development of analytical technologies, and the emphasis on the importance of metabolic fluxes led to the rise of a novel concept called metabolic engineering in the 1990s. In the seminal book of the field it was defined as “the directed improvement of product formation or cellular properties through the modification of specific biochemical reaction(s) or the introduction of new one(s) with the use of recombinant DNA technology“ (Stephanopoulos, Aristidou, & Nielsen, 1998).
Driver of the next revolution in industrial biotechnology was the standardization and characterization of well-defined parts (e.g. enzymes, expression units, localization tags, integration sites), novel DNA assembly and genome scale engineering
technologies, as well as the emergence of cost-effective DNA sequencing and synthesis, which led to the field of synthetic biology (Wittmann, 2017). Synthetic biology is based on an engineering approach (design-build-test-learn cycle) to rationally design organisms or other biological systems not found in nature (König, Frank, Heil, & Coenen, 2013). This has resulted in a huge expansion of the product range of industrial biotechnology to various plant natural products such as steviol glycoside sweeteners (WO/2011/153378, 2011), opioid painkillers (Galanie, Thodey, Trenchard, Interrante, & Smolke, 2015), or the antimalarial drug precursor artemisinic acid (Paddon & Keasling, 2014), but also to platform chemicals like butanediol (Burgard, Burk, Osterhout, Van Dien, & Yim, 2016), propanediol (Nakamura & Whited, 2003), or farnesene (Meadows et al., 2016).
Besides impacting the chemical industry, industrial biotechnology is becoming more and more visible in mainstream consumer products. Adidas, Patagonia, and North Face have all rolled out fermentation based spider silk clothing prototypes soon to be mass produced (Scott, 2017). Lego and Coca-Cola are both aiming to replace their fossil-based plastics with biotechnology derived sustainable alternatives (Lego, n.d.; Virent, n.d.). Even supermarket shelves might soon be reached by industrial biotechnology, with Perfect Day Foods aiming to launch milk produced by engineered yeast in 2018 (Perfect Day, n.d.). With biotechnology now impacting many aspects of human life, the term bioeconomy was born, which the Organization for Economic Co-operation and Development (OECD) defines as the share of the economy delivered by biotechnology (Flores Bueso & Tangney, 2017).
3.1.2 Impact of industrial biotechnology
In 2012, the US biotechnology sector had estimated total revenues of $324 billion, which amounted to over 2% of the gross domestic product. These revenues were further split between three sectors: biologics (drugs) at $91 billion, crops at $128 billion, and industrial products (biofuels, enzymes, biomaterials, and biochemicals) at $105 billion. Over the past decade, the US biotechnology industry has grown with annual growth rates >10%, which was far above the total economy (Carlson, 2016). Deloitte, a financial consulting business, valued the global fermentation based industry at $127 billion in 2013. Ethanol accounted for 94% of the total production volume, while generating 87% of the value. The four next biggest products were lysine, glutamic acid, citric acid, and lactic acid, which accounted for 89% of the higher margin products
(Deloitte, 2014). Synthetic biology applications in industrial biotechnology were projected to grow even more, and their global value of $3.9 billion in 2016 is estimated to reach $11.4 billion by 2021 (Flores Bueso & Tangney, 2017).
Economic growth has been linked to negative environmental impact ever since the industrial revolution. However, industrial biotechnology allows for growth, while at the same time saving water, energy, raw materials, and waste production. It is estimated that the field was already saving emissions of 33 million tons of CO2 in 2011, with a
potential of 1 to 2.5 billion tons by 2030. This would exceed the total reported emissions of Germany in 1990 (OECD, 2011). Table 1 summarizes life cycle analyses of several industrial biotechnology products on market, showing the enormous potential impact on greenhouse gas emission and energy savings compared to petroleum based production.
Table 1. Savings of greenhouse gas emission (GHGE) and energy usage for production by fermentation
versus petrochemical production of various products on market.
Product Company GHGE savings Energy savings Reference
Succinic acid BioAmber 100% 61% (BioAmber, 2013)
1-3-propanediol DuPont Tate & Lyle
56% 42% (DuPont Tate &
Lyle, n.d.) Riboflavin Hoffmann – La Roche 100% 0% (OECD, 2001) Polylactic acid polymer
NatureWorks 30-60% 30-50% (Vink, Davies, & Kolstad, 2010)
Current industrial biotechnology processes mainly use sugars derived from corn, wheat, and sugarcane as raw materials, which are also used as human and animal feedstock. This lead to the so-called food versus biofuel debate (Ajanovic, 2011). A link between rising food prices and decreasing food availability with increasing biofuel production remains questioned (Mohr & Raman, 2013). Recent developments should however resolve this debate. Several full-scale second generation bioethanol plants are now in use, which are able to run on lignocellulosic waste streams from agriculture, such as corn stover or straw, as feedstocks (Jansen et al., 2017).
3.1.3 Industry landscape and recent trends
Many large chemical and food companies like Ajinomoto, Archer Daniels Midland, BASF, Cargill, DowDuPont, Evonik Industries, Kyowa Hakko Kirin, Novozymes, or Royal DSM have a long history of using industrial biotechnology for
production of amino acids, organic acids, biopolymers, vitamins, lipids, or enzymes (Dechema, 2004; Research and Markets, n.d.). With the rise of metabolic engineering in the 1990s and synthetic biology in the 2000s, many new industrial biotechnology companies have been established (Tables 2,3).
Table 2. List of public industrial biotechnology companies. Financial results are extracted from annual
reports 2016. IPO: initial public offering.
Name Location Founded IPO Field Net income/(loss)
Aemetis US 2005 2007 Biofuels (15'636'000)
Amyris US 2003 2010 Specialty chemicals (87'334'000) BioAmber US 2008 2013 Specialty chemicals (28'371'000) Brain AG DE 1993 2016 Enzymes/Organisms (8'700'000) Codexis US 2002 2010 Protein Engineering (8'558'000) Deinove FR 2006 2010 Antibiotics/Nutrition (6'279'000) Evolva CH 2004 2009 Health & nutrition (35'800'000)
Gevo US 2005 2011 Biofuels (37'228'000)
Metabolic Explorer FR 1999 2007 Specialty chemicals 6'623'000 TerraVia US 2003 2011 Health & nutrition (101'556'000)
Figure 1. Market capitalization (in US$) of public industrial biotechnology companies. Generated at
(YCharts, n.d.).
Around 2010, there was a big hype about the first wave of successful companies and several of them became publicly traded (Table 2). Many of them already had first products on the market or were shortly before introducing them. Figure 1 shows the development of the market capitalization of these publicly traded companies. After this initial hype, there was a large drop in valuation for most of them. They were confronted with various problems, ranging from problems in scale-up and large scale production,
delayed launch of key products, higher than expected production costs to slower than promised market penetration of launched products (Cumbers, 2014; Lane, 2016, 2017a, 2017b; Lievense, 2016). Except for Metabolic Explorer, all these public industrial biotechnology companies were still making losses in 2016 (Table 2).
Besides the publicly traded companies, a vibrant ecosystem of well-funded, private industrial biotechnology startup companies has developed (Table 3). In recent years, funding in synthetic biology companies has been growing heavily (Figure 2), and Ginkgo Bioworks was recently declared a “unicorn”, a privately held company valued at over $1 billion (Lee, 2017).
Table 3. List of well-funded private industrial biotechnology companies. Total funding raised by
companies extracted from (Crunchbase, n.d.).
Name Location Founded Funding (US$) Field
Anellotech US 2008 27'250'000 Specialty chemicals
AgriMetis US 2014 30'800'000 Natural crop protection agents
Algenol US 2006 25’000’000 Algae biofuels
Arzeda US 2008 15’200’000 Protein design
Asilomar Bio US 2012 15’250’000 Natural crop protection agents Bolt Threads US 2009 212’999’999 Spider silk
Calysta Energy US 2011 88’000’000 Gas fermentation
DNA Script FR 2014 13’500’000 DNA synthesis
Ecovative US 2007 20’054’293 Performance materials Genomatica US 2000 137’124’621 Strain & process engineering Ginkgo Bioworks US 2008 429’120’000 Organism design
Green Biologics GB 2003 120’110’515 2nd generation feedstocks Greenlight Biosciences US 2008 46’000’000 Cell free production
Inscripta US 2015 23’000’000 Genome editing
LanzaTech US 2005 204’300’000 Gas fermentation
LifeMine Therapeutics US 2016 55’000’000 Eukaryotic microbial drugs Lumen Bioscience US 2017 13’000’000 Spirulina platform
Lygos US 2010 13'120'000 Specialty chemicals
Modern Meadow US 2011 53’500’000 Cultured leather
Myriant US 2005 110'000'000 Specialty chemicals
Provivi US 2013 29'471'105 Natural crop protection agents
Synthace GB 2011 16'277'314 SynBio operating system
Teewinot Life Sciences US 2015 19'300'000 Cannabinoids
Transcriptic US 2012 27'770'000 Automation/Cloud lab Sphere Fluidics GB 2010 15'004'627 Single cell analysis
Spiber JP 2007 148'090'000 Spider silk
Sweetwater Energy US 2006 28'591'612 2nd generation feedstocks Synthetic Genomics US 2005 40'000'001 Organism design
Twist Bioscience US 2013 203'110'714 DNA synthesis
Verdezyne US 2005 86'466'000 High value chemicals
Figure 2. Development of total venture funding raised by synthetic biology companies. From (Schmidt,
n.d.).
These private companies are a good indicator of the recent trends in industrial biotechnology and synthetic biology. Forty years after Sanger sequencing was developed, sequencing costs are continually dropping and read lengths are increasing, driven by companies like Illumina, Pacific Biosciences, or Oxford Nanopore Technologies (Shendure et al., 2017). Besides increasing the amount of sequenced genes and organisms, this allows for novel experimental approaches. Deep sequencing can be used as readout of pooled growth coupled assays (A. M. Smith et al., 2009), flow cytometry experiments (Bonde et al., 2016), or adaptive lab evolution (Lang et al., 2013). Similarly, startup companies like Twist and Gen9 (acquired by Ginkgo Bioworks in 2017 (Ginkgo Bioworks, n.d.-b)) are disrupting the DNA synthesis market and prices have dropped from 1$ to a few cents per base pair in the last decade (Dance, 2016). Therefore, screening thousands of synthesized enzyme variants is now feasible (Ginkgo Bioworks, n.d.-a), and synthesis of the SC2.0 Saccharomyces cerevisiae genome as the first synthetic eukaryotic genome is well underway (Kannan & Gibson, 2017). In order to unleash the full potential of these developments and by taking advantage of novel DNA assembly technologies (Casini, Storch, Baldwin, & Ellis, 2015), companies like Amyris, Ginkgo Bioworks, or Zymergen have created fully automated workflows of DNA assembly, strain construction, and strain characterization. Together with big data and machine learning approaches for understanding and interpreting the results, this allows for a much larger scale of experiments (Ginkgo Bioworks, n.d.-c; Platt, 2015; Zymergen, n.d.). Systems biology technologies also have a large impact on industrial biotechnology applications. As an example, Genomatica has built an integrated
biotechnology platform, incorporating genomics, transcriptomics, proteomics, metabolomics, and fluxomics with genome scale metabolic models for validation and optimization of strains (Barton et al., 2014). Advances in computational methodologies and computational power have also enabled the field of de novo protein design, a technology now being commercialized by Arzeda (Arzeda, n.d.; P.-S. Huang, Boyken, & Baker, 2016). Finally, genome engineering was revolutionized in the last couple of years with the development of MAGE and CRISPR-Cas9. These tools allow multiplexing of genome engineering steps, leading to shorter design-build-test-learn cycles (Bao, Cobb, & Zhao, 2016), as well as making less studied organisms of industrial interest genetically tractable (Donohoue, Barrangou, & May, 2017).
3.2 Plant polyketides
Polyketides are a large class of secondary metabolites found in most plants. They can be further grouped into several subclasses like the chalcones, stilbenes, phloroglucinols, resorcinols, benzophenones, biphenyls, bibenzyls, chromones, acridones, pyrones, and curcuminoids (Abe & Morita, 2010). Polyketides have various functions in plants, such as pigmentation, UV protection, signaling, or plant defense (Lattanzio, Kroon, Quideau, & Treutter, 2008). Their common feature is that a type III polyketide synthase performs the committed step in their biosynthesis. These enzymes act as homodimers and homologs were found in all land plants with available genomic data. They condense various numbers of extender units, most commonly malonyl-CoA, onto an acyl-CoA starter unit to form a linear polyketide, which is then intramolecularly cyclized to form the core polyketide structure (Shimizu, Ogata, & Goto, 2017). Some examples of enzymes, using various starter units and numbers of condensation, are shown in Figure 3. Polyketides are an important part of the human diet. Certain compound families like proanthocyanidins are ubiquitously found in many dietary plants, while others are particularly abundant in certain foods (e.g. dihydrochalcones in apples or isoflavones in soy) (Cheynier, 2012). Various health benefits have been linked with their consumption (K. Pandey & Rizv, 2009). Well researched examples are the metabolic health promoting effects of resveratrol (Schrauwen & Timmers, 2014), the anti-cancer effects of curcumin (Shanmugam et al., 2015), or the health promoting effects of soy isoflavones in post-menopausal women (Messina, 2014). They also find other applications in various industries: anthocyanins are used as natural colorants in
many different applications (Cortez, Luna-Vital, Margulis, & Gonzalez de Mejia, 2017), homoeriodictyol can be used as bitterness masking agent (Ley, Krammer, Reinders, Gatfield, & Bertram, 2005), and resveratrol can be polymerized into a fire-resistant, light, and halogen free composite material (Evolva, 2016).
Figure 3. Type III polyketide synthase reactions catalyzed by various enzymes. ACS, acridone synthase;
BAS, benzalacetone synthase; BBS, bibenzyl synthase; BPS, benzophenone synthase; CHS, chalcone synthase; CUS, curcuminoid synthase; OLS, olivetol synthase; 2PS, 2-pyrone synthase; SPS, styrylpyrone synthase; STS, stilbene synthase; VPS, phlorisovalerophenone synthase. Adapted from (Abe & Morita, 2010)
Since the first report of heterologous naringenin production in E. coli in 2003 (Hwang, Kaneko, Ohnishi, & Horinouchi, 2003), there have been many academic studies on heterologous production of flavonoids, stilbenoids, and curcuminoids using unicellular hosts, particularly E. coli and S. cerevisiae. These efforts have recently been excellently reviewed (Gottardi, Reifenrath, Boles, & Tripp, 2017; R. P. Pandey, Parajuli, Koffas, & Sohng, 2016; Wang, Guleria, Koffas, & Yan, 2016). In contrast,
only one commercial biotechnological process for production of plant polyketides is publicly disclosed: production of the Veri-teTM branded resveratrol by an engineered yeast strain, developed by the Swiss company Evolva (Evolva, n.d.).
3.3 Dihydrochalcones
3.3.1 Introduction to dihydrochalcones
Since phlorizin was identified in apples as the first dihydrochalcone in 1835 (Petersen, 1835), there has been significant interest in this class of compounds, accompanied by scientific research into their potential benefits for humans. While dihydrochalcones have long been thought to be restricted to plants belonging to about 30 plant families (Ninomiya & Koketsu, 2013), they were more recently found in significant amounts in grapes and raspberries, and with the development of novel and more sensitive analytical methods it is becoming obvious that they might be more widespread (Carvalho et al., 2013; Vrhovsek et al., 2012). Apples however remain unique in that they accumulate dihydrochalcones to very high concentrations of up to 14% dry weight in leaves (Gosch, Halbwirth, & Stich, 2010). Although knowledge about the functional role of dihydrochalcones in planta is limited, many of these structures have received attention for other reasons, mostly relating to a variety of human health and food applications (Rozmer & Perjési, 2016). Three of the most prominent examples of active dihydrochalcones described in literature are briefly outlined here. Phlorizin was found to be a hypoglycemic agent, acting by inhibiting SGLT1 and SGLT2, the human glucose transporters involved in intestinal glucose absorption and renal glucose reabsorption (Ehrenkranz, Lewis, Kahn, & Roth, 2005). It was later used as a blueprint for the development of over ten synthetic antidiabetic drugs (Chao, 2014), three of which have been approved by the Food and Drug Administration (FDA) and European Medicines Agency (EMA) (Scheen, 2015). Aspalathin and nothofagin, which are naturally found in rooibos (Aspalathus linearis), exhibit strong antioxidant activity (Snijman et al., 2009) and are absorbed by the human body as intact glycosides due to the metabolic stability of their C-C-glycosidic bond (Breiter et al., 2011). Naringin dihydrochalcone (NDC) and neohesperidin dihydrochalcone, which can be chemically synthesized from citrus flavanones, are sweeteners with one and twenty times the sweetness of saccharin on a molar basis,
respectively (Horowitz & Gentili, 1969). In Europe, neohesperidin dihydrochalcone is approved as the food additive E959 (Janvier, Goscinny, Le Donne, & Van Loco, 2015). Chemically, the dihydrochalcones comprise a 1,3-diphenylpropan-1-one skeleton. They are further functionalized, mainly on the two aromatic rings, by hydroxylation, methylation, prenylation, glycosylation, and/or polymerization. Over 200 structurally different dihydrochalcones have been identified to date (Rozmer & Perjési, 2016).
3.3.2 Biosynthesis of dihydrochalcones
The proposed biosynthesis of dihydrochalcones in plants is shown in Figure 4. The early pathway from phenylalanine to p-coumaroyl-CoA is catalyzed by phenylalanine ammonia lyase (PAL), cinnamate 4-hydroxylase (C4H), and 4-coumarate-CoA ligase (4CL). These steps are shared with the biosynthesis of other polyketides, such as flavonoids or stilbenoids, and have been thoroughly studied and characterized (Gosch, Halbwirth, & Stich, 2010). The action of a double bond reductase (DBR) to form p-dihydrocoumaroyl-CoA from p-coumaroyl-CoA appears to be required to initiate the biosynthesis of dihydrochalcones (Dare, Tomes, Cooney, Greenwood, & Hellens, 2013; Gosch, Halbwirth, Kuhn, Miosic, & Stich, 2009). Three different enzymes from apple (Malus x domestica) have recently been suggested to catalyze this reaction in planta (Dare, Tomes, Cooney, et al., 2013; Ibdah et al., 2014). Phloretin, the first committed dihydrochalcone, is then formed by decarboxylative condensation with three units of malonyl-CoA and a subsequent cyclisation, all catalyzed by chalcone synthase (CHS). CHS was found to be shared between the flavonoid and dihydrochalcone pathways in apple (Gosch et al., 2009). A range of enzymes responsible for further decoration of dihydrochalcones has been identified. Several UDP-dependent-glycosyltransferases (UGTs) from apple, pear, and carnation glycosylate the 2’-hydroxygroup of phloretin to form phlorizin (Gosch, Halbwirth, Schneider, Hölscher, & Stich, 2010; Jugdé, Nguy, Moller, Cooney, & Atkinson, 2008; Werner & Morgan, 2009), two UGTs from rice and buckwheat C-glycosylate the 3’-position of phloretin to form nothofagin (Brazier-Hicks et al., 2009; Ito, Fujimoto, Shimosaka, & Taguchi, 2014), MdPh-4’-OGT from Malus x domestica glycosylates the 4’- hydroxygroup of phloretin to form trilobatin (Yahyaa et al., 2016), and chalcone 3-hydroxylase (CH3H) from Cosmos sulphureus hydroxylates phloretin to form 3-hydroxyphloretin in yeast and in plants (Hutabarat et al., 2016) (Figure 4B).
Figure 4. (A) The biosynthetic pathway to the first committed dihydrochalcone (phloretin), flavonoid
(naringenin), and stilbenoid (resveratrol) from phenylalanine and malonyl-CoA is shown. (B) Depicted are proposed biosynthetic routes to several hydroxylated, glycosylated, and methylated dihydrochalcone derivatives. CHI, chalcone isomerase; CHS, chalcone synthase; CPR, cytochrome P450 reductase; CYP, cytochrome P450; C4H, cinnamate 4-hydroxylase; DBR, double bond reductase; OMT, O-methyltransferase; PAL, phenylalanine ammonia lyase; STS, stilbene synthase; UGT, UDP-dependent-glycosyltransferase; 4CL, 4-coumarate-CoA ligase.
3.3.3 Metabolic engineering of microorganisms for production of
dihydrochalcones
Metabolic engineering of dihydrochalcones in microorganisms has been the subject of only three studies. Two of these studies (Watts, Lee, & Schmidt-Dannert, 2004; Werner, Chen, Jiang, & Morgan, 2010) expressed 4CL and CHS enzymes in E. coli and S. cerevisiae, respectively, and produced phloretin by feeding phloretic acid. This strategy circumvents the critical DBR step needed to generate the starter molecule for dihydrochalcone biosynthesis. In another study, a CHI and an enoate reductase from Eubacterium ramulus was expressed in E. coli and the compounds phloretin, 3-hydroxyphloretin, and homoeriodictyol dihydrochalcone were produced by feeding
O O H O O H OH O CoA-S OH HO O OH O OH O CoA-S OH OH O H OH O OH C4H/CPR 4CL DBR CHS CHI STS CHS Cinnamic acid p-Coumaric acid p-Coumaroyl-CoA Naringenin Phloretin p-Dihydrocoumaroyl-CoA + 3 Malonyl-CoA + 3 Malonyl -CoA NH2 O O H Phenylalanine OH OH O H Resveratrol OH O H OH O OH Glc OH Rha-(1,2)-Glc-O OH O O-CH3 OH OH O H O-Glc O OH OH OH O H OH O OH OH OH O H OH O OH Glc OH UGT CYP/CPR UGT UGT UGT Nothofagin Phloretin
3-Hydroxyphloretin Neohesperidin dihydrochalcone
3-Hydroxyphlorizin Aspalathin OH Glc-O OH O OH Trilobatin UGT OH O H O-Glc O OH Phlorizin OH O H OH O OH OH Rha-(1,2)-Glc-O OH O OH Naringin dihydrochalcone UGT A B OMT UGT UGT PAL β α 2' 3' 4' 5' 1 2 3 4 5 6 6' 8 3 4 5 6 1' 2' 3' 4' 5' 6' 1 2 7 1' 5 6 7 8 1' 2' 3' 4' 5' 6' 1 4 3 2 + 3 Malonyl -CoA ??? O O H OH Phloretic acid
naringenin, eriodictyol, and homoeriodictyol, respectively (Gall et al., 2014). However, besides the high cost of these precursors, this strategy additionally required anaerobic cultivation to achieve sufficient enzymatic activity.
3.4 Anthocyanins
3.4.1 Introduction to anthocyanins
Anthocyanins, together with other flavonoids, belong to a large group of diverse secondary metabolites found in almost the entire plant kingdom. They are probably best known for the colors they confer to plant tissues, in particular the red, orange, purple, and blue colors of flower petals, fruits, and leaves. While attraction of pollinators is the most obvious function of anthocyanins in planta, they have also been linked to shielding of abiotic stresses (UV-B radiation, temperature variation, and mineral stress) and to active defensive roles against pathogens, insects, and herbivores (Andersen & Jordheim, 2010).
From a human perspective, anthocyanins have found applications as colorants in the food and beverage industry, and the demand for such natural colors are expected to increase (Cortez et al., 2017). In addition, it has become clear that anthocyanins may have benefits in human health. Numerous studies are currently being conducted to elucidate their potential health promoting effects, ranging from antioxidant activity, cardiovascular protection, neuroprotection, vision improvement, antidiabetic properties, anti-inflammatory effects, cancer protection to antimicrobial activity (Pojer, Mattivi, Johnson, & Stockley, 2013).
Although derived from the same biosynthetic plant pathway the anthocyanins are a quite diverse class of compounds, with complex patterns of glycosylation and acylation. To date, 644 different structure elucidated anthocyanins have been isolated from various plants (Andersen & Jordheim, 2010).
3.4.2 Biosynthesis of anthocyanins
The biosynthesis of anthocyanins in plants proceeds via the general flavonoid pathway (Figure 5).
Figure 5. (A) Pathway from phenylalanine and malonyl-CoA to naringenin. (B) Linear pathway from
naringenin to anthocyanins, as well as the deviation via trans-flavan-3-ols, which was successfully incorporated in E. coli, and the flavonol by-products derived from ANS side activities. Names of compounds with different hydroxylation patterns can be found in Table 4. ANS: anthocyanidin synthase; ANR: anthocyanidin reductase; A3GT: anthocyanidin 3-O-glycosyl transferase; CHI: chalcone isomerase; CHS: chalcone synthase; C4H: cinnamate 4-hydroxylase; CPR: cytochrome P450 reductase; DFR: dihydroflavonol-4-reductase; F3H: flavanone 3-hydroxylase; F3’H: flavonoid-3’-hydroxylase; F3’5’H: flavonoid-3’,5’-hydroxylase; LAR: leucoanthocyanidin reductase; PAL: phenylalanine ammonia lyase; 4CL: 4-coumarate-CoA ligase
O O H O O H OH O CoA-S OH C4H/CPR 4CL CHS Cinnamic acid p-Coumaric acid p-Coumaroyl-CoA Naringenin chalcone + 3 Malonyl-CoA NH2 O O H Phenylalanine A B PAL OH O H OH O OH CHI Naringenin DFR ANS A3GT Dihydroflavonol Leucoanthocyanidin Anthocyanidin Anthocyanin Naringenin a) F3H b) F3H, F3'H c) F3H, F3'5'H Flavonol Flavonol-3-O-glucoside A3GT trans-Flavan-3-ol O O H OH O OH O O H OH O OH O O H OH O OH R2 OH R1 O O H OH OH OH R2 OH R1 O+ O H OH OH R2 OH R1 O+ O H OH OH R2 OGlc R1 O O H OH O OH R2 OH R1 O O H OH OH R2 OGlc O R1 O O H OH OH R2 OH R1 ANS LAR ANS ANS cis-Flavan-3-ol O O H OH OH R2 OH R1 ANR
Like for dihydrochalcones, the activated phenylpropanoic acid p-coumaroyl-CoA is produced from the aromatic amino acid phenylalanine by a sequence of three enzymes: phenylalanine ammonia lyase (PAL), cinnamate hydroxylase (C4H), and 4-coumarate-CoA ligase (4CL). Chalcone synthase (CHS) condenses p-coumaroyl-CoA with three malonyl-CoA extender units and cyclizes the molecule to form naringenin chalcone, which is then isomerized to naringenin by chalcone isomerase (CHI). Flavanone hydroxylase (F3H) catalyzes the hydroxylation of naringenin at the 3-position to yield dihydrokaempferol, a dihydroflavonol. F3H belongs to the 2-oxoglutarate-dependent dioxygenase (2ODD) family. Naringenin and dihydrokaempferol can be hydroxylated by the cytochrome P450 (CYP) enzymes flavonoid-3’-hydroxylase (F3’H) or flavonoid-3’,5’-hydroxylase (F3’5’H) to form eriodictyol and 5,7,3’,4’,5’-pentahydroxyflavanone, or dihydroquercetin and dihydromyricetin, respectively. Presence of these two enzymes determines the hydroxylation pattern of the p-coumaroyl-CoA derived B ring of both flavonoids and anthocyanins.
Table 4. Names and abbreviations of compound classes and compounds in the pathway from naringenin
to the three main anthocyanins.
Compound class R1=R2=H R1=OH, R2=H R1=R2=OH Flavanone Naringenin Eriodictyol
5,7,3’,4’,5’-Penta-hydroxyflavanone Dihydroflavonol Dihydrokaempferol Dihydroquercetin Dihydromyricetin Flavonol Kaempferol Quercetin Myricetin
Flavonol-3-O-glucoside Kaempferol-3-O-glucoside Quercetin-3-O-glucoside Myricetin-3-O-glucoside Leucoanthocyanidin Leucopelargonidin Leucocyanidin Leucodelphinidin Anthocyanidin Pelargonidin Cyanidin Delphinidin Anthocyanin Pelargonidin-3-O-glucoside Cyanidin-3-O-glucoside Delphinidin-3-O-glucoside trans-Flavan-3-ol Afzelechin Catechin Gallocatechin cis-Flavan-3-ol Epiafzelechin Epicatechin Epigallocatechin
Dihydroflavonol-4-reductase (DFR) then catalyzes the reduction of dihydroflavonols to the corresponding leucoanthocyanidins, which are subsequently oxidized to the corresponding anthocyanidins by anthocyanidin synthase (ANS, also called leucoanthocyanidin dioxygenase (LDOX)), also belonging to the 2ODD family.
This step has been problematic both in vitro and in E. coli, where ANS converts leucoanthocyanidins primarily into flavonols instead of anthocyanidins, probably due to a second oxidation by ANS (Turnbull et al., 2003; Yan, Li, & Koffas, 2008). Both leucoanthocyanidin and anthocyanidin are relatively unstable intermediates, and in order to form the more stable anthocyanins, anthocyanidins are 3-O-glucosylated by the action of a UDP-glucose dependent anthocyanidin 3-O-glycosyl transferase (A3GT) (Tanaka, Sasaki, & Ohmiya, 2008).
The three basic anthocyanins, pelargonidin-3-O-glucoside, cyanidin-3-O-glucoside, and delphinidin-3-O-glucoside differ by the number of hydroxyl-groups on the B-ring. These hydroxyl-groups are in some cases further O-methylated to yield peonidin, petunidin, malvidin, and other less commonly found structures (Davies, 2009). Further modifications include glycosylation at one or more hydroxyl-groups and in some cases further glycosylation and/or acylation of these sugars (Sasaki, Nishizaki, Ozeki, & Miyahara, 2014; Tanaka et al., 2008). The most commonly found sugar moieties are glucose, rhamnose, galactose, xylose, arabinose, and glucuronic acid. Common acyl groups include the dicarboxylic acid malonic acid, various hydroxycinnamic acids (p-coumaric-, caffeic-, ferulic-, sinapic-, and 3,5-dihydrocinnamic acids), as well as hydroxybenzoic acids (p-hydroxybenzoic- and gallic acids) (Andersen & Jordheim, 2010). Enzymes catalyzing many of these decoration reactions have been discovered (Yonekura-Sakakibara, Nakayama, Yamazaki, & Saito, 2009).
3.4.3 Transport of anthocyanins
In plants, anthocyanins usually accumulate in the vacuole. Both the vacuolar pH and the presence of co-pigments play a role in stability and color of the anthocyanins (Passeri, Koes, & Quattrocchio, 2016; J. Zhao & Dixon, 2010). In various plants, transporters belonging to the ABC or MATE families were suggested to be responsible for this accumulation. ABC transporters use the energy of ATP hydrolysis and seem to be dependent on co-transport of glutathione, while MATE transporters use a proton gradient as driving force (Francisco et al., 2013; Marinova et al., 2007; J. Zhao, 2015; J. Zhao & Dixon, 2010). By binding to anthocyanins, glutathione-S-transferases (GSTs) were suggested as carrier proteins, which present anthocyanins to the transporters (Mueller, Goodman, Silady, & Walbot, 2000; Sun, Li, & Huang, 2012). Plants mutated in transporters or GSTs were shown to accumulate only a fraction of the anthocyanins compared to the wild type, and therefore vacuolar transport of anthocyanins is thought
to be essential for their production in plants (Alfenito et al., 1998; Goodman, Casati, & Walbot, 2004; Kitamura, Oono, & Narumi, 2016; Kitamura, Shikazono, & Tanaka, 2004; Sun et al., 2012; Yamazaki et al., 2008). However, it is still a matter of debate how these different transport systems may interact and complement each other (J. Zhao, 2015).
3.4.4 Metabolic engineering of microorganisms for production of anthocyanins A series of studies investigated conversion of flavonoid precursors to several glycosylated, methylated, and acylated anthocyanins by engineered E. coli. These efforts have recently been reviewed (Zha & Koffas, 2017). Selection of optimal enzymes, as well as optimization of cofactors, culturing conditions, and expression conditions has resulted in cyanidin-3-O-glucoside production from flavan-3-ol precursors of up to 350 mg/l of, while production from flavanones never exceeded 2.07 mg/l (Chemler & Koffas, 2008; Cress et al., 2017; C. G. Lim et al., 2015; Yan, Chemler, Huang, Martens, & Koffas, 2005; Yan et al., 2008; Zha & Koffas, 2017). More recently, production of up to 9.5 mg/l pelargonidin-3-O-glucoside from glucose was shown by a synthetic polyculture approach of four engineered E. coli strains, each optimized for expression of a module of the complete pathway (Jones et al., 2017).
3.5 Scope of the thesis
This thesis aimed at extending the range of plant polyketides attainable by metabolic engineering of the yeast S. cerevisiae with a focus on two compound classes. The dihydrochalcones contain several commercially relevant compounds with sweet, antidiabetic, or antioxidant properties. The anthocyanins are already in use as natural colorants in the food and beverage industries. Proof of concepts for de novo biosynthesis of compounds within these two classes should highlight the potential of yeast as cell factory for polyketides. Therefore, this thesis should lay the foundation and point towards the next steps required for the development of a more sustainable production process of these compounds.
4 Materials and Methods
4.1 Chemicals
Unless stated otherwise, chemicals were purchased from Sigma-Aldrich (St. Louis, Missouri, USA). Authentic standards of cyanidin, 3-O-glucoside, cyanidin-3,5-O-diglucoside, delphinidin, delphinidin-3-O-glucoside, delphinidin-3,5-O-diglucoside, myricetin-3-O-glucoside, pelargonidin, pelargonidin-3-O-glucoside, pelargonidin-3,5-O-diglucoside, phloretin, and trilobatin were purchased from Extrasynthese (Genay, France). Authentic standards of 3-hydroxyphloretin and dihydrokaempferol were purchased from PlantMetaChem (Giessen, Germany). Authentic standards of gallocatechin and pinocembrin dihydrochalcone were purchased from Toronto Research Chemicals (North York, Canada) and AnalytiCon (Potsdam, Germany), respectively. Nothofagin and afzelechin were kindly provided by Dr. Alexander Gutmann (Graz University, Austria) and Dr. Stefan Martens (Fondazione Edmund Mach, San Michele all’Adige, Italy), respectively.
4.2 Plasmids and enzymes
E. coli XL10 Gold (Agilent, Santa Clara, California, USA) cells were used for subcloning of genes. Table 5 shows all genes used in this study, as well as the vector backbones they were cloned into. Coding sequences for selected enzymes were cloned into expression cassettes of plasmids pEVE2176 to pEVE2181 for assembly by in vivo homologous recombination (see 4.4) or into yeast expression plasmids pEVE2157, pEVE2159, and pEVE2164, which are based on the pRS series of shuttle plasmids (Sikorski & Hieter, 1989). Generally, restriction enzyme and ligation based cloning with HindIII HF, SacII, and T4 DNA ligase (all NEB, Ipswich, Massachusetts, USA) according to standard protocols was used for plasmid construction (Green & Sambrook, 2012). Genes containing internal HindIII or SacII sites were cloned by In-Fusion (Takara, Kyoto, Japan) according to the manufacturer’s instructions. E. coli was grown in LB medium prepared with 25 g/l of LB broth (Miller) and supplemented with 100 µg/l ampicillin for amplification of plasmids.
S. cerevisiae codon optimized genes were manufactured by GeneArt (ThermoFisher, Waltham, Massachusetts, USA), except genes in pDHC25 and pDHC26, which were obtained by site directed mutagenesis of pDHC24 using overlap extension PCR with primers DHPR1 to DHPR10 (Table 6) according to a standard protocol (Heckman & Pease, 2007). During synthesis or PCR, all genes were provided at the 5’ end with an AAGCTTAAA DNA sequence comprising a HindIII site and a Kozak sequence and at the 3’ end a GGCGCC DNA sequence comprising a SacII restriction site.
Table 5. List of genes used in this work and plasmid backbones into which they were cloned. Plasmid
name
Gene Backbone Codon optimized
Organism NCBI protein accession number
pDHC1 AtPAL2 pEVE2179 yes Arabidopsis thaliana NP_190894.1 pDHC2 AmC4H pEVE2180 yes Ammi majus AAO62904.1 pDHC3 ScCPR1 pEVE2181 no S. cerevisiae NP_011908.1 pDHC4 At4CL2 pEVE2178 no A. thaliana NP_188761.1 pDHC5 HaCHS pEVE2176 yes Hypericum androsaemum AAG30295.1 pDHC6 ScDFG10 pEVE2177 no S. cerevisiae NP_012215.1 pDHC7 ScTSC13 pEVE2177 no S. cerevisiae NP_010269.1 pDHC8 KlTSC13 pEVE2177 yes Kluyveromyces lactis XP_452392.1 pDHC9 AtECR pEVE2177 yes A. thaliana NP_191096.1 pDHC10 GhECR2 pEVE2177 yes Gossypium hirsutum NP_001314306.1 pDHC11 MdECR pEVE2177 yes M. x domestica XP_008382818.1 pDHC12 MdENRL3 pEVE2177 yes M. x domestica NP_001280847.1 pDHC13 MdENRL5 pEVE2177 yes M. x domestica NP_001281005.1 pDHC14 MdHCDBR pEVE2177 yes M. x domestica XP_008367739.1 pDHC15 ErERED pEVE2177 yes Eubacterium ramulus AGS82961.1 pDHC16 RiZS1 pEVE2177 yes Rubus idaeus AEL78825.1 pDHC17 PcCHS pEVE2176 yes Petroselinum crispum CAA24779.1 pDHC18 PhCHS pEVE2176 yes Petunia x hybrida CAA32731.1 pDHC19 HvCHS1 pEVE2176 yes Hordeum vulgare CAA41250.1 pDHC20 HvCHS2 pEVE2176 yes H. vulgare CAA70435.1 pDHC21 SbCHS pEVE2176 yes Scutellaria baicalensis BAB03471.1 pDHC22 MdCHS1 pEVE2176 no M. x domestica NP_001306186.1 pDHC23 MdCHS2 pEVE2176 no M. x domestica NP_001306181.1 pDHC24 MdUGT88F1 pEVE2176 yes M. x domestica ACZ44840.1 pDHC25 MdUGT88A1 pEVE2176 yes M. x domestica ABY73540.1 pDHC26 PcUGT88F2 pEVE2176 yes Pyrus communis ACZ44838.1 pDHC27 DcGT4 pEVE2176 yes Dianthus caryophyllus BAD52006.1 pDHC28 OsCGT pEVE2176 yes Oryza sativa subsp. jap. ABC94602.1 pDHC29 AtUGT73B2 pEVE2178 yes A. thaliana NP_567954.1 pDHC30 AtUGT76D1 pEVE2178 no A. thaliana NP_180216.1 pDHC31 AtUGT84B1 pEVE2178 no A. thaliana NP_179907.1 pDHC32 Cm1,2RHAT pEVE2179 yes Citrus maxima AAL06646.2 pDHC33 AtRHM2 pEVE2180 no A. thaliana NP_564633.2 pDHC34 OsF3'H pEVE2177 yes O. sativa subsp. jap. XP_015613041.1 pDHC35 PhF3'H pEVE2177 yes P. x hybrida AAD56282.1
pDHC36 PfF3'H pEVE2177 yes Perilla frutescens BAB59005.1 pDHC37 AcF3'H pEVE2177 yes Allium cepa AAS48419.1 pDHC38 MdF3'H1 pEVE2177 no M. x domestica ACR14867.1 pDHC39 MdF3'H2 pEVE2177 no M. x domestica XP_008374610.1 pDHC40 CsCH3H pEVE2177 yes C. sulphureus ACO35755.1 pDHC41 AtATR1 pEVE2178 yes A. thaliana NP_194183.1 pDHC42 CaER pEVE2177 yes Clostridium acetobutylicum WP_010966642.1 pANT1 MsCHI pEVE2177 yes Medicago sativa AAB41524.1 pANT2 VvF3'H pEVE2177 yes Vitis vinifera CAI54278.1 pANT3 PhF3'H pEVE2177 yes P. x hybrida AAD56282.1 pANT4 OsF3'H pEVE2177 yes O. sativa subsp. jap. AEK31169.1 pANT5 CrF3'5'H pEVE2177 yes Catharanthus roseus CAA09850.1 pANT6 PhF3'5'H pEVE2177 yes P. x hybrida CAA80266.1 pANT7 OhF3'5'H pEVE2177 yes Osteospermum hybrid cul ABB43031.1 pANT8 SlF3'5'H pEVE2177 yes Solanum lycopersicum ACF32346.1 pANT9 CiF3'5'H pEVE2177 yes Cichorium intybus AGO03825.1 pANT10 AtCPR1 pEVE2178 yes A. thaliana CAA46814.1 pANT11 FaF3H pEVE2178 yes Fragaria x ananassa AAU04791.1 pANT12 MdF3H pEVE2178 yes M. x domestica CAA49353.1 pANT13 NtF3H pEVE2178 yes Nicotiana tabacum BAF96938.1 pANT14 AtDFR pEVE2179 yes A. thaliana AAA32783.1 pANT15 AaDFR pEVE2179 yes Anthurium andraeanum AAP20866.1 pANT16 PtDFR pEVE2179 yes Populus trichocarpa EEE80032.1 pANT17 IhDFR pEVE2179 yes Iris hollandica BAF93856.1 pANT18 MdDFR pEVE2179 no M. x domestica AAD26204.1 pANT19 VvLAR pEVE2180 yes V. vinifera CAI26310.1 pANT20 InANS pEVE2176 yes Ipomoea nil BAB71806.1 pANT21 GhANS pEVE2176 yes Gerbera x hybrida AAY15743.2 pANT22 MdANS pEVE2176 yes M. x domestica BAB92998.1 pANT23 PhANS pEVE2176 yes P. x hybrida P51092.1 pANT24 FaANS pEVE2176 yes F. x ananassa AAU12368.1 pANT25 PcANS pEVE2176 yes P. communis ABB70119.1 pANT26 IbANS pEVE2176 yes Ipomoea batatas ADE08370.1 pANT27 StANS pEVE2176 yes Solanum tuberosum AEJ90548.1 pANT28 MsANS pEVE2176 yes Magnolia sprengeri AHU88620.1 pANT29 GbANS pEVE2176 yes Ginkgo biloba ACC66092.1
pANT30 ZmANS pEVE2176 yes Zea mays CAA39022.1
pANT31 AtANS pEVE2176 yes A. thaliana AAB09572.1 pANT32 OsANS pEVE2176 yes O. sativa subsp. indica CAA69252
pANT33 AcANS pEVE2176 yes A. cepa ABM66367.1
pANT34 OsA3GT pEVE2164 yes O. sativa subsp. jap. BAB68093.1 pANT35 GtA3GT-1 pEVE2164 yes Gentiana triflora BAC54092.1 pANT36 PhA3GT pEVE2164 yes P. x hybrida BAA89008.1 pANT37 AtA3GT pEVE2164 yes A. thaliana CAC01718.1 pANT38 FaA3GT-1 pEVE2164 yes F. x ananassa AAU09442.1 pANT39 VvA3GT pEVE2164 yes V. vinifera AAB81682.1 pANT40 FaA3GT-2 pEVE2164 yes F. x ananassa AAU12366.1 pANT41 DcA3GT pEVE2164 yes D. caryophyllus BAD52003.1 pANT42 GtA3GT-2 pEVE2164 yes G. triflora BAA12737.1 pANT43 FaA3GT-2 pEVE2177 yes F. x ananassa AAU12366.1 pANT44 DcA3GT pEVE2177 yes D. caryophyllus BAD52003.1
pGST2 PhAN9 pEVE2157 yes P. x hybrida CAA68993 pGST3 AtTT19 pEVE2157 yes A. thaliana NP_197224 pGST4 AtTT19-3 pEVE2157 yes A. thaliana BAD89984.1
pGST5 AtTT19-4 pEVE2157 yes A. thaliana NP_197224 (W205L) pGST6 VvGST1 pEVE2157 yes V. vinifera AAN85826.1 pGST7 VvGST2 pEVE2157 yes V. vinifera ABK81651.1 pGST8 VvGST3 pEVE2157 yes V. vinifera ABO64930.1 pGST9 VvGST4 pEVE2157 yes V. vinifera AAX81329 pGST10 VvGST5 pEVE2157 yes V. vinifera ABL84692.1 pGST11 PfGST1 pEVE2157 yes P. fructescens BAG14300 pGST12 CsGST3 pEVE2157 yes Cyclamen spp BAM14584 pGST13 TaGSTL1 pEVE2157 yes Triticum aestivum CAA76758.1 pGST14 AtTT12 pEVE2159 yes A. thaliana NP_191462 pGST15 SlMTP77 pEVE2159 yes S. lycopersicum AAQ55183 pGST16 VvAM1 pEVE2159 yes V. vinifera ACN88706 pGST17 VvAM3 pEVE2159 yes V. vinifera ACN91542 pGST18 MtMATE1 pEVE2159 yes Medicago truncatula ADV04045 pGST19 BnTT12-1 pEVE2159 yes Brassica napus ACJ36209 pGST20 MdMATE1 pEVE2159 yes M. x domestica ADO22710 pGST21 MdMATE2 pEVE2159 yes M. x domestica ADO22712 pGST22 VvMATE1 pEVE2159 yes V. vinifera XP_002282932 pGST23 VvMATE2 pEVE2159 yes V. vinifera XP_002282907 pGST24 GaTT12a pEVE2159 yes Gossypium arboretum AGC55236
pGST25 ZmMRP3 pEVE2159 yes Z. mays AAT37905
pGST26 VvABCC1 pEVE2159 yes V. vinifera AGC23330 pGST27 DvA3GMAT pEVE2176 yes Dahlia variabilis AAO12206 pGST28 VaA5GT pEVE2180 yes Vitis amurensis AHL68667.1 pGST29 NsA3GRT pEVE2178 yes Nierenbergia ssp. BAC10994.1 pGST30 CtA3G3'5'GT pEVE2179 yes Clitoria ternatea BAF49289
Genes in pDHC3, pDHC6, and pDHC7 were amplified by PCR (Q5 DNA polymerase, New England Biolabs) with primers DHPR11 to DHPR16 (Table 6) from a colony of S. cerevisiae S288C after lysis in 30 µl 0.2% SDS at 95°C for 5 minutes and clarification at 14000g for 5 minutes. For the genes in pDHC6 and pDHC7, restriction sites and Kozak sequence, as described above, were added during PCR. ScCPR1 in pDHC3 was initially cloned with SpeI and XhoI, because it contained an internal SacII site. This site was then removed with a silent mutation (c519t) introduced by inverse PCR using primers DHPR17 and DHPR18 according to standard protocols (Green & Sambrook, 2012). For genes in pDHC4, pDHC22, pDHC23, pDHC30, pDHC31, pDHC33, pDHC38, pDHC39, and pANT18, RNA was extracted from A. thaliana leaves or M. x domestica var. Golden Delicious apple peel with the RNeasy kit (Qiagen, Venlo, Netherlands) according to the manufacturer’s instructions. First strand cDNA was synthesized with the Mint-2 cDNA synthesis kit (Evrogen, Moscow, Russia) and genes were amplified by PCR (Q5 DNA polymerase) with primers DHPR19 to DHPR34 or
AcnPR1 to AcnPR6 (Table 6). For genes in pDHC4, pDHC22, pDHC23, pDHC30, pDHC31, pDHC33, pDHC38, and pDHC39, during PCR, an AAA Kozak sequence was added to the 5’ end of the gene and 15 base pairs with homology to the plasmid backbone were added at the 5’ and 3’ end of the gene for cloning by In-Fusion into plasmid backbones linearized with HindIII and SacII. For MdDFR in pANT18, an overlap exchange PCR strategy using standard protocols (Heckman & Pease, 2007) was used to remove two internal HindIII sites of MdDFR with silent point mutations using primers AcnPR1 to AcnPR6, before cloning the open reading frame with HindIII and SacII (Table 6).
Table 6. List of primers used in this study. Primer
name
Sequence Description
DHPR1 ACAAAAAGCTTAAAATGGGTGATG TCATTG
Forward primer for restriction enzyme based cloning of MdUGT88A1 and PcUGT88F2 DHPR2 AGCTACCGCGGTCAGGTAATGG Reverse primer for restriction enzyme based
cloning of MdUGT88A1 and PcUGT88F2 DHPR3 AGCAGCACCAGAAGTACAGAAGTA
GTAGGTTGG
Reverse primer for site directed mutagenesis by overlap extension PCR of MdUGT88F1 to MdUGT88A1 (R139C)
DHPR4 CCAACCTACTACTTCTGTACTTCTG GTGCTGCT
Forward primer for site directed mutagenesis by overlap extension PCR of MdUGT88F1 to MdUGT88A1 (R139C)
DHPR5 ACCCAATTCAACCATAGCAACTAT ATGACCCAT
Reverse primer for site directed mutagenesis by overlap extension PCR of MdUGT88F1 to PcUGT88F2 (S18A)
DHPR6 ATGGGTCATATAGTTGCTATGGTTG AATTGGGT
Forward primer for site directed mutagenesis by overlap extension PCR of MdUGT88F1 to PcUGT88F2 (S18A)
DHPR7 AGAAAGCAGCCAAAACAGCAGCAC
CAGAAGTATGGAAGTAGTAGGTT
Reverse primer for site directed mutagenesis by overlap extension PCR of MdUGT88F1 to PcUGT88F2 (R139H/I145V)
DHPR8 AACCTACTACTTCCATACTTCTGGT GCTGCTGTTTTGGCTGCTTTCT
Forward primer for site directed mutagenesis by overlap extension PCR of MdUGT88F1 to PcUGT88F2 (R139H/I145V)
DHPR9 CATCTTTCTCTCAAAGCTCTACCAC CTTCG
Reverse primer for site directed mutagenesis by overlap extension PCR of MdUGT88F1 to PcUGT88F2 (V449A)
DHPR10 CCGAAGGTGGTAGAGCTTTGAGAG AAAGATG
Forward primer for site directed mutagenesis by overlap extension PCR of MdUGT88F1 to PcUGT88F2 (V449A)
DHPR11 TACTAAGCTTACTAGTAAAATGCCG TTTGGAATAGACA
Forward primer for restriction enzyme based cloning of ScCPR1
DHPR12 TCTCGAGTTTAAACCGCGGTTACCA GACATCTTCTTGGTA
Reverse primer for restriction enzyme based cloning of ScCPR1
TGAAGAACAATTGC cloning of ScDFG10 DHPR14 ACGTACCGCGGCTAGATTATAAAA
GGTATTATGGCGTAG
Reverse primer for restriction enzyme based cloning of ScDFG10
DHPR15 ACGTAAAGCTTAAAATGCCTATCA CCATAAAAAGC
Forward primer for restriction enzyme based cloning of ScTSC13
DHPR16 ACGTACCGCGGTCAAAATACAAAT GGAATCAAGAATG
Reverse primer for restriction enzyme based cloning of ScTSC13
DHPR17 P* CCCGCAGCGGAGAGATG Forward primer for site directed mutagenesis by inverse PCR of ScCPR1 (c519t)
DHPR18 CGCTATCAGACTAGGCAAGCTC Reverse primer for site directed mutagenesis by inverse PCR of ScCPR1 (c519t)
DHPR19 TAATTACAAAAAGCTAAAATGACG ACACAAGATGTG
Forward primer for In-Fusion cloning of At4CL2
DHPR20 AGTTAAAAGCACTCCCTAGTTCATT AATCCATTTGCTAG
Reverse primer for In-Fusion cloning of At4CL2
DHPR21 AACAAACAAAAAGCTAAAATGGTT ACAGTCGAGGAAG
Forward primer for In-Fusion cloning of MdCHS1
DHPR22 GCCGTCGGACGTGCCTCAAGCCGTT AAACCCAC
Reverse primer for In-Fusion cloning of MdCHS1
DHPR23 AACAAACAAAAAGCTAAAATGGTG ACCGTCGAAG
Forward primer for In-Fusion cloning of MdCHS2
DHPR24 GCCGTCGGACGTGCCTCAAGCACC CACACTG
Reverse primer for In-Fusion cloning of MdCHS2
DHPR25 TAATTACAAAAAGCTTAAAATGGC
AGAGATTCGCC Forward primer for In-Fusion cloning of AtUGT76D1 DHPR26 AGTTAAAAGCACTCCGCGGTCATT
GTTCGTCAATTTGCATC
Reverse primer for In-Fusion cloning of AtUGT76D1
DHPR27 TAATTACAAAAAGCTAAAATGGGC AGTAGTGAGG
Forward primer for In-Fusion cloning of AtUGT73B2
DHPR28 AGTTAAAAGCACTCCTTAGGCGATT GTGATATCACTAATGAAC
Reverse primer for In-Fusion cloning of AtUGT73B2
DHPR29 TTAACTAAACAAGCTAAAATGGAT GATACTACGTATAAGCCAAAGAAC
Forward primer for In-Fusion cloning of AtRHM2
DHPR30 AAGAGCGATTTGTCCTTAGGTTCTC TTGTTTGGTTCAAAGACG
Reverse primer for In-Fusion cloning of AtRHM2
DHPR31 ATATAAAACAAAGCTAAAATGTTT
GTTCTCATAGTCTTCACC Forward primer for In-Fusion cloning of MdF3'H1 DHPR32 AGACATAAGAGATCCTCAAGATGA
TGATGCATTGTATGC
Reverse primer for In-Fusion cloning of MdF3'H1
DHPR33 ATATAAAACAAAGCTAAAATGTTT GTTCTCATATTCTTCACCG
Forward primer for In-Fusion cloning of MdF3'H2
DHPR34 AGACATAAGAGATCCTCAAGGTGA TGACGCATTATATG
Reverse primer for In-Fusion cloning of MdF3'H2
AcnPR1 ACGTAAAGCTTAAAATGGATCCGA GTCCGAATCCG
Forward primer for restriction enzyme based cloning of MdDFR
AcnPR2 AACAGTTCGAAAGCTAGTGTTCAC ATCCTCA
Reverse primer for restriction enzyme based cloning of MdDFR
AcnPR3 TATGGCTTCATCAAAACTTCCCTCA TCCGCC
Reverse primer for site directed mutagenesis by overlap extension PCR of MdDFR (c210t) AcnPR4 GGCGGATGAGGGAAGTTTTGATGA
AGCCATA
Forward primer for site directed mutagenesis by overlap extension PCR of MdDFR (c210t) AcnPR5 TGAGGATGTGAACACTAGCTTTCG
AACTGTT
Reverse primer for site directed mutagenesis by overlap extension PCR of MdDFR (t369a) AcnPR6 AACAGTTCGAAAGCTAGTGTTCAC
ATCCTCA
Forward primer for site directed mutagenesis by overlap extension PCR of MdDFR (t369a)
4.3 Yeast strains
S. cerevisiae strain BG (MATα hoΔ0 his3Δ0 leu2Δ0 ura3Δ0 cat5Δ0::CAT5(I91M) mip1Δ0::MIP1(A661T) gal2Δ0::GAL2 sal1Δ0::SAL1), which is a derivative of the S288C strain NCYC 3608 (NCYC, Norwich, United Kingdom), was used for all experiments in this work. The strain had been further modified in our labs. Briefly, the LEU2 and HIS3 open reading frames were deleted to create two additional auxotrophies for leucine and histidine, respectively. The KanMX cassette was excised by Cre-Lox recombination. The non-functional gal2 gene was replaced with a functional allele from S. cerevisiae SK1 strain NCYC 3615 (NCYC) and the sal1, mip1, and cat5 genes were engineered to reduce petite formation (Dimitrov, Brem, Kruglyak, & Gottschling, 2009). Generally, yeast cultures were grown in SC medium prepared with 1.47 g/l Synthetic Complete (Kaiser) Drop Out: Leu, His, Ura (Formedium, Hunstanton, United Kingdom), 6.7 g/l Yeast Nitrogen Base Without Amino Acids, 20 g/l D-(+)-Glucose, pH set to 5.8 with hydrochloric acid, and supplemented with 76 mg/l histidine, 380 mg/l leucine, and/or 76 mg/l uracil depending on the auxotrophies of the strains. A slow glucose release minimal medium as follows was used in some experiments: 19.2 g/l MES monohydrate, 3.5 g/l ammonium sulfate, 1.89 g/l citric acid monohydrate, 1.40 g/l potassium chloride, 1.77 g/l dipotassium hydrogenphosphate heptahydrate, 1.35 g/l magnesium sulfate heptahydrate, 1.35 g/l sodium chloride, 0.80 g/l calcium chloride dihydrate, 15 mg/l EDTA, 4.5 mg/l zinc sulfate heptahydrate, 0.3 mg/l cobalt(II) chloride hexahydrate, 1 mg/l manganese(II) chloride tetrahydrate, 0.3 mg/l copper(II) sulfate pentahydrate, 3 mg/l iron(II) sulfate heptahydrate, 0.4 mg/l sodium molybdate dihydrate, 1 mg/l boric acid, 0.05 mg/l biotin, 1 mg/l calcium pantothenate, 1 mg/l nicotinic acid, 25 mg/l inositol, 1 mg/l thiamine HCl, 1mg/l pyridoxine HCl, 0.2 mg/l para-aminobenzoic acid, pH set to pH 6.4 with potassium hydroxide for the normal
medium or to pH 4.0 with sulfuric acid for the low pH medium, and supplemented with 40 g/l polysaccharide (m2p-labs, Baesweiler, Germany) and 0.3% (v/v) Enzyme-Mix 100 U/ml (m2p-labs, Baesweiler, Germany).
4.4 Assembly of gene expression cassettes on multi-expression
plasmids or into the genome by homologous recombination
Multiple expression cassettes were assembled into multi-expression plasmids or integrated into the genome with an in vivo homologous recombination technology (HRT) slightly modified from DNA assembler (Shao, Zhao, & Zhao, 2009). In contrast to the original version, the 60 base pair homology sequences used to assemble different cassettes were not added by PCR but were already present in HRT entry vectors. This allows indefinite reuse of cassettes after initial cloning and sequence verification of the respective genes. After cloning into these entry vectors, both expression cassettes and helper fragments required for assembly of HRT plasmids or integration into the genome are flanked by 60 base pair HRT tags named A, B, C, D, E, F, G, H, and Z, which are in turn flanked by AscI restriction sites for release of the tagged fragments. Table 7 lists all basic parts used in this work. Genes of interest were cloned into pEVE2176-2181 as shown in Table 5. For multi-expression HRT plasmid assembly 310 fmol each of the ZA and AB entry plasmids, containing all elements required for replication, maintenance, and selection, were combined with 460 fmol each of all other entry plasmids, containing the expression cassettes and the closing linker. The complete mixture was digested with AscI (NEB) in a 10 µl reaction, releasing all inserts from their vector backbone, followed by heat inactivation of the restriction enzyme at 80°C for 20 minutes. The whole reaction was used to transform S. cerevisiae with a standard LiAc transformation (Gietz & Schiestl, 2007). For integration of expression cassettes into the yeast genome the method was slightly adapted. The autonomous replication signal was omitted, and instead the ZA and AB helper fragments contained homologous sequences for integration into the genome and a selection marker nested between two LoxP sites. Additionally, the amount of DNA was scaled up by a factor of three compared to assembly of multi-expression plasmids in order to increase integration efficiency. All strains constructed in this work can be found in Table 8.
