A.2. Supplementary Material, Chapter 3
Table A.2.:Primers used for real-time PCR analysis ofpsbAtransformants and WT cells ofP. tricornutum.
Primer Sequence (5’-3’) Ohp1-like1 fw GCCATCGGAAACCGAGAAA Ohp1-like1 rev CGAGTTCGACCGTATCCAATG Ohp2 fw AAGAAACCTGGCGGAAGGAA Ohp2 rev AGGAAGAACATGGCGAATCGT Sepx fw GCAGAAATTTGGAATGGACGTG Sepx rev CGCCTTCCTGTAGACCCTGAAT Dde fw ACATCTCAGCCGGACAAAACA Dde rev CCAATTCAGTTTGCCGAAGAAC psbAfw TACCCAATTTGGGAAGCAGC psbArev AAACGGTAGCTTAATTCCCATTCA Sod fw TCAATGCCAGTTTCGGAAGC Sod rev TTAACGCAAACCCATACCCATC Lhcx1 fw AAGGTTCGTCGTTCCTCTTCG Lhcx1 rev CGGAAGCACCGATAGCAATAGT Lhcx2 fw CGCCATTACTCACCTCAACCAG Lhcx2 rev CAACCCAACCAATTTGAGCG Lhcx3 fw TCTTGAACGAGGACTACACCCC Lhcx3 rev TCCGTTCTGGAGTTCCTTGGT Lhcx4 fw ATGGCCGCGTTGCTATGTT Lhcx4 rev TATAGCAGGCCCCGAAACTTG Gapdh fw ACGGCCGATGTTTCTATGGT Gapdh rev ATCGGTCCTTCTGACGCCTT
A. Supplementary Data
Table A.3.:Diadinoxanthin (DD) and diatoxanthin (DT) contents in the wildtype (WT) and thepsbAmutants of Phaeodactylum tricornutumacclimated to 250µmol·photons·m−2·s−1for72h. Pigments are inmol/100mol Chla. DEP (DD de-epoxidation) = DT/(DD+DT)×100. Values are average±SD of two measurements.
The content in fucoxanthin, Chl c and β-carotene was similar to the data in table 3.2 on page 33. 72 h acclimation corresponds to the beginning of the stationary phase of growth (see Fig. A.7A). When diatom cells reach the stationary phase of growth, their DD/DT content increases [16]. When the DD/DT content is higher, for the same light conditions DEP is higher [138].
Pigment/Parameter WT V219I F255I S264A L275W
DD 25.2±2.8 21.2 ±1.8 20 ±1.4 15.2 ±2 15.5±1
DT 3.6±0.4 3.6 ±0.2 3 ±0.9 2.2±0.5 5.5 ±0.4
DD+DT 28.8±3.4 24.8 ±1.6 23 ±0.5 17.4±2.4 21± 0.9 DEP (in %) 12.9±1.3 14.5 ±1.7 13 ±3.9 12.5±0.8 26± 2.5 Diadinoxanthin (DD) and diatoxanthin (DT) contents and the non-photochemical fluorescence quenching (NPQ) in the wild-type (WT) and the psbA mutants of Phaeodactylum tricornutum acclimated to 250 µmol photons m-2 s-1 for 72 h
Pigment DEP (DD de-epoxidation) = DT/(DD+DT)x100. Values are average SD of two
measurements. The content in fucoxanthin, Chl c and -carotene was similar to the data in Table 1. 72 h acclimation corresponds to the beginning of the stationary phase of growth (see Fig. S3A). When diatom cells reach the stationary phase of growth, their DD/DT content increases (Arsalane et al, 1994). When the DD/DT content is higher, for the same light conditions DEP is higher (Lavaud et al, 2002).
0
0 200 400 600 800 1000 1200 WT V219I F255I S264A L275W
Light intensity (µmol photons.m-2.s-1)
NPQ
Figure A.5.:Non-photochemical fluorescence quenching (NPQ) in the wildtype (WT) and thepsbAmutants of Phaeodactylum tricornutumacclimated to 250µmol·photons·m−2·s−1 for72h. For methods see Fig. A.7 on page 122.
A.2. Supplementary Material, Chapter 3 Supplementary File S1
Diagram of the influence of mutations on the photosynthetic apparatus and on the amplitude of the photoprotective mechanisms under low (LL) and high (HL) light acclimation in the psbA mutants (V219I/F255I/S264A/L275W) of Phaeodactylum tricornutum in comparison to the wild type (WT) situation.
Fig. S1: Middle: the electron pathways within the PSII reaction center (see Materna et al, 2009); Symbols: red star, mutation; size of QA-/QB-, concentration of QA-/QB-; thickness of the e- arrows, value of the ETRmax and of the QB- to QAback-transfer; dotted feature of the OEC arrow, proportion of the disturbance of the OEC operation. Abbreviations: arrow up,
Figure A.6.:Influence of the mutations on the photosynthetic apparatus and the amplitude of photoprotective mechanisms under low (LL) and high (HL) light acclimation in thepsbAmutants (V219I/F255I/S264A/L275W) of P. tricornutumin comparison to the WT. Middle: the electron pathways whithin the PSII reaction center (see [156]); symbols: red star, mutation; size of QA−
/QB−
, concentration of QA−
/QB−
; thickness of the e− arrows, value of the ETRmaxand of the QB−
to QA back-transfer; dotted feature of the OEC arrow, proportion of the disturbance of the OEC operation. Abbreviations: arrow up, increased value (the true value is given in brackets); arrow down, decrease; flat arrow, no change; DT, diatoxanthin; ETR, electron transport rate; e−, electrons; OEC, oxygen evolving complex; PSII CET, photosystem II cyclic electron transfer; PSII RCs, PSII reaction centers; NPQ, non-photochemical quenching of fluorescence quenching; QA and QB, quinones. See the text for a more detailed description.
A. Supplementary Data
Details on the kinetics of the PSII electron cycle (PSII CET) and NPQ in the WT and the four psbA mutants
Fig. S1: A- Extent of the PSII electron cycle (PSII CET) in the wild-type (WT) and the four psbA V219I / F255I / S264A / L275W mutants of P. tricornutum cells for the first 450 µmol
photons m-2 s-1 of the light gradient used in this study. The illumination duration was 5 min; a new sample was used for each irradiance. Values are average SD of three to four measurements. B- Non-photochemical Chl a fluorescence quenching (NPQ) in the same cells as a function of time for an irradiance of 2000 µmol photons m-2 s-1.
Methods:
Oxygen yield and the PSII electron cycle (PSII CET)
The relative O2 yield produced per flash during a sequence of single-turnover saturating flashes at a frequency of 2 Hz was measured polarographically at 21C with a flash
0
Figure A.7.:Details on the kinetics of the PSII electron cycle (PSII CET) and NPQ in the WT and the fourpsbA mutants. (A) Extent of the PSII electron cycle (PSII CET) in the wildtype (WT) and the fourpsbAmutants (V219I/F255I/S264A/L275W) ofP. tricornutumfor the first 450µmol·photons·m−2·s−1of the light gradient used in this study. The illumination duration was5min; a new sample was used for each irradiance. Values are average±SD of three to four measurements. (B) Non-photochemical Chlafluorescence quenching (NPQ) in the same cells as a function of time for an irradiance of 2000µmol·photons·m−2·s−1.
Methods:
Oxygen yield and the PSII electron cycle (PSII CET): The relative O2 yield produced per flash during a sequence of single-turnover saturating flashes at a frequency of 2Hzwas measured polaro-graphically at 21◦C with a flash electrode as described by [140]. Short (5 µs) saturating flashes were produced by a Strobotac lamp (General Radio Co., Concord, MA). The flashes were separated by 500 ms allowing the reopening of PSII RCs by reoxidation of QA−, between each flash. For the control sequences, cells were first dark-adapted for 20minand then deposited on the electrode.
Both control and illuminated samples were allowed to settle on the electrode for 7minin darkness before measurement. The steady-state O2yield per flash (YSS) was attained for the last four flashes of a sequence of 20 flashes when the classical four-step oscillations due to the S-states cycle ([126];
see [156] for a classic recording) were fully damped. YSS was used to evaluate the number of O2
producing PSII RCs relative to Chla(see [138]). Its decrease after a short illumination of increasing irradiances was used to evaluate the photoinhibition kinetics (see Fig. 3.2 on page 31). The O2deficit per PSII reaction center, which is a measurement of the extent of the PSII electron cycle (PSII CET), was measured as described in [140]. The O2deficit per PSII reaction center was quantified from an illuminated (L) sample as 20×YSS, the steady-state flash yield, minus the sum of signals in a 20-flash series, expressed in unitsYSS. The contribution to the deficit resulting from normal S-state deactivation during dark-adaptation was corrected by subtraction of the deficit in a non-illuminated (D) sample (which is non-zero because the higher oxidation states of the O2-evolving complex are reduced in the dark):
O2 deficit = [{(20×YSS L)-(P(Y1...20)L)}-{(20×YSS D)-(P(Y1...20)D)}]/YSS D
Chlorophyll fluorescence yield and the non-photochemical quenching (NPQ): Chl fluorescence yield was monitored with a modified PAM-101 fluorometer (Walz, Effeltrich, Germany) as described pre-viously [202]. A Clark electrode vial was adapted to the PAM light guides in order to record
simul-A.2. Supplementary Material, Chapter 3
taneously O2 and fluorescence. Fluorescence was excited by a very weak (non-actinic) modulated 650nmlight. After 20mindark-adaptation, continuous actinic light of adjustable intensity was ap-plied (different irradiances and illumination durations, see the Results section, chapter 3.4, page 29).
600mspulses of white light (4000µmol·photons·m−2·s−1) were admitted by an electronic shutter (Uniblitz, Vincent, USA, opening time 2ms) placed in front of a KL-1500 quartz iodine lamp con-tinuously regularly switched on in order to monitor the evolution of fluorescence during actinic light exposure. The average fluorescence measured during the last 400msof the pulse was taken as Fm
orFm’. For each experiment, 2mLof cell suspension were used. Sodium bicarbonate was added at a concentration of 4mM from a freshly prepared 0.2M stock solution in distilled water to prevent any limitation of the photosynthetic rate by carbon supply. Standard fluorescence nomenclature was used. F0 andFmare defined as the minimum PSII fluorescence yield of dark-adapted cells and the maximum PSII fluorescence yield reached in such cells during a saturating pulse of white light, respectively. The maximum PSII quantum yield for photochemistry is the ratio Fv/Fm where Fv
is the variable part of the fluorescence emission and is equal to Fm−F0. The non-photochemical fluorescence quenching was NPQ =Fm/Fm’−1, whereFm’ is the maximum PSII fluorescence yield of light-adapted cells. The photochemical quenching was qP = (Fm−F’)/(Fm’−F0’), whereF’ is the steady-state level of fluorescence emission reached under a given irradiance and after a given time of illumination. 1−qP is a parameter to estimate the reduction state of QA [27]. ETR, the rate of linear electron transport was calculated as ETR = ΦPSII ×PFD × α× 0.5, where ΦPSII is the PSII quantum yield for photochemistry ( = (Fm’−F’)/ Fm’), PFD is the irradiance, αis the PSII antenna size.
A. Supplementary Data
Growth and maximum PSII quantum yield for photochemistry (Fv/Fm) of the WT and the four psbA mutants during acclimation to high light intensities
0 1 2 3 4 5 6 7
Figure A.8,caption on page 125
A.2. Supplementary Material, Chapter 3
Figure A.8.:Growth and maximum PSII quantum yield for photochemistry (Fv/Fm) of the WT and the four psbAmutants during acclimation to high light intensities. Growth (AandB) and evolution of the maximum PSII quantum yield for photochemistry (Fv/Fm) (C toF) of the wildtype (WT) and the fourpsbAmutants (V219I/F255I/S264A/L275W) ofP. tricornutumcells during acclimation to two high light intensities: 250 and 450µmol·photons·m−2·s−1 (A/C/EandB/D/F, respectively). Values are average±SD of four to five measurements.
Methods:
Phaeodactylum tricornutum Bohlin (University of Texas Culture Collection, strain 646) wildtype (WT) and mutant cells were grown in 200 mL sterile f/2 50 % medium [87] at 21◦C in airlift columns continuously flushed with sterile air. The cultures were illuminated at a light intensity of 50µmol·photons·m−2·s−1with white fluorescent tubes (OSRAM) with a 16:8hlight:dark cycle.
After having reached the middle of the exponential phase of growth at 50µmol·photons·m−2·s−1 (4 days of growth), the cells were resuspended in fresh f/2 medium at a concentration of 0.32 µg Chla·mL−1. Samples for the determination of Chla andFv/Fm were taken each day at the same time (3 hours after initiating the light period). Algal biomass was determined as the amount of chlorophylla(Chla) in the culture. Chlaamount was determined by spectrophotometry using the 90 % acetone extraction method [113]. Fv/Fm, the maximum PSII quantum yield for photochemistry was routinely monitored during cell growth with a home-made fluorometer (see [188]). Fluorescence parameters were defined as described in Fig. A.7.
Supplementary File S4
Typical NPQ measurement at 250 µmol photons m-2 s-1 for the wild-type (WT) and the four psbA F255I / S264A / L275W mutants of P. tricornutum cells.
Methods: see Fig. S1.
0 0,5 1 1,5 2
0 1 2 3 4 5
WT V219I S264A F255I L275W
Time (min) NPQ 250
Figure A.9.:Typical NPQ measurement at 250µmol·photons·m−2·s−1for the wildtype (WT) and thepsbA mutants F255I/S264A/L275W ofP. tricornutum. Methods see Fig. A.7.
A. Supplementary Data
Relationship between the non-photochemical fluorescence quenching (NPQ) and the amount of diatoxanthin (DT) in the WT (+/- DCMU or NH4Cl) and the four psbA mutants of Phaeodactylum tricornutum
Data were extracted from Table 1, see the legend of table 1 for details. The dotted line reveals the direct linear relationship usually observed between NPQ and DT in diatoms (Lavaud et al., 2002a; Goss et al., 2006). It is noteworthy that all types of cells as well as the WT cells treated with DCMU or NH4Cl follow that relationship (slope NPQ vs DT 0.43 0.05) while the mutant L275W did not (slope NPQ vs DT 0.21).
References :
Lavaud, J., Rousseau, B., van Gorkom, H. & Etienne, A.-L. 2002. Influence in the
diadinoxanthin pool size on photoprotection in the marine planktonic diatom Phaeodactylum tricornutum. Plant Physiol. 129:1398-406
Figure A.10.:Relationship between the non-photochemical fluorescence quenching (NPQ) and the amount of dia-toxanthin (DT) in the WT (+/−DCMU or NH4Cl) and the fourpsbAmutants ofPhaeodactylum tricornutum.
Data were extracted from table 3.2 on page 33, see the legend of table 3.2 for details. The dotted line reveals the direct linear relationship usually observed between NPQ and DT in diatoms [138, 74]. It is noteworthy that all types of cells as well as the WT cells treated with DCMU or NH4Cl follow that relationship (slope NPQ vs DT 0.43±0.05) while the mutant L275W did not (slope NPQ vs DT 0.21).Supplementary File S8
Transcript level of photosynthetic genes in WT cells grown at 250 µmol photons m-2 s-1 (‘high light’, HL) relative to WT cells grown at 50 µmol photons m-2 s-1 (‘low light’, LL).
Fig. S8: The transcript levels of LL grown cells were normalized at 1 (dark continuous line).
The transcript levels of HL grown cells were expressed relative to the transcript levels of genes under LL. The cells were sampled during the exponential phase of growth, 3 h after initiating the light period (16:8 h light:dark cycle). The genes are: psbA (D1 protein), dde (DD de-epoxidase), sod (superoxide dismutase), lhcx (light-harvesting complex ‘x’), ohp (one-helix protein), sep (stress-enhanced protein). psbA encodes for the D1 protein of the PSII RC which is susceptible to photodamage; dde encodes for the DD de-epoxidase which is the enzyme responsible for the photoprotective de-epoxidation of DD into DT; sod encodes for the superoxide dismutase an enzyme responsible for the scavenging of reactive oxygen species;
Figure A.11.:Transcript level of photosynthetic genes in WT cells grown at 250µmol·photons·m−2·s−1(‘high light’, HL) relative to WT cells grown at 50µmol·photons·m−2·s−1(‘low light’, LL). The transcript levels of LL grown cells were normalized to 1 (dark continuous line). The transcript levels of HL grown cells are shown relative to the transcript levels of genes under LL. The cells were sampled during the exponential phase of growth,3hafter initiating the light period (16:8hlight:dark cycle). The genes are: psbA(D1 protein),Dde (DD de-epoxidase),Sod (superoxide dismutase),Lhcx (light-harvesting complex ‘x’),Ohp(one-helix protein), Sep (stress-enhanced protein). Values are average±SD of three measurements. Methods: see the Material and Methods (chapter 3.3, page 3.3) for a description of RNA extraction and transcript level analysis.