1 Introduction
1.7 Superoxide dismutase 2 (Sod2)
Sod2, also called MnSOD, is a member of the iron/manganese superoxide dismutase family. It encodes a mitochondrial matrix protein that forms a homotetramer and binds one manganese ion per subunit. The protein transforms toxic superoxide, a byproduct of the mitochondrial electron transport chain, into hydrogen peroxide and diatomic oxygen. It is a key metabolic anti-oxidant enzyme for detoxifying free radicals inside mitochondria. The Sod2 gene has been shown to be required for normal biological tissue functions of maintaining the integrity of mitochondrial enzymes. Homozygous Sod2-/- mutant mice die with the first 10 days of life with a dilated cardiomyopathy, accumulation of lipid in liver and skeletal muscle, and metabolic acidosis [109].
Therefore, Sod2 gene ‘flox’ mice were generated which can then be used as conditional knockout alleles by crossing them to Cre mice. They provides a new opportunity to investigate the function of this gene in specific tissues and organ [110].
Several studies have reported declines in MnSOD activity during diseases including cancer, aging, progeria, asthma, and transplant rejection [111-113]. It was also shown in our laboratory that the SodLysMcre mice, where the Sod2 gene is deficient in granulocytes and macrophages, were susceptible to Lysteria monocytogenes infection in mouse model (Pisano, et al., unpublished). However, it was not known if Sod2 may also be required for the host defense against IAV infections.
21 1.8 Objective of the thesis
General objective of this thesis:
The overall objective of this thesis was to determine the role of specific host genes for the host defense against influenza virus A (IAV) infections. This objective was addressed by the following scientific approaches.
Specific objectives:
a) Analysis of gene expression after IAV infection and selection of candidate genes for further analyses.
In previous studies from our laboratory, susceptible (DBA/2J) and resistant (C57BL/6J) mice were infected and the genome-wide gene expression was analyzed by micro arrays. These results were to be further confirmed in my thesis work with a second assay. Based on these analyses and reports in the literature, candidate genes should be selected which should be further studied in knock-out mice. Those candidate genes for which mutant mice were available at the HZI or from external collaborators should be studied first. For the other genes, targeted ES cells should be obtained from public repositories to produce live knock-out mutant lines.
b) Analysis of the susceptibility to IAV infections in mutant mouse lines.
Mutant mouse lines should be infected with IAV and their phenotypes be studied with respect to weight loss, survival, viral load, and immune response.
22 2 Materials and methods
2.1 Material
2.1.1 Chemicals and reagents
Unless specified otherwise, all chemicals and reagents were purchased from Sigma-Aldrich, Invitrogen, or Merck. Taq Polymerase, nucleic acids (2-log ladders) were ordered from Genecraft Germany. BioscriptTM was obtained from Bioline GmbH, Germany.
2.1.2 Virus
Mouse-adapted virus strains, influenza A/Puerto Rico/8/34(H1N1, PR8) were obtained from Munster propagated in the chorio-allantoic cavity of 10-day-old embryonated hen eggs for 48 hours at 37°C.
2.1.3 Mouse mutants and ES cell lines Irf7-/- mutant mice
Irf7-/- mutant mice were originally received from Thomas Kolbe, Biomodels Austria and the Department of Agrobiotechnology, University of Natural Resources and Applied Life Science, Vienna. The original Irf7-/- mice were generated on 129 backgrounds by Kenya Honda et al. [88]. Mice were backcrossed to C57BL/6J for 10 generation, and then bred to homozygocity. The mutant was maintained as a homozygous line. The genotyping of 124 informative SNPs SNPs were from the C57BL/6J background, only six SNPs indicated small regions that were still from the 129 background (Table 2.1).
Table 2.1: List of SNPs in Irf7-/- micedifferent from C57BL/6J
SNP ID SNP ID
rs3719255 rs13479567
rs3699358 rs13480100
rs3663988 rs13481634
In this thesis work, I refer to B6.129-Irf7tm1Ttg/tm1Ttg
mice as Irf7-/- mice [88].
23 Rag2-/- mutant mice
Rag2-/- mice were obtained from Dr. Siegfried Weiß, Molecular Immunology group, HZI.
The mice were maintained on a C57BL/6J background. The genotyping of informative 472 SNPs confirmed that 448 SNPs were from C57BL/6J background. However 24 SNPs were different from C57BL/6J as shown in the Table 2.2.
Table 2.2: List of SNPs in Rag2-/- mice different from C57BL/6J
SNP ID SNP ID
In this thesis work, I refer to B6; 129-Rag2 tmCgn/tmCgn
mutant mice as Rag2-/- mice [39].
Socs3LysMcre mice
Socs3LysMcre mice were generated by crossing B6.129-Socs3tm1Ayos with B6.129P2-LzMtm1(cre)Ifo
mice. Socs3LysMcre were mice kindly provided by Roland Lang, Institute of Medical Microbiology, Immunology and Hygiene, Technical University Munich. These mice were already bred onto a C57BL/6J background..
24
In this thesis work, I refer to B6.129-Socs3tm1Ayos/Socs3tm1Ayos LzMtm1(cre)Ifo
+ as Socs3LysMcre mice and to B6.129-Socs3tm1Ayos/Socs3tm1Ayos mice, which did not contain the Cre recombinase, and which were used as wild type controls, as Socs3LysMcre- mice [53, 114].
Socs3Rosa26Ert2cre mice
Socs3Rosa26Ert2cre mice were generated by crossing B6.129-Socs3tm1Ayos mice to B6.129-Gt (ROSA)26Sortm1(cre/Esr1)Brn
mice, which were kindly provided by Dagmar Wirth, from the research group Model Systems for Infection and Immunity, HZI.
In this theis work, I refer to B6.129-Socs3tm1Ayos/Socs3tm1Ayos Gt(ROSA)26Sortm1(cre/Esr1)Brn
+ mice as Socs3Rosa26Ert2cre mice, and to B6.129-Socs3tm1Ayos /Socs3tm1Ayos mice, which did not contain the Cre recombinase, and which were used as wild type controls, as Socs3Rosa26Ert2cre- mice [114, 115].
Sod2LysMcre mice
Sod2LysMcre mice were generated by crossing 129; B6-Sod2tm1Sh with B6.129P2-LzMtm1(cre)Ifo
mice. Sod2LysMcre mice were obtained from Werner Müller, Department of Experimental Immunology, HZI. They were maintained in the mixed background of 129 and C57BL/6J background.
In this thesis work, I refer to 129;B6-Sod2tm1Sh /Sod2tm1Sh LzMtm1(cre)If /+ as Sod2LysMcre mice, and to 129;B6-Sod2tm1Sh /Sod2tm1Sh which did not contain the Cre recombinase, and which were used as wild type controls, as Sod2LysMcre- mice [53, 116].
Other mutant ES cell lines
Ifi44, Ifi27, Ifi47, and Ifit1 KO ES cell lines were purchased from the Knockout mouse
project consortium, USA (KOMP
Here, I refer to B6-Ifi44tm1a(KOMP)Wtsi/tm1a(KOMP)Wtsi
as Ifi44-/- ES cell line [117], to B6-Ifi2712a tm1(KOMP)Vlcg/tm1(KOMP)Vlcg
as Ifi27-/- ES cell line [118], to B6-Ifi47tm1Gat/tm1Gat
as Ifi47-/- ES cell line [119] and to B6-Ifit1tm1(KOMP)Vlcg
as Ifit1-/- ES cell line [120].
25
C57BL/6J and DBA/2J mice were purchased from Janvier.
2.1.4 Kits
Table 2.3: List of kits used in this thesis
Name of the kits Company
RNeasy Midi kits Qiagen
SYBR-Green kits Roche
Mouse Interferon response RT2 profiler PCR array SABioscience
Rnase-Free DNase Set Qiagen
Mouse interferon alpha ELISA kit PBL Mouse interferon beta ELISA kit PBL Verikine-DIYtm Mouse-IL28B/IFNlambda3 PBL Thermoscript First-strand Synthesis System Invitrogen
2.1.5 Oligonucleotides
Table 2.4: List of primers used for semi-quantitative PCR analysis
Gene
26
27
Table 2.5: List of primers used for real-time PCR analysis
Gene name
Forward primer Reverse primer
Ifit1 TGGCCGTTTCCTACAGTTTCATAA AACACGTCTTTCAGCCACTTTCTC Ifi35 GTCCAGCCAGCCAGATAACCACA GGGCCACTTCTTCATCAGCAAACC Ifi44 TGACCCCCTGCCATTTATTCTGTG GTTCGGATGGTTTGATGTGATTGG
Ifit3 GGCCGCCCTGGAGTGCTTAG AGAGACGGCCCATGTGATAGTAGA
Tlr7 TGGAGAGCCGGTGATAACAGATAC GGCGGCATACCCTCAAAAACC B-actin GGGTCAGAAGGACTCCTATG GGTCTCAAACATGATCTGGG
Table 2.6: List of primers used for genotype analysis
Gene name
Forward primer Reverse primer
Socs3F GCGGGCAGGGGAAGAGACTGTCTGGGGTTG GGCGCACGGAGCCAGCGTGGATCTGCG
Socs3R2 AGTCCGCTTGTCAAAGGTATTGTCCCAC
Cre1 GCATTTCTGGGGATTGCTTA CCCGGCAAAACAGGTAGTTA
Irf7F
GTGGTACCCAGTCCTGCCCTCTTTATAATCT TCGTGCTTTACGGTATCGCCGCTCCCGATTC
Irf7R2 AGTAGATCCAAGCTCCCGGCTAAGTTCGTAC
Rag2F GGGAGGACACTCACTTGCCAGTA AGTCAGGAGTCTCCATCTCACTGA
Neo CGGCCGGAGAACCTGCGTGCAA
Sod2F GCTGTCATTGCTTTTAACTGC AGTCACCTCCACACACAG
Sod2R TGCCAGATGTCACCTTAAAG
28 2.1.6 Antibodies
Table 2.7: List of antibodies used in this thesis
Antibodies Company Conditions
Anti-influenza NP protein polyclonal Virostat, Portland, USA 1:1000 Anti-goat-HRP antibody KPL, Gaithersburg MD, USA 1:1000
Rabbit anti-goat-biotin KPL, MA, USA 1:250
Anti mouse-IgG-HRP KPL, Gaithersburg MD, USA 1:2000 Anti mouse-IgG2a-HRP SouthernBiotech, Birmingham, 1:1000 Anti mouse-IgM-HRP KPL, Gaithersburg MD, USA 1:1000
2.1.7 Solutions
Table 2.8: List of buffers used in this thesis
Buffer Contents
1x TAE buffer 10mM sodium acetate,1mM Na2EDTA, 40mM Tris/HCl. pH 8.0 Agarose loading buffer 50%(v/v) glycerol, 1 mM Na2EDTA, 0.1%(v/v) Xylencyanol, 0.1%
orange G
PBS 137 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4.2H2O, 1.4 mM KH2PO4
Tail lysis buffer Cell lysis solution, Qiagen
Trypsin-EDTA 0.25%(v/v) trypsin, 0.53 mM EDTA Wash buffer PBS with 0.05% tween 20
Block buffer Wash buffer with 5% FCS
Substrate buffer 64mM Na2HPO4, 27 mM Citric acid, to pH 5.0 Stop solution 4% HCl
29 Table 2.9: List of media used for cell culture
Solutions Content
DMEM Dulbecco’s Modified Eagle Medium with 4.5g/L D-Glucose, Gibco 2xEMEM 2xDMEM with 1% Pen/Strep, 2mM glutamin, Filted with 0.2 um
filter
Fetal Bovine Serum PAA laboratories GmbH, A15-151
MDCK culture medium MEM with 10%FCS, 1% P/S, 2mM glutamine
MEF culture medium DMEM Glut Max, 10% FCS, 1%P/S, 1% Sodium pyruvate, 0.01%
beta-mercaptoethonal
ES cell culture medium DMEM Glut Max, 10% FCS, 1%P/S, 1% Sodium pyryvate, 0.01%
beta-mercaptoethonal Infection medium DMEM with 0.1
% BSA, and 2.5 ug/ml N-Acetylated Trypsin(NAT)
30 2.1.8 Apparatuses
Table 2.10: List of apparatuses used in this thesis
Equipments Company and type
Air pump Vacuum-Pump unit, BVC 21NT Agarose gel system Biostep, GmbH, HUB
Cell counter Assistant, Germany
PCR machine Biometra Tgrandient/Tprofessional Basic Thermocycler Egg incubator Bruja, Motor Bruter Modell 84/EM
Homogenizer Poly Tron 2100
Cell incubator Therm scientific, Hera cell 240 Centrifuge Centrifuge 5417R/5804R
Sterile working bench Thermo scientific, HERS SAFE ksp Gel documentation InTAS, GDS
Microscope Leica DMIL Pipette Gilsen / Eppendorf Water bath GFL,1083
ELISA Reader Megellan
Lamp ORBAN, Tempo Nr.119
Sections cutting Microm HM340E
Real-time PCR system Roche, LightCycler 480 System
31 2.1.9 Software
Table 2.11: List of software used in this thesis
Software Company
Adobe Acrobat professional 7.0 Adobe systems Inc.
GraphPad prism 5.0 GraphPad Software, Inc Microsoft office 2007 Microsoft
Photoshop CS2 Adobe Systems Inc.
Primer 5 Primer Biosoft International
2.2 Methods
2.2.1 Molecular biology methods 2.2.1.1 Virus preparation and titration
Mouse-adapted virus strains influenza A/Puerto Rico/8/34(H1N1, PR8), was propagated in the chorio-allantoic cavity of 10-day-old embryonated hen eggs for 48 hours at 37°C.
Fluid from the chorio-allantoic cavity was collected and the virus was titrated by the FFU assay and stored in aliquots at -70°C until use. The identity of the virus was confirmed by sequence analysis of the HA and NA segments.
The Focus-forming Unit (FFU) assay was used to determine the titer of infectious virus.
Virus titration by foci assay MDCK II cells (American Type Culture Collection, Manassas, USA) were cultured at 37°C in 5% CO2 in Dulbecco’s Modified Eagle Medium (DMEM), supplemented with 10% fetal calf serum (FCS), 1% penicillin/streptomycin. 6x105 cells were seeded in 96-well culture plates and incubated at 37°C in 5% CO2 for 24 h. For foci assay, lungs of mice were homogenized in phosphate buffered saline (PBS) with 0.1% BSA using the Poly Tron 2100 homogenizer. Debris was removed by centrifugation for 10 min at 1000 rpm. The samples were stored in aliquots at -70°C.
Serial 10-fold dilutions of lung homogenates in DMEM containing 0.1% BSA were prepared and added to MDCK II cells. After 1 h, cells were washed twice with PBS and
32
fixed with 4% formalin in PBS (100µl/well). The plates were incubated at 37°C in 5%
CO2 for 1 h. The inoculates were aspirated and replaced with 100 ml of 1% Avicell overlay and incubated at 37°C for 24 h. Subsequently, the plates were washed twice with PBS and fixed with 4% formalin in PBS for 10 min at room temperature. The formalin was removed and the cells were washed and incubated for 10 min with 100 ml/well Quencher (0.5% Triton 6100, 20 mM glycine in PBS). After 10 min, the cells were washed with Wash Buffer (0.5% Tween 20 in PBS) and blocked with 50 ml Blocking Buffer (0.5% Tween 20, 1% BSA in PBS) at 37°C in 5% CO2 for 30 min. The primary antibody (anti-influenza nucleoprotein (NP) polyclonal goat antibody from Virostat, Portland, USA) and the secondary antibody (anti-goat-HRP from KPL, Gaithersburg MD, USA) were diluted 1:1000 in Blocking Buffer. 50 ml of the primary antibody were added to each well and incubated at room temperature for 1 h. After 1 h, the cells were washed three times with Wash Buffer. Then the cells were incubated with 50 ml of the secondary antibody for 45 min, washed again and incubated with 50 ml of substrate (True Blue from KPL) until the blue spots from infected cell foci appeared. The foci were counted and the viral loads were calculated as focus forming units per lung (FFU/lung).
2.2.1.2 DNA preparation and genotyping protocol
Total genomic DNA for genotyping was extracted from the tissue of the tail by overnight digestion with 3μl of 20 μg/ml proteinase K solution in 300μl tail lysis buffer at 55°C.
Proteinase K was inactivated by heat-shock at 90°C for 10 min. 100μl protein precipitation solution was added, mixed gently with the sample and centrifuged for 3min at 13,000rpm. The aqueous phase was transferred into a new tube and 1 volume of 100% iso-propanol was added. The tube was inverted gently and swirled to mix. The DNA was centrifuged down at 13,000 rpm for 3 min. The supernatant was aspired and washed once with 70% ethanol. The pellet was briefly air-dried at room temperature (RT) and was then dissolved in 50μl Hydration solution.
The concentration of nucleic acid was determined by spectrophotometry (Nanodrop-1000 V3.60) according to the manufacturer’s instructions.
33
For the Irf7-/- mice, the following PCR reaction mixes and programs were applied to PCR softstrips. PCR products (wild type: 300bp, mutant: 200bp):
Component Final concentration Volume
10xPCR buffer 1× 2.0μl
For the Rag2-/- mice, the following PCR reaction mixes and programs were applied to PCR softstrips. PCR products (wild type: 263bp, mutant: 350bp)
Component Final concentration Volume
10xPCR buffer 1× 2.0μl
34
For the Socs3 flxed allele the following PCR reaction mixes and program were applied to PCR softstrips. Products (wild type: 380bp, mutant: 280bp)
Component Final concentration Volume
10xPCR buffer 1× 2.0μl
35
For the conditional mutant mice, the expression of the Cre recombinase gene was detected by the following protocol (cre+: 350bp)
Component Final concentration Volume
10xPCR buffer 1× 2.0μl
2.2.1.3 Agarose gel electrophoresis
After amplification, the PCR reaction mix was loaded with 1/10 volume agarose loading buffer. Depending on the expected product size, it was applied onto a 1 to 2% (w/v) agarose gel to separate PCR products. Agarose gels were prepared with UltraPureTM agarose (Invitrogen), 1× TAE, and 0.5μg/ml ethidium bromide solution. A 2-log DNA ladder was used to determine the size of the PCR product. The separation took place in 1× TAE running buffer for 45 min at 120 volts in an agarose gel chamber Mupid®-ex (Eurogentec GmbH). PCR fragments were visualized on a UV unit (U-Transilluminator;
Olympus).
36 2.2.1.4 Total RNA isolation and purification
Total RNA was prepared from lungs using the RNeasy Midi kit (Qiagen, Hilden, Germany) following the manufacturer’s protocol. Quality and quantity checks were performed using Agilent 2100 bioanalyzer.
2.2.1.5 Semi-quantitative PPCR and Real-time PCR
Samples contain 500 ng RNA were digested with DNase I (to remove any DNA in the preparation). Subsequently the RNA was subjected to cDNA synthesis with random hexamer primers (Invitrogen) following the program: denatured at 37 °C for 20 min, followed by reverse transcription at 75 °C for 1 h. Samples were diluted to a final volume of 30 µl and stored at -20 °C. 2 µl of cDNA product were amplified with specific primers (Table 5). For RT, the BioscriptTM (Bioline GmbH,Germany) was used. Taq polymerase (Genecraft Germany) was used for PCR. After the PCR, the amplified DNA fragments were analyzed by 1% agarose gel electrophoresis.
Real-time PCR was carried out with the DNA Master SYBR Green I kit (Roche, Mannheim, Germany) using a LightCycler 480 apparatus (Multiwell Plate 96/384, Roche). The specific primers were used for real-time PCR shown in Table6. The house-keeping gene ribosomal protein β-actin was used for normalization.
For the determination of the viral nucleic acids, reverse transcription was carried out according to the manufacturer’s instructions using the Thermosctipt TM RT-PCR kit (Invitrogen, Carlsbad, USA). Briefly, 500 ng lung-extracted RNA and random hexamer primers (Invitrogen) were mixed and denatured at 70 °C for 8 min, followed by reverse transcription at 60°C for 1 h. Reactions were terminated by incubating the mixture at 85°C for 5 min and RNase H treatment at 37°C for 20 min. Samples were diluted to a final volume 50 ml and stored at -20°C. 5 µl of cDNA product were amplified with specific primers. For HA analysis, the following primers were used: HA01 (5’-CCAGAATATACAC CCAGTCACAAT-3’) and HA02 (5’- GATCCGCTGCATAGCCTGAT -3’). For the external standard curve, serial dilutions (between 1010 and 102 molecules) of in vitro transcribed pGEM-T Easy-HA RNA were used. Real-time PCR was carried out with the DNA Master SYBR Green I kit (Roche, Mannheim, Germany) using a
37
LightCycler 480 apparatus (Multiwell Plate 96 or 384, Roche). The housekeeping gene β-actin was used for normalization.
2.2.1.6 ELISA assays
ELISA was used for detection of the interferons following the manufacturer’s protocol (PBL, Germany). The detection of the virus-specific antibodies in the serum was performed as follows: virus was diluted 1:1000 with PBS buffer and this solution was used to coat the micro-plate with 100 µl per well by incubating the micro-plate at 37°C overnight. Afterwards, the plate was washed 3 times with wash buffer (PBS with 0.05%
Tween20), then blocked with 100µl blocking buffer (PBS with 0.05% Tween 20 and 5%
FCS) per well at 37°C for 1 hour. After blocking serum samples were added at a dilution of 1:200 in block buffer and the plate was incubated at 37°C for 2 hours. Then the plate was washed 3 times with wash buffer and loaded with 100µl anti-mouse IgG-HRP or anti-mouse IgG2a-HRP at a dilution of 1:1000 in block buffer, followed by incubation at 37°C for 2 hours. After incubation with the secondary antibody, the plate was washed 3 times with wash buffer and then substrate solution (10ml substrate buffer with 30µl OPD and 4µl H2O2) was added, followed by incubation at room temperature for about 10-20 min or until the color developed.
2.2.2 Cell biology methods
2.2.2.1 Peritoneal macrophage cell isolation
10-12 weeks old mice were used for preparation of peritoneal macrophage by injection of 3ml 3% thioglycollate. Five days after injection, mice were sacrificed with CO2. A transverse cut was made into the inguinal area and the skin was pulled back carefully without destroying the peritoneal wall. The abdominal cavity was washed by injecting 10ml ice cold PBS/1% FCS with a 26G needle. The peritoneum was gently massaged and moved back and forth to distribute the PBS/1% FCS. The PBS+PEC was then collected using a 10ml syringe with a 21G needle and kept on ice. The cells were centrifuged at 170g for 5 min at RT. The pellet was resuspended in 2 ml cell lysis buffer per mouse and incubated for 8-10 min at RT in darkness to lyse the erythrocytes. The remaining cells were centrifuged at 170 g for 5 min at RT and resuspended in 3 ml
38
serum-free medium. Then the cells were plated onto a cell culture plate with the proper concentration. 24h later, the medium of was changed and the cells were ready for use.
2.2.3 Animal procedures 2.2.3.1 Mouse infections
Mice were anesthetized by intra-peritoneal injection with Ketamine-Rompun with doses adjusted to their individual body weight (10μl/g). Virus was administered intra-nasally in a total volume of 20 μl sterile PBS with the dose indicated in the experiments. Sterile PBS was used for the controls. Mice showing a with weight loss of more than 25% or 30% of the starting bodyweight were euthanized and recorded as dead.
2.2.3.2 Tamoxifen treatment
Tamoxifen (TA) stock solution was prepared in peanut oil at concentration of 50mg/ml and stored at -20 °C in aliquots [121]. For the tamoxifen treatment of the inducible Socs3Rosa26Ert2cre mice, the dosage of 30mgtamoxifen/kgbodyweight was used.
Socs3Rosa26Ert2cre mice and wild type mice were intraperitoneally (i.p.) injected five times per week for 2 weeks. TA-treated mice were infected with virus one week after the last TA injection.
2.2.3.3 Acetylsalicylic acid administration
Acetylsalicylic acid (ASA, SIGMA) was dissolved in PBS at concentrations of 5mM, 10mM, and 20mM (pH adjusted to 7.4) and filtered through a 0.22 µm filter (MILLIPORE). DBA/2J mice and non-infected control mice were treated intravenously (i.v. 200 µl) once per day with ASA from day 1 until 7 days post-infection. One hour after the first treatment with ASA, mice were infected with the influenza A virus (PR8).
Acetylsalicylic acid (ASA, SIGMA) was dissolved in PBS at concentrations of 5mM, 10mM, and 20mM (pH adjusted to 7.4) and filtered through a 0.22 µm filter (MILLIPORE). DBA/2J mice and non-infected control mice were treated intravenously (i.v. 200 µl) once per day with ASA from day 1 until 7 days post-infection. One hour after the first treatment with ASA, mice were infected with the influenza A virus (PR8).