Molecular biology methods

Mouse-adapted virus strains influenza A/Puerto Rico/8/34(H1N1, PR8), was propagated in the chorio-allantoic cavity of 10-day-old embryonated hen eggs for 48 hours at 37°C.

Fluid from the chorio-allantoic cavity was collected and the virus was titrated by the FFU assay and stored in aliquots at -70°C until use. The identity of the virus was confirmed by sequence analysis of the HA and NA segments.

The Focus-forming Unit (FFU) assay was used to determine the titer of infectious virus.

Virus titration by foci assay MDCK II cells (American Type Culture Collection, Manassas, USA) were cultured at 37°C in 5% CO2 in Dulbecco’s Modified Eagle Medium (DMEM), supplemented with 10% fetal calf serum (FCS), 1% penicillin/streptomycin. 6x10⁵ cells were seeded in 96-well culture plates and incubated at 37°C in 5% CO2 for 24 h. For foci assay, lungs of mice were homogenized in phosphate buffered saline (PBS) with 0.1% BSA using the Poly Tron 2100 homogenizer. Debris was removed by centrifugation for 10 min at 1000 rpm. The samples were stored in aliquots at -70°C.

Serial 10-fold dilutions of lung homogenates in DMEM containing 0.1% BSA were prepared and added to MDCK II cells. After 1 h, cells were washed twice with PBS and

32

fixed with 4% formalin in PBS (100µl/well). The plates were incubated at 37°C in 5%

CO2 for 1 h. The inoculates were aspirated and replaced with 100 ml of 1% Avicell overlay and incubated at 37°C for 24 h. Subsequently, the plates were washed twice with PBS and fixed with 4% formalin in PBS for 10 min at room temperature. The formalin was removed and the cells were washed and incubated for 10 min with 100 ml/well Quencher (0.5% Triton 6100, 20 mM glycine in PBS). After 10 min, the cells were washed with Wash Buffer (0.5% Tween 20 in PBS) and blocked with 50 ml Blocking Buffer (0.5% Tween 20, 1% BSA in PBS) at 37°C in 5% CO2 for 30 min. The primary antibody (anti-influenza nucleoprotein (NP) polyclonal goat antibody from Virostat, Portland, USA) and the secondary antibody (anti-goat-HRP from KPL, Gaithersburg MD, USA) were diluted 1:1000 in Blocking Buffer. 50 ml of the primary antibody were added to each well and incubated at room temperature for 1 h. After 1 h, the cells were washed three times with Wash Buffer. Then the cells were incubated with 50 ml of the secondary antibody for 45 min, washed again and incubated with 50 ml of substrate (True Blue from KPL) until the blue spots from infected cell foci appeared. The foci were counted and the viral loads were calculated as focus forming units per lung (FFU/lung).

2.2.1.2 DNA preparation and genotyping protocol

Total genomic DNA for genotyping was extracted from the tissue of the tail by overnight digestion with 3μl of 20 μg/ml proteinase K solution in 300μl tail lysis buffer at 55°C.

Proteinase K was inactivated by heat-shock at 90°C for 10 min. 100μl protein precipitation solution was added, mixed gently with the sample and centrifuged for 3min at 13,000rpm. The aqueous phase was transferred into a new tube and 1 volume of 100% iso-propanol was added. The tube was inverted gently and swirled to mix. The DNA was centrifuged down at 13,000 rpm for 3 min. The supernatant was aspired and washed once with 70% ethanol. The pellet was briefly air-dried at room temperature (RT) and was then dissolved in 50μl Hydration solution.

The concentration of nucleic acid was determined by spectrophotometry (Nanodrop-1000 V3.60) according to the manufacturer’s instructions.

33

For the Irf7^-/- mice, the following PCR reaction mixes and programs were applied to PCR softstrips. PCR products (wild type: 300bp, mutant: 200bp):

Component Final concentration Volume

10xPCR buffer 1× 2.0μl

For the Rag2^-/- mice, the following PCR reaction mixes and programs were applied to PCR softstrips. PCR products (wild type: 263bp, mutant: 350bp)

Component Final concentration Volume

10xPCR buffer 1× 2.0μl

34

For the Socs3 flxed allele the following PCR reaction mixes and program were applied to PCR softstrips. Products (wild type: 380bp, mutant: 280bp)

Component Final concentration Volume

10xPCR buffer 1× 2.0μl

35

For the conditional mutant mice, the expression of the Cre recombinase gene was detected by the following protocol (cre+: 350bp)

Component Final concentration Volume

10xPCR buffer 1× 2.0μl

2.2.1.3 Agarose gel electrophoresis

After amplification, the PCR reaction mix was loaded with 1/10 volume agarose loading buffer. Depending on the expected product size, it was applied onto a 1 to 2% (w/v) agarose gel to separate PCR products. Agarose gels were prepared with UltraPureTM agarose (Invitrogen), 1× TAE, and 0.5μg/ml ethidium bromide solution. A 2-log DNA ladder was used to determine the size of the PCR product. The separation took place in 1× TAE running buffer for 45 min at 120 volts in an agarose gel chamber Mupid®-ex (Eurogentec GmbH). PCR fragments were visualized on a UV unit (U-Transilluminator;

Olympus).

36 2.2.1.4 Total RNA isolation and purification

Total RNA was prepared from lungs using the RNeasy Midi kit (Qiagen, Hilden, Germany) following the manufacturer’s protocol. Quality and quantity checks were performed using Agilent 2100 bioanalyzer.

2.2.1.5 Semi-quantitative PPCR and Real-time PCR

Samples contain 500 ng RNA were digested with DNase I (to remove any DNA in the preparation). Subsequently the RNA was subjected to cDNA synthesis with random hexamer primers (Invitrogen) following the program: denatured at 37 °C for 20 min, followed by reverse transcription at 75 °C for 1 h. Samples were diluted to a final volume of 30 µl and stored at -20 °C. 2 µl of cDNA product were amplified with specific primers (Table 5). For RT, the Bioscript^TM (Bioline GmbH,Germany) was used. Taq polymerase (Genecraft Germany) was used for PCR. After the PCR, the amplified DNA fragments were analyzed by 1% agarose gel electrophoresis.

Real-time PCR was carried out with the DNA Master SYBR Green I kit (Roche, Mannheim, Germany) using a LightCycler 480 apparatus (Multiwell Plate 96/384, Roche). The specific primers were used for real-time PCR shown in Table6. The house-keeping gene ribosomal protein β-actin was used for normalization.

For the determination of the viral nucleic acids, reverse transcription was carried out according to the manufacturer’s instructions using the Thermosctipt TM RT-PCR kit (Invitrogen, Carlsbad, USA). Briefly, 500 ng lung-extracted RNA and random hexamer primers (Invitrogen) were mixed and denatured at 70 °C for 8 min, followed by reverse transcription at 60°C for 1 h. Reactions were terminated by incubating the mixture at 85°C for 5 min and RNase H treatment at 37°C for 20 min. Samples were diluted to a final volume 50 ml and stored at -20°C. 5 µl of cDNA product were amplified with specific primers. For HA analysis, the following primers were used: HA01 (5’-CCAGAATATACAC CCAGTCACAAT-3’) and HA02 (5’- GATCCGCTGCATAGCCTGAT -3’). For the external standard curve, serial dilutions (between 10¹⁰ and 10² molecules) of in vitro transcribed pGEM-T Easy-HA RNA were used. Real-time PCR was carried out with the DNA Master SYBR Green I kit (Roche, Mannheim, Germany) using a

37

LightCycler 480 apparatus (Multiwell Plate 96 or 384, Roche). The housekeeping gene β-actin was used for normalization.

2.2.1.6 ELISA assays

ELISA was used for detection of the interferons following the manufacturer’s protocol (PBL, Germany). The detection of the virus-specific antibodies in the serum was performed as follows: virus was diluted 1:1000 with PBS buffer and this solution was used to coat the micro-plate with 100 µl per well by incubating the micro-plate at 37°C overnight. Afterwards, the plate was washed 3 times with wash buffer (PBS with 0.05%

Tween20), then blocked with 100µl blocking buffer (PBS with 0.05% Tween 20 and 5%

FCS) per well at 37°C for 1 hour. After blocking serum samples were added at a dilution of 1:200 in block buffer and the plate was incubated at 37°C for 2 hours. Then the plate was washed 3 times with wash buffer and loaded with 100µl anti-mouse IgG-HRP or anti-mouse IgG2a-HRP at a dilution of 1:1000 in block buffer, followed by incubation at 37°C for 2 hours. After incubation with the secondary antibody, the plate was washed 3 times with wash buffer and then substrate solution (10ml substrate buffer with 30µl OPD and 4µl H2O2) was added, followed by incubation at room temperature for about 10-20 min or until the color developed.