SI MATERIAL AND METHODS

Chemicals. SQ and SL were synthesized chemically and identified by NMR and MS as described elsewhere (Mayer et al. 2010, Denger et al. 2012). GP, PG, KDPG, and GAP were from Sigma-Aldrich. Biochemicals (NAD⁺, NADP⁺, NADH, and NADPH) were purchased from Biomol. All other chemicals were of the highest purity available from Sigma-Aldrich, Fluka, Roth, or Merck.

Growth conditions. P. putida SQ1 (DSM 100120) (Denger et al. 2012) was grown in phosphate-buffered, mineral salts medium (pH 7.2) (Thurnheer et al. 1986) and supplemented with SQ (6 or 12 mM), glucose (6 mM), or succinate (9 mM) as the sole carbon and energy source. Cultures on the 2-mL and 5-mL scales were incubated in glass tubes (Corning) in a roller, and cultures on the 30-mL and 200-mL scales were incubated in capped Erlenmeyer flasks on a shaker, each at 30 °C in the dark. The cultures were inoculated (1%) with precultures grown with the same substrate. For cultures in Erlenmeyer flasks, 0.8-mL samples were taken at intervals to monitor growth at OD580.

Preparation of cell-free extracts. P. putida cells from cultures on the 200-mL scale were harvested at an OD580 of about 0.5 by centrifugation (20,000 × g, 15 min, 4 °C) and were disrupted by three passages through a chilled French pressure cell (140 MPa; Aminco) in the presence of DNase (25 μg·mL⁻¹). Whole cells and cell debris were removed by centrifugation (11,000 × g, 10 min, 4 °C), which yielded crude extract, and the membrane fragments were collected by ultracentrifugation (100,000 × g, 60 min, 4 °C); this supernatant was called soluble protein fraction.

Proteomics. A draft genome sequence of P. putida SQ1 for proteomics was established under contract by GATC Biotech using the Illumina HiSeq2000 platform and a 100-bp paired-end library, which resulted in 23,816,201 reads (1.85 × 109 total bases); trimming, mapping, and de novo assembly of the unmapped raw reads were performed at the Genomics Center of the University of Konstanz (Felux et al. 2015A). The sequences were annotated within the Joint Genome Institute’s analysis system (Markowitz et al. 2014), and the annotation (http://

img.jgi.doe.gov; IMG Project ID Gp0039102) was used to build a local Mascot database (Perkins et al. 1999) for PF-MS. For 2D isoelectric focusing (IEF)-SDS/PAGE (2D-PAGE) of the soluble protein fraction of P. putida cells, the Bio-Rad ReadyStrip immobilized pH

gradient (IPG) system was used for the first dimension separation (17 cm length; pI range, pH 4–7) and 12% SDS/PAGE gels (17 × 20 cm; no stacking gel) were used for the second-dimension separation; sample preparation and IEF separation conditions were essentially as described in the manufacturer’s instructions (Bio-Rad Ready-Strip IPG strip instruction manual), with the modifications described previously (Schmidt et al. 2013). Stained protein spots were cut from the gel and subjected to PF-MS at the Proteomics Facility of the University of Konstanz (www.proteomics-facility.uni-konstanz.de); the parameters for mass spectral analysis and Mascot database searching and scoring were set as previously described (Schmidt et al. 2013). For total proteomics of the soluble protein fraction, the sample preparation, gel purification, tryptic digest, high-resolution PF-MS (Orbitrap-MS) analysis, and Mascot database searching were performed according to our previously published protocol (Gutiérrez Acosta et al. 2014).

Transcriptional analysis. RNA preparation and RT-PCR assays were carried out according to our previously published protocol (Weiss et al. 2012). Briefly, cells were grown in the appropriate selective medium on a 30-mL scale and harvested in the mid-exponential growth phase (OD₅₈₀ ∼ 0.28) by centrifugation (15,000 × g, 15 min, 4 °C). The cell pellets were stored at -20°C in RNAlater RNA stabilization solution (Applied Biosystems). Total RNA was prepared using the E.Z.N.A. Bacterial RNA Kit (Omega Bio-Tek) following the manufacturer’s instructions; the RNA preparations were treated with RNase-free DNase (2 units, 30 min, 37 °C; Fermentas). For complementary cDNA synthesis, Maxima reverse transcriptase (Fermentas) was used. For PCR reactions, Taq polymerase (Fermentas) was used with cDNA from RT reactions as a template (2 μL of RT reaction in 20 μL of PCR mixture).

The primer pairs used (Microsynth) are listed in Table S1.

Construction of an insertion mutant. For the generation of an insertion mutant in the SQ-dehydrogenase gene PpSQ1_00090, an internal 500-bp sequence of gene 0090 was amplified with Primer pKO_0090_F GGGCAAGGGCTGGC-3′) and pKO_0090_R (5′-TGAAGGCCTGGCTGGCC-3′) by PCR assay using Taq polymerase. The PCR fragment was cloned into the vector PCR2.1 using a Topo TA Cloning Kit (Invitrogen), and the correct sequence of the resulting plasmid PCR2.1[KO0090] was confirmed by sequencing (GATC Biotech). One feature of this plasmid is its restricted host range, which makes it suitable as a vector for insertional mutagenesis via homologous recombination in P. putida SQ1. For preparation of electrocompetent cells, strain SQ1 was grown in 100 mL of LB (OD600 = 0.8;

shaking at 180 rpm, 30 °C). Cells were harvested and washed three times by centrifugation at

9.500 × g for 5 min and resuspended in 50 mL, 25 mL, and 10 mL of sucrose solution (300 mM), respectively. Finally, the cells were resuspended in 500 μL of sucrose solution (300 mM). Each 100-μL portion of electrocompetent cells was transferred into a 0.2-cm electroporation cuvette (Biorad); mixed with 10 μL (800 ng) of PCR2.1[KO0090] plasmid DNA; and electroporated using an Eppendorf Gene Pulser at 2.5 V, 200 Ω, and 25 μF. After recovery in 2 mL of LB in a 15-mL Falcon tube (shaking at 180 rpm, 30 °C), the insertion mutants were selected on LB-agar containing 20 μg·mL⁻¹ kanamycin. After incubation for 24 h at 30 °C, colonies were restreaked onto fresh plates and the correct insertion of PCR2.1 into the target gene 0090 was confirmed by colony PCR assay using the primers 0089_REV (Table S1) and M13mod_FOR (5′-TTGTAAAACGACGGCCAGTGAAT- 3′); these primers bind downstream of the target gene 0090 and in the PCR2.1 sequence, respectively. Growth of mutants was tested in 6 mM SQ- or glucose minimal salts medium (as discussed above) supplemented with μg·mL⁻¹ kanamycin.

Heterologous overproduction and purification of His-tagged proteins. Heterologous expression of candidate genes and subsequent purification of the recombinant proteins were carried out according to our previously published protocol (Felux et al. 2013). In brief, chromosomal DNA of P. putida SQ1 was isolated (Illustra bacterial genomic Prep Mini Spin kit; GE Healthcare), the candidate genes were amplified by PCR using Phusion HF DNA Polymerase (Finnzymes), and the primer pairs are listed in Table S2. The PCR conditions (30 cycles) were 15 s of denaturation at 98 °C, 20 s of annealing at 58 °C, and 60 s of elongation at 72 °C for genes PpSQ1_00088 and 0090; 32 s of elongation at 72 °C for gene PpSQ1_00091; 20 s of annealing at 62 °C for gene PpSQ1_00089; and 20 s of annealing at 57

°C and 30 s of elongation at 72 °C for gene PpSQ1_00100. The PCR products were purified (QIAquick MinElute PCR Purification Kit, Qiagen) and ligated into an N-terminal His6 -tagged expression vector (Champion pET 100 directional TOPO Expression Kit; Invitrogen).

The constructs were transformed into OneShot TOP10 E. coli cells (Invitrogen) and confirmed by DNA sequencing (GATC Biotech). BL21 Star (DE3) OneShot E. coli cells (Invitrogen) were transformed with the constructs and grown at 37 °C in LB (100 mg · L^-1 ampicillin). Cultures were induced (0.5 mM isopropyl-β-D-thiogalactopyranoside) at an OD580 of 0.8 and grown for an additional 5 h at 20 °C. After harvesting by centrifugation (15,000 × g, 15 min, 4 °C), the cells were resuspended in 20 mM Tris HCl (pH 8.0; buffer A) containing 0.03 mg · mL^-1 DNase I (Sigma) and then disrupted by four passages through a chilled French pressure cell (140 MPa; Aminco). Whole cells and debris were removed by centrifugation (15,000 × g, 15 min, 4 °C), and the membrane fragments were removed by

ultracentrifugation (100,000 × g, 60 min, 4 °C). The soluble protein fractions were loaded assayed spectrophotometrically as the formation of the coproduct NADH/NADPH recorded at 365 nm for 1 min; the standard reaction mixture (1 mL) contained 50 mM Tris HCl (pH 8.0), 1 mM SQ or GP, 2 mM NAD⁺ or NADP⁺, and 2 μg of recombinant protein or 50 μg of soluble protein fraction, respectively. The kinetic parameters for recombinant SQ and GP dehydrogenase were determined when the substrate concentrations were varied, and the activities were plotted using hyperbolic fit in Origin (Microcal Software, Inc.); the pH optimum was determined when the pH of the reaction buffer was varied (Cleland 1982). SLA as a substrate for the SLA dehydrogenase assay was prepared in reactions of recombinant SLA reductase of E. coli K-12 (YihU; 5 μg·mL⁻¹) (Denger et al. 2014) with DHPS (1 mM) and NAD⁺ (4 mM) in reaction buffer [50 mM Tris HCl (pH 8.0)]; the reverse reaction of the SLA reductase was monitored spectrophotometrically as formation of the coproduct NADH at 365 nm in the presence and absence of recombinant SLA dehydrogenase. Analysis of substrate disappearance and product formation by HPLC/MS (as discussed below) in reactions with cell-free extract of SQ- or glucose-grown P. putida SQ1 cells was done on the 0.3-mL scale in 50 mM Tris HCl buffer (pH 7.3) at room temperature (∼20–23 °C). The reactions contained a soluble protein fraction (50 μg of protein per milliliter) and SQ or GP (1 mM), and were started by addition of NAD⁺ (3 mM); at intervals (t = 0, 5, 30, and 90 min), samples (66 μL) were taken, to which acetonitrile (33 μL) was added. Analysis of substrate disappearance and product formation by HPLC/MS in reactions with recombinant enzymes was carried out on a 1-mL scale in 50 mM Tris HCl buffer (pH 7.5) stirred at room temperature. The recombinant enzymes (50 μg·mL⁻¹ each) were added one after another to reaction mixtures that contained SQ (2 mM) and NAD⁺ (3 mM); after 45 min of reaction time, a sample (66 μL) was taken, to which acetonitrile (33 μL) was added, and the next enzyme was added until the reaction sequence had been completed in the following order: SQ dehydrogenase, lactonase, dehydratase, aldolase, and SLA dehydrogenase. Activity of recombinant SG dehydratases and KDSG aldolase with authentic PG and KDPG as

substrates, respectively (2 mM), was tested by HPLC-MS/MS analysis under the same reaction and sampling conditions.

Analytical methods. For HPLC-electrospray ionization (ESI)-MS/MS, an Agilent 1100 HPLC system fitted with a ZIC-HILIC column (5 μm, 200 Å, 150 × 4.6 mm; Merck) was connected to an LCQ ion trap mass spectrometer (Thermo Fisher Scientific). The HPLC conditions were as follows: from 90% B to 65% B in 25 min, 65% for 10 min, back to 90% B in 0.5 min, and 90% B column equilibration for 9.5 min. Solvent A was 90% 0.1 M ammonium acetate and 10% acetonitrile, and solvent B was acetonitrile. The flow rate was set to 0.75 mL·min⁻¹. The mass spectrometer was run in ESI negative mode. The retention times and ESI-MS/MS fragmentation patterns of SQ and SLA were the same as described and shown previously (Denger et al. 2014). The retention times and ESI-MS/MS fragmentation patterns of the other analytes were observed as follows: SGL retention time, 20.4 min; SGL ESI-MS m/z (% base-peak) 241 (100); SGL ESI-MS/MS of [M-H]⁻ 241: 241 (26), 223 (4), described previously (Müller et al. 2008); briefly, an Aminex HPX-87H ion-exchange column (BioRad) at 60 °C was used, and the eluent was 5 mM H2SO4 at a flow rate of 0.6 mL·min⁻¹; pyruvate eluted at 9.3 min.

Enzyme nomenclature. We suggest that SQ dehydrogenase belongs to the NC-IUBMB (Nomenclature Commission of the International Union of Biochemistry and Molecular Biology) subgroup EC 1.1.1, with the name sulfoquinovose dehydrogenase [NAD⁺] (systematic name sulfoquinovose: NAD⁺ 1-oxidoreductase). The SLA dehydrogenase would then belong to subgroup EC 1.2.1, with the name sulfolactaldehyde dehydrogenase [NAD(P)⁺] (systematic name 3-sulfolactaldehyde:NAD(P)⁺ oxidoreductase). The SGL lactonase would belong to EC 3.1.1, with the name sulfogluconolactonase (systematic name 6-deoxy-6-sulfoglucono-1,5-lactone lactonohydrolase). The SG dehydratase would belong to EC 4.2.1, with the name sulfogluconate dehydratase (systematic name

6-deoxy-6-sulfogluconate hydro-lyase [2-dehydro-3,6-dideoxy-6-6-deoxy-6-sulfogluconate-forming]). The KDSG aldolase would belong to EC 4.1.2, with the name 2-dehydro-3,6-dideoxy-6-sulfogluconate aldolase [systematic name 2-dehydro-3,6-dideoxy-6-sulfogluconate 3-sulfolactaldehydelyase (pyruvate-forming)].

Fig. S1. MS/MS fragmentation of SGL, SG, and KDSG. (A) Fragment ions of the [M-H]⁻ ions of SGL. Fragmentation led to a loss of water (-18) and carbon dioxide (-44), and to the formation of HSO3−

(81) ions. (B) Fragment ions of the [M-H]⁻ ions of SG. Fragmentation led to a loss of water (-18), CH2O2 (-46), C2H4O3 (-76), and SO3− (-80), concomitant with the formation of HSO3− (81) ions.

(C) Fragment ions of the [M-H]⁻ ions of KDSG. Fragmentation led mainly to a loss of water (-18) and carbon dioxide (-44), and to the formation of HSO3

− (81) ions.

Fig. S2. MS/MS fragmentation of SLA and SL. (A) Fragment ions of the [M-H]⁻ ions of SLA.

Fragmentation led to a loss of water (-18) and to the formation HSO3− (81) and C3H3O2− (71) ions. (B) Fragment ions of the [M-H]⁻ ions of SL. Fragmentation led to a loss of water (-18) and to the formation HSO3

− (81) ions.

Fig. S3. Growth experiment with P. putida SQ1 WT (A) and its insertion mutant (B) in gene 0090 (SQ dehydrogenase). Duplicate growth experiments are shown with glucose (open symbols) and SQ (solid symbols) as growth substrate in liquid cultures (6 mM each). Growth was monitored as optical density (OD580).

Fig. S4. Analysis of the purity of heterologously overproduced enzymes using SDS-PAGE. Marker proteins are indicated (kilo Daltons). Lane A, SQ dehydrogenase (PpSQ1_00090); lane B, SGL lactonase (PpSQ1_00091); lane C, SG dehydratase (PpSQ1_00089); lane D, KDSG aldolase (PpSQ1_00100); lane E, SLA dehydrogenase (PpSQ1_00088); and lane F, GP dehydrogenase (Zwf-1, PpSQ1_03570). The protein bands with a lower molecular mass than expected in lane C represent C-terminally truncated versions of the recombinant His-tagged protein, as determined by PF-MS.

0

Table S1. Primer pairs used for RT-PCR

Primer name Sequence (5’ -3’) product length, bp

0088_FOR AGCCGACCGTGCTCACTGAAGTTA 215

Table S2. Primer pairs used for directional cloning

PpSQ1_00088f * CACCATGCTCGAACTCAAAGACCCTTCT

PpSQ1_00088r GTATCGGACATGGGGCTACTCTATG

PpSQ1_00089f * CACCATGTCCGAAAAGCACAAGAAA

PpSQ1_00089r TCAGTGGATGGGTGGCTC

PpSQ1_00090f * CACCATGAACCGTCATACCGATACGCATTAC

PpSQ1_00090r CTGACGTCAATCAGGGTGGATTACTG

PpSQ1_00091f * CACCATGAATGAAACGCTGAAGTGTGTGG

PpSQ1_00091r GGTTCATGATAGGAAGCTCGTGAATG

PpSQ1_00100f * CACCATGTCCACTGCTGTCACG

PpSQ1_00100r TCAGTAGGCTGTCGCTAC

PpSQ1_03570f * CACCATGGCTGCGATCAGTGTTGAACCT

PpSQ1_03570r TGATGCGCCTTGACCGATGTC

* primer with adaptor sequence for directional cloning (underlined).

CHAPTER 5