1 G186T_A187C_G189T CATCCTGGCCCATCGTCGTATGCGCACAGTCACC
2 A391C_G393T GCCATTGCTGCCGACCGTTACATGGCCATCGTC
3 G426T CCTTCCAGCCTCGTCTTTCAGCTCCCAG
4 A676C_G678T CCTCACGCTCTGGCGTCGCGCAGTGCCCG
5 A937C_G939T_ G957T GTCTCAACCACCGTTTTCGCTCTGGGTTCCGTCTTGCCTTCCGC 6 A1039C_A1041T_A10
48C_G1050T
CCTCCCTCTCCACGCGTGTCAACCGTTGTCACACTAAGGAG
7 A1146G CAGGATGGATCAGGGCTGTGGTTTGGGTATGGTTTG
15 C87G CCTTCTCCATGCCGAGCTGGCAGCTGG
16 C339G CCAGAACCTCTTCCCGATCACAGCCATGTTTG
17 C414G_C438G CATCGTCCACCCGTTCCAGCCTCGGCTTTCAGCTCCGAGCACCA
AGG
18 C558G GTGGTGGCCTGGCCGGAAGACAGCGGG
19 C690G CGTCGCGCAGTGCCGGGACATCAGGCG
20 C795G CATCTGCTGGCTGCCGTACCACCTCTACTTC
21 C912G CTCTACCATGTACAATCCGATCATCTACTGCTGTCTC
109
Expression of NK2R – MBP fusion protein
22 C990G GCCCATGGGTCACACCGACCAAGGAAGAT
23 C1020G CTCGAGCTGACTCCGACGACCTCCCTCTCC
24 C1095G GGGGACACAGCCCCGTCCGAGGCTACC
25 C1128G GAGGCGGGGCGTCCGCAGGATGGATCAG
26 C1173G GTATGGTTTGCTTGCCCCGACCAAAACTCATGTTG
Table 1: List of oligonucleotides used for exchanging rare codons present in NK2R gene.
Exchanged nucleotides are underlined. Arginine rare codons AGG, AGA were replaced with CGT; Leucine rare codon CTA was replaced with CTG and Proline rare codon CCC was replaced with CCG
Expression of the MBP-hNK2R fusion protein in E.coli
The plasmid harboring the mbp-hnk2R gene was transformed into BL21 (DE3) RIPL cells. The cells were plated onto Luria-Bertani (LB)-agar plus 100 µg/ml ampicillin and 1%
(w/v) glucose to suppress expression. For the expression of the MBP-hNK2R fusion protein, 10 ml of an overnight culture (LB supplemented with 1% (w/v) glucose and 100 µg/ml ampicillin) were used to inoculate 1 liter of LB media supplemented with 0.2% (w/v) glucose in a 2 litre flask. The cells were grown at 37 °C in an incubator under shaking at 200 rpm. When the OD at 600 nm reached 0.5, the expression of the MBP-hNK2R was induced with 1 mM isopropyl-β-D-thiogalactoside (IPTG) and the cells were incubated for another 16 h at 20°C. The cells were harvested by centrifugation (4000 g, 4 °C), resuspended in 8 ml lysis buffer per mg of wet cell
110
paste, and then stored at –20 °C. The lysis buffer was composed of 20 mM Tris-HCl, pH 7.5, 200 mM NaCl, 1 mM EDTA, and a protease inhibitor cocktail tablet from Roche.
Analysis of the Expression of the MBP-hNK2R fusion protein in E.coli
The frozen cells were thawed on ice and broken by sonication with a W-450D Branson digital sonifier for 2 min (at 15 % power, 15 s pulse cycle). The cell suspension was centrifuged at 9000 g for 20 mins at 4 °C to separate the cell debris and the supernatant to obtain a crude extract (CE). Subsequently, 20 µl CE, containing the expressed fusion protein, were treated with 10 µl of 3X sample buffer (163 mM Tris–HCl, pH 6.8, containing 0.25 mg/ml bromophenol blue, 0.5% SDS, and 50% glycerol). The mixture was subject to SDS–PAGE [26] with gels containing 12% acrylamide. These gels were analyzed by Coomassie staining and also by a Western blot. The samples were not boiled prior to loading them onto the gels as aggregation of the protein was observed similar to previous reports on the analysis of the hNK1R [27].
For Western blots [28], the proteins were transferred from the gel to a nitrocellulose paper (Millipore, USA) and detected using anti-NK2R antibodies (Abcam Cambridge, UK). In addition, anti-rabbit IgG horseradish peroxidase (Sigma, Germany) was used as a secondary antibody. The immunoreactive bands were detected using the ECL Chemiluminescence Detection Kit (Pierce, Germany) and visualized with an LAS-300 intelligent dark box (Fuji, USA)
Purification of the MBP-hNK2R fusion protein
The CE was diluted to 1:5 times with buffer A (20 mM Tris-HCl, 200 mM NaCl, 1 mM EDTA, 0.1% LDAO pH 7.5). To obtain highly pure and LDAO solubilized MBP-hNK2R, a
two-111
Expression of NK2R – MBP fusion protein step purification protocol was employed. In the first step, an amylose affinity chromatography was performed with an ÄKTA Purifier HPLC/FPLC system (GE health care). A column containing 4 ml amylose resin was first equilibrated with buffer A. The diluted CE was loaded onto this column at a flow rate of 1 ml/min. The column was then washed extensively with 5 column volumes of buffer A. The MBP-hNK2R was eluted with buffer B (20mM Tris-HCl, 1 mM EDTA, 0.1% LDAO, 10 mM Maltose pH 7.5). In the second purification step, a 10 ml CM-sepharose column was equilibrated with buffer C (20mM Tris-HCl, 1 mM EDTA, 0.1% LDAO).
The MBP-hNK2R was loaded onto this column at a flow rate of 1 ml/min. The column was washed extensively with 5 column volumes of buffer C to remove weakly bound contaminants.
The purified MBP-hNK2R was eluted by a 500 mM NaCl gradient.
Cleavage of the MBP-hNK2R fusion protein and isolation of the hNK2R
The fusion partner MBP was then cleaved off by the protease Factor Xa. Briefly, the purified MBP-hNK2R was dialyzed against cleavage buffer (20 mM Tris-HCl, 100 mM NaCl, 2 mM CaCl2 and 0.1% LDAO pH 7.5) for 16 h at 4 °C. After dialysis, 100 µg of fusion protein in cleavage buffer were incubated with 10 µg Factor Xa protease (10% w/w) for 16 h at 8°C. The cleavage products were dialyzed against buffer D (20 mM Tris-HCl, 25 mM NaCl and 0.1%
LDAO pH 7.5), loaded onto a 10 ml CM-sepharose column, and washed extensively with 5 column volumes of buffer D. The purified hNK2R was then eluted using buffer D containing 500 mM NaCl. The concentration of the purified hNK2R was estimated using the Lowry method [29].
112
In-gel digestion and mass spectroscopy analysis of the purified hNK2R
The purified hNK2R was resolved on SDS–PAGE and stained with Coomassie blue dye.
The band corresponding to the purified hNK2R was excised and the gel slices were destained using 50 % (w/v) acetonitrile in 0.05 M NH4HCO3. hNK2R with dithiothreitol and alkylation with iodoacetamide were performed using Mann’s protocol [30]. The prepared dried gel pieces were swollen in a digestion buffer containing 0.02 µg/µL trypsin (Promega) in 50 mM NH4HCO3 solution. After incubation at 4°C for 45 min, the trypsin solution was removed and 100 mM NH4HCO3 was added to the gel pieces. The enzymatic digestion was carried out at 37°C overnight. The peptides were extracted 2–3 times with 0.2 mL of 60% (w/v) acetonitrile and 1% (w/v) TFA in 100 mL of water. The sample solution was dried down and reconstituted in a 5% (w/v) acetonitrile-water mixture with 0.1% (w/v) TFA for a mass spectrometric analysis.
The mass spectroscopic analysis was performed in the Proteomics facility of the University of Konstanz using an LC-ESI-MS mass spectrometer (Xevo QT, Waters, MA, USA).
Radioligand binding assay to determine the functional activity of the hNK2R
Radioligand binding assays were performed on the crude extract (CE) and on the purified LDAO solubilized hNK2R to determine whether the protein was functionally active.
Approximately 3 µg of hNK2R were diluted in 500 µL of assay buffer (50 mM Tris–HCl, 10 mM EDTA pH 7.5) and incubated with 10 nM of NK2R antagonist, [3H] SR-48968 (20 Ci/mmol, Perkin Elmer) for 1 h at 4°C to determine the total binding (T). The total binding includes the binding of the antagonist to the receptor as well as to the membranes and buffer components.
Non-specific binding was assayed by incubating the receptor with 10 nM of [3H] SR-48968 in the presence of 1000-fold excess of non-labeled SR-48968 (10 µM) for 1 h at
113
Expression of NK2R – MBP fusion protein 4 °C. The 1000-fold excess of non-labeled SR-48968 will displace the ligand bound to the receptor because the binding is reversible. However, the ligand bound to the membranes and buffer components will not be displaced. Therefore, the difference between the count per minute (CPM) of total and nonspecific binding gives the specific binding of the ligand.
The bound and free ligands were separated by rapid filtration on a Whatman GF/B filter, which was soaked in 0.3% polyethylimine. The filters were washed three times with 10 mM Tris–HCl, pH 7.5 and then incubated with 3 ml of Emulsifier SafeTM (Packard) for 5 mins prior to scintillation counting in a Tricarb TR liquid scintillation analyser (5 min/sample). All samples were assayed in triplicate. The binding of the antagonist was measured as count per minute (CPM) using the liquid scintillation counter. Specific binding was determined using the following formula.
T (total binding)-NSB (non-specific binding) = SB (specific binding)
T represents the total number of counts for samples incubated with [3H] SR-48968. NSB represents total number of counts for samples incubated with [3H] SR-48968 in the presence of unlabelled SR-48968.
Circular dichroism spectra of the purified hNK2R
Far UV circular dichroism (CD) spectra of 6.4 µM of hNK2R in buffer D were recorded at room temperature with a Jasco 715 CD spectrophotometer (Jasco, Tokyo, Japan) using a quartz glass cuvette with 0.5 mm path length. Three scans were accumulated from 190–250 nm with a response time of 8 s, a bandwidth of 1 nm and a scan speed of 50 nm/min. Background spectra of buffer D without the hNK2R were subtracted. The CD spectra were normalized to obtain the mean residue molar ellipticity [Θ](λ) using the following equation
114
[Θ](λ) = 100 [31]
Θ(λ) c · n · l
where l is the path length of the cuvette in cm, Θ(λ) is the recorded ellipticity in degrees at the wavelength λ, c is the concentration in mol/l, and n is the number of amino acid residues of the hNK2R.
Results
Expression of the hNK2R as a fusion protein in E.coli
Since the hNK2R is scarce and difficult to isolate from the host cells, we attempted its heterologous overexpression in E. coli. Previously, a similar strategy has led to the successful expression of another tachykinin receptor, hNK1R, which was expressed in truncated form lacking the last 42 residues using an pET-23b vector in form of inclusion bodies in E.coli [27].
Our first attempts to express the hNK2R using a pET-22b vector with the nk2r gene cloned between the NdeI and HindIII restriction sites did not result in the desired milligram levels of hNK2R (data not shown), consistent with the earlier report [27]. Previously, the GPCRs human peripheral cannabinoid receptor and β2-adrenergic receptor were expressed in E.coli as fusion proteins with two partners, maltose binding protein (MBP) at the N- and thioredoxin at the C-terminus [32]. In case of the human β2-adrenergic receptor, expression levels were sufficient for its structure determination [33]. Therefore, we next examined whether hNK2R can be isolated in milligram amounts when fused to the C-terminus of the native E. coli protein MBP.
MBP of E. coli, lacking the malE signal sequence at its N-terminus, was fused to the Factor Xa cleavage site (Asp-Asp-Asp-Asp-Lys) and to the N-terminus of hNK2R on the DNA
115
Expression of NK2R – MBP fusion protein level to express the fusion protein MBP-hNK2R (Fig. 1) for subsequent cleavage of MBP with the protease Factor Xa to obtain hNK2R. The deletion of the MBP leader sequence facilitated the cytoplasmic expression of the MBP-hNK2R fusion protein in form of inclusion bodies and increased the expression yield. However, the amounts of the hNK2R obtained in this way were disappointingly low. This might have been caused by the codon usage in the hnk2r gene, which contains codons that are rarely used in E.coli. The lack of E.coli tRNA with the corresponding anticodons could explain these low expression levels. In order to examine this possibility, we transformed E. coli BL21 (DE3) RIPL cells with our expression vector. The RIPL cells contain extra copies of tRNA genes, designed to overcome the lack of tRNA that may be required for translation of the hnk2R gene. Here, the use of these RIPL E. coli did not improve the expression of MBP-hNK2R.
malE Factor Xa hNK2R His6
Figure 1: Schematic representation of the recombinant construct for heterologous production of the human NK2R in E.coli. malE, coding region for E.coli Maltose binding protein (without signal sequence); Factor Xa, protease cleavage site; hNK2R, coding region for human NK2R;
His6, Histidine 6 tag.
Previously, attempts to obtain GPCRs from Rosetta E. coli (DE3) cells, which are similar to the RIPL strains used in the present work, resulted in high level expression for just one out of nine GPCRs [27]. However, Bane et al. [27] did not attempt to replace those codons in the genes of the GPCRs that are rare in E. coli against codons that are more commonly used by these cells.
To completely rule out the possibility that the E. coli codon bias causes the lack of hNK2R 116
expression in our expression trials, we performed a rare codon replacement. Baneres et al. [34]
have reported that the exchange of the rare codons dramatically improved the expression of the leukotriene receptor BLT1. In our present work, the hNK2R was successfully expressed in milligram amounts as a fusion protein with the MBP after exchange of the rare E. coli codons in the hnk2R gene. The MBP-hNK2R fusion protein was detected by western blot analysis using anti-NK2R antibodies. The blot showed a band at an apparent molecular mass of 85 kDa, which corresponded to the molecular mass of the fusion protein (Fig. 2). Additional attempts to express hNK2R after codon exchange in hnk2R, but in the absence of the fusion partner MBP were unsuccessful. The fusion partner and the codon replacement were both required for the NK2R expression in milligram amounts.
A B C 95 kDa
72 kDa 55 kDa 43 kDa
Figure 2: Comparison of the expression of the MBP-hNK2R with and without codon exchange.
Expressed protein was identified by western blot analysis using anti-NK2R antibody.
(A) Prestained Molecular weight marker (Fermentas), (B) Expression of MBP-hNK2R before codon exchange, (C) Expression of MBP-hNK2R after codon exchange.
117
Expression of NK2R – MBP fusion protein Purification of the MBP-hNK2R fusion protein
The purification of the MBP-hNK2R was performed using an amylose column, taking advantage of the affinity between MBP and amylose molecules. Following the elution from the amylose column, the hNK2R was not completely pure, possibly because of endogenous amylose present in E. coli. The presence of 0.2% glucose did not reduce the endogenous amylose production. Therefore, we decided to perform a second purification step using the weak cation exchanger CM-sepharose and FPLC. The purity of the MBP-hNK2R was determined by SDS-PAGE. Both, coomassie brilliant blue and silver nitrate staining of the gels indicated that the purity of the MBP-hNK2R fusion protein was ~95 %. The identity of the MBP-hNK2R was confirmed using anti-NK2R antibodies (Fig 3).
A B C D
95 kDa 72 kDa 55 kDa 43 kDa
Figure 3: Purification of MBP-hNK2R by an amylose affinity column and subsequent CM-sepharose cation exchange column. (A) Protein eluted from amylose affinity column –
coomassie blue staining, (B) Protein eluted from CM-sepharose column – coomassie blue staining, (C) Silver nitrate staining, (D) Western blot analysis with anti-NK2R antibody.
118
Cleavage of the MBP-hNK2R fusion protein and isolation of the hNK2R
The purified MBP-hNK2R was subjected to cleavage with Factor Xa protease to remove the MBP. For an optimization, the cleavage of the fusion protein was tested at various temperatures and it was most efficient at 8 °C. The inclusion of additives like SDS, urea, and SR-48968 did not improve the cleavage efficiency (data not shown). After cleavage and its purification over a CM-sepharose column, hNK2R was confirmed using anti-NK2R antibodies (Fig 4). The purified hNK2 receptor migrated at an apparent molecular weight of ~40 kDa, i.e.
slightly below its calculated molecular weight of 44 kDa. This altered electrophoretic mobility of membrane proteins has been described previously for other GPCRs [27, 35]. The yield of pure hNK2R was 0.3 mg per liter of E.coli culture as determined by the Lowry method. Our optimized expression levels will facilitate the development of a refolding procedure for subsequent biochemical and biophysical studies on the structure and function of the hNK2R.
A B 95 kDa
72 kDa 55 kDa 43 kDa
Figure 4: Cleavage of MBP-hNK2R with Factor Xa and subsequent purification using CM-sepharose column. Protein confirmed with Anti-NK2R antibody. (A) hNK2R after cleavage, (B) MBP-hNK2R before cleavage.
119
Expression of NK2R – MBP fusion protein Mass spectroscopic analysis of the purified hNK2R
To confirm the identity of the expressed protein, a mass spectroscopic analysis was performed. The single band of the hNK2R at 40kDa, obtained by SDS-PAGE, was excised and in-gel digested with trypsin. Figure 5 shows the mass spectroscopic analysis of hNK2R. Three peptides arising from the hNK2R were identified. The identified peptides, their positions along the hNk2R polypeptide chain and their corresponding masses are listed in Table 2 and also indicated in the mass spectrum (Figure 5). The peptides were derived from the cytoplasmic domains of the hNK2R. The peptide sequences and the obtained masses were in agreement with the calculated masses of the hNK2R. One of the peptides was derived from the C-terminal domain of the hNK2R thus confirming the isolated receptor is indeed the full length hNK2R.
Observed Mass (Da) Peptide sequence Position
687.85 845.95 659.86
YMAIVHPFQPR EDKLELTPTTSLST
LELTPTTSLSTR
132-142 333-346 336-347
Table 2: Detection of the peptides derived from hNK2 receptor expressed in E.coli by LC-MS/MS.
120
Figure 5: Mass spectrum of the tryptic digest derived from the purified hNK2 receptor. Peptide mixtures obtained after in-gel trypsin digestion. Peptides corresponding to their molecular masses are indicated.
EDKLELTPTTSLST
LELTPTTSLSTR
121
Expression of NK2R – MBP fusion protein Analysis of the activity and the secondary structure of the purified hNK2R
Activity of the hNK2R was investigated by measuring its ability to bind the antagonist [3H] SR-48968. The functionality of the receptor was calculated as a function of specific binding of the antagonist to the receptors. The specific binding of the antagonist to the receptor is the difference between the CPM values of Total and nonspecific binding. The CPM values for both total and nonspecific binding of the antagonist SR-48968 were similar thereby, no specific binding of the ligand to the receptor was observed. The CPM value obtained was due to the nonspecific binding of the antagonist to the membranes and cellular components. This indicates that the receptor was not functional, and suggesting that the hNK2R was not correctly folded.
Preliminary biophysical characterization of the hNK2R was performed using circular dichroism spectroscopy. The 190–250 nm spectrum is characteristic of a folded protein with a high content of secondary structure. The secondary structure of the hNK2R was determined in the presence of 0.1% LDAO. The CD spectrum displays a significant amount of α-helical structure. The spectra displayed two distinct minima at 209 nm and 221 nm, characteristic of α-helix (Fig 6).
122
209 nm
221 nm
Figure 6: Circular dichroism spectra LDAO solubilised purified hNK2R. Circular dichroism spectroscopy of hNK2R indicates presence of substantial amount of α-helix. The arrows indicate the negative maxima characteristic of α- helix.
Discussion
The first step in the elucidation of the structure of a membrane protein is its successful expression and purification. Despite several examples of highly over-expressed eukaryotic membrane proteins, the heterologous protein production is still a matter of trial and error.
Typically, structural studies generally require milligram amounts of a protein. Often such large amounts can be obtained by a heterologous expression of the proteins in bacteria. However, for eukaryotic membrane proteins the production of high quantities is particularly challenging, especially for the members of the GPCR-family of integral membrane proteins [36].
In this study, we have described the overexpression and purification of the human tachykinin NK2 receptor as a fusion protein with MBP in E.coli. To our knowledge, this work is
123
Expression of NK2R – MBP fusion protein the first report on the expression and purification of hNK2R in E.coli. Previous attempts to express hNK2R in E.coli without a fusion partner were not successful. Bane et al attempted to express hNK2R in E.coli cells containing extra copies of tRNA and were not successful in that approach. [27]. Several GPCRs have been successfully expressed as MBP fusion proteins in E.coli including the human peripheral cannabinoid receptor [32], the adenosine A2a receptor [35], and the β2-Adrenergic receptor [33].
In our study, the use of a MBP as a fusion partner alone was not sufficient for the expression of the hNK2R in E.coli. The use of E.coli cells (BL21-DE3 RIPL) containing extra copies of tRNA for rare codons did not yield any expression of the hNK2R. The exchange of codons that are less abundant in E.coli was necessary for the expression of hNK2R in milligram amounts. Dramatic improvement of expression due to codon exchange has been reported previously for human leukotriene B4 receptor BLT1 [34]. The expression of hNK2R after codon exchange and without fusion partner was not successful (data not shown).
This result suggests that codon optimization may be more effective than supplementing rare tRNAs when expressing GPCRs in E. coli. This observation is in agreement with Bane et al whose attempts to express nine receptors resulted in high level expression of just one receptor, hNK1R. It was observed by the authors that codon replacement is more efficient than employing E.coli cells containing extra copies of tRNA. However in our case, it was surprising that both a
This result suggests that codon optimization may be more effective than supplementing rare tRNAs when expressing GPCRs in E. coli. This observation is in agreement with Bane et al whose attempts to express nine receptors resulted in high level expression of just one receptor, hNK1R. It was observed by the authors that codon replacement is more efficient than employing E.coli cells containing extra copies of tRNA. However in our case, it was surprising that both a