1 E. coli Lysate 12
2 Reaction Mix 10
3 Amino Acids 12
4 Methionine 1
5 Reconstitution Buffer 5 6 DNA in water or TE buffer 10
Table 7.3: List of components used for expressing the NK2R and D2R in thecell-free expression system
7.4: Results
7.4.1: Expression of the NK2R and D2R using the linear template generation set
The figure 7.4 shows the anti-his blot to detect the expression of the NK2R and D2R in the cell-free expression system using the linear template generation set. Neither NK2R nor D2R were expressed in this technique. The GFP was expressed ruling out the possibilities of any experimental errors. The possible reasons for lack of expression might be
• the protein concentration was too low to be detected by blot
• no initiation of translation due to strong secondary structures of the mRNA 74
Cell-free GPCR expression
• the expressed proteins interfered with the translation or transcription process
M 1 2 3 4
130 95 72 55 43
Lane M – Molecular Weight Marker Lane 1 – D2R/Linear Template Lane 2 – Nk2R/Linear Template Lane 3 – Positive Control - GFP Lane 4 – Negative Control
34 26
17
Figure 7.4: Expression of the NK2R and D2R using the linear template generation set – anti-his blot
7.4.2: Expression of the NK2R and D2R using the pIVEX2.4d vector
The figure 7.5 shows the anti-his blot to detect the expression of the NK2R and D2R in cell-free expression system using the pIVEX2.4d vector. It is evident from the blot that both NK2R and D2R were expressed in cell-free system when the vector was employed.
Lane M – Molecular Weight Marker Lane 1 – D2R
Lane 2 – Nk2R
Lane 3 – Negative Control
Figure 7.4: Expression of the NK2R and D2R using the pIVEX2.4d vector – anti-his blot
75
76
The GPCRs, NK2R and D2R were expressed in cell-free expression system successfully when the pIVEX vector was employed. However, I decided to search for another expression system for the following reasons:
• the amount of protein expressed was too low; the yield was not in milligram quantities as reported for other GPCRs.
• scaling up of the reaction volume did not yield milligram amount of receptors
• cell-free expression was an expensive technique for further scale up as the E.coli extract was commercially purchased.
Expression of GPCR - TM-OmpA fusion protein
Chapter 8: Expression of the Tachykinin 2 and Dopamine 2 receptors in Escherichia coli with transmembrane domain of Outer membrane protein A as a fusion partner and rare codon exchange technique
8.1: Introduction
The ability of E. coli to produce large amounts of eukaryotic proteins as inclusion bodies has been exploited for the high-level production of GPCRs. Key advantages of expressing foreign proteins in inclusion bodies are, it reduces the toxicity to the cell during expression, inclusion bodies are relatively easy to purify, and expressed proteins are resistant to proteolytic degradation.
Most importantly, E. coli has the potential to produce as much as hundreds of milligrams of inclusion bodies per liter of culture. However, in order to achieve properly folded GPCRs using this method, refolding would be required (Baneres et al. 2003), (Baneres et al. 2005).
Our initial attempts to express GPCRs in E.coli were unsuccessful (Chapter 2). Therefore, I decided to try expressing GPCRs in E.coli with a fusion protein at the N-terminus. Usually, a native E.coli protein is used as a fusion partner for expression of heterologous protein E.coli. The most common fusion partner is Maltose Binding Protein (MBP). The MBP has been employed to express numerous GPCRs and helps in solubility of the expressed protein (Kapust and Waugh 1999). However, MBP fusion protein expresses in periplasmic membrane, thereby reducing the yield of protein expressed. Therefore, I decided to design a construct which targets the expressed proteins into inclusion bodies for higher yields.
Therefore, I decided to employ the transmembrane domain of outer membrane protein A (OmpA) as the fusion partner to express the GPCRs. OmpA is an oligomeric transmembrane protein which acts as a receptor for phages (Cullis and Hope 1978) and is analogous to a 33 kDa protein of S. typhimurium, which reacts with bacteriocin (Hall and Silhavy 1981). The OmpA forms an eight-stranded β-barrel that functions as a structural protein and perhaps as an ion channel in the outer membrane of E.coli (Kleinschmidt and Tamm 2002). The transmembrane part is located between residues 1 and 177 spanning the membrane (Hirota et al. 1977). In this work, I have employed the 177 amino acid transmembrane domain of OmpA (TM-OmpA) as a fusion partner in attempts to express the GPCRs as inclusion bodies.
77
8.1.1: The effect of rare codons on high level expression of heterologous protein in E.coli E. coli, and indeed all cells, uses specific subsets of the 61 available amino acid codons for the production of most mRNA molecules. The frequencies, by which the various codons appear in genes of E. coli, are different from the frequencies, by which the same codons appear in genes of other organisms. Those codons that are only used in the E.coli genes, which are expressed at a low level, are known as the so-called rare codons. The amount of specific tRNAs corresponds to the frequency of the codons in E.coli. A tRNA, which recognizes a rarely used codon in E.coli, is present in low amounts. When a gene containing these rare codons is overexpressed in E. coli, the differences in the codon usage can impede the translation of this gene due to the demand for one or more rare tRNAs. Consequently, reduced expression levels are obtained (Kane 1995).
Insufficient tRNA pools can lead to translational stalling, premature translation termination, translation frame shifting and amino acid misincorporation (Kurland and Gallant 1996).
Examination of the codon usage in all 4,290 E. coli genes reveals that certain codons are underrepresented (Table 8.1). In particular, the arginine (Arg) codons AGA, AGG, and CGA, the isoleucine (Ile) codon AUA, and the leucine (Leu) codon less frequently used for the gene expression in E.coli (Nakamura et al. 2000).
78
Table 8.1: List of E.coli rare codons and usage in protein expression
Codon usage is expressed as the fraction of all possible codons for a given amino acid.
“All genes” represents the fraction in all 4,290 coding sequences in the E. coli genome.
“Class II” represents the fraction in 195 genes highly and continuously expressed during exponential growth (Henaut 1996)
Expression of GPCR - TM-OmpA fusion protein
8.2: Materials
E.coli cells BL21 CodonPlus (DE3)-RIPL were purchased from Stratagene. These cells contain extra copies of the argU, ileY, leuW and proL tRNA genes. These genes encode tRNAs that recognize the arginine codons AGA and AGG, the isoleucine codon AUA, the leucine codon CUA and the proline codon CCC respectively. These codons are less abundant in E.coli thereby could inhibit the over expression of an heterologous proteins (Kane 1995).
The pET-22b vector (Figure 8.1) was employed for the expression trials of the NK2R and D2R.
The pET-22b vector carries an N-terminal pelB signal sequence for potential periplasmic localization of the expressed protein. The vector contains a C-terminal his-tag for the detection and purification of the expressed protein. As the aim of this construct was to produce inclusion bodies of the expressed GPCRs, the pelB signal sequence was removed using the restriction enzyme site NdeI. Target genes were cloned into the pET plasmids under control of strong bacteriophage T7 transcription and translation signals. The expression was induced by providing a source of T7 RNA polymerase in the host cell. Isopropyl β-D-1-thiogalactopyranoside (IPTG), which is a molecular mimic of allolactose, a lactose metabolite that triggers transcription of lac operon is widely used for induction of the recombinant protein expression in E.coli.
The Phusion polymerase was purchased from Finnzymes and T4 DNA ligase was purchased from Stratagene. Oligonucleotides were purchased from MWG Oligonucleotides, Germany. The QuikChange® Multi Site-Directed Mutagenesis Kit was purchased from Stratagene.
79
Figure 8.1: pET-22b vector map
Important characteristics: Multiple cloning Sites: 158-225; pelB coding sequence: 224-289: T7 promoter site: bases 361-377; His-tag coding sequence: bases 140-157: the sequence was numbered by the pBR322 convention, therefore, the T7 expression region is reversed on the circular map. The figure is taken from the company information sheet (Novagen)
8.3: Methods
8.3.1: Construction of the TM-OmpA-GPCR fusion plasmid
A PCR reaction was performed to introduce the restriction sites NdeI/EcoRI into the TM-OmpA cDNA. Another PCR reaction was performed to introduce EcoRI/HindIII and EcoRI/XhoI restriction sites into the NK2R and D2R gene respectively. The DNA sequence coding for an enterokinase cleavage site was introduced at the N-terminus of the GPCR sequence, to
80
Expression of GPCR - TM-OmpA fusion protein facilitate the removal of TM-OmpA by proteolysis after protein expression. Oligonucleotides
employed for the cloning are shown in the table 8.2.
Name Description Codon Sequence 5’-3’
TM-OmpA Forw
Introduces an NdeI site prior
to the start codon AGTCGCATATGATGGCTCCGAAAGATAACA TM-OmpA
NK2R Rev Introduces an HindIII site
and removes the stop codon CCGTCAAAGCTTAATTTCAACATGAGTTTTGGTG D2R Forw
removes the stop codon GCCACTCGAGGCAGTGAAGGATCTTCAGG
Table 8.2: Oligonucleotides used for the construction of the Tm-OmpA-GPCR fusion protein construct
The restriction enzyme sites are underlined; the enterokinase cleavage site sequence shown in bold
The PCR products of TM-OmpA and GPCRs were digested with EcoRI and ligated as described in section 2.2.2.7 and 2.2.2.8. The ligated product was used as the template for further PCR with TM-OmpA Forw and GPCR Rev primers to obtain sufficient amount of the PCR product for subcloning it into the pET-22b vector. The pET-22b vector was digested with NdeI/HindIII and NdeI /XhoI to insert the TM-OmpA-NK2R and TM-OmpA-D2R cDNA sequences respectively. The restriction enzyme NdeI was employed because it eliminates the pelB signal sequence at the N-terminus. Therefore, the expressed protein forms inclusion bodies, thereby increasing the yield of the expressed protein. The PCR products and the pET-22b vector were digested with appropriate enzymes, ligated and transformed into XL1-blue cells as described in
81
materials and methods (Section 2.2.2.1, 2.2.2.7, 2.2.2.8). The Plasmid DNA was prepared as described in section 2.2.2.2 and its sequence was verified. The final plasmid was named as TM-OmpA-GPCR-pET 22b. A schematic illustration of the plasmid construction is shown in figure 8.2
Figure8.2: Schematic illustration of the TM-OmpA-GPCR plasmid construction See text for details.
Ligated product used as template for PCR
PCR products and pET-22b vector digested with NdeI and
HindIII/XhoI and ligated
82
Expression of GPCR - TM-OmpA fusion protein
8.3.2: Transformation of BL21-Codonplus (DE3)-RIPL cells
Typically, 5 µg of the plasmid DNA was added to 100 μl of competent cells containing 2 µl of β-mercaptoethanol and incubated for 30 mins on ice. The cells were subjected to heat shock at 42°C for 20 secs and returned to ice for 2 mins. After 2mins, 400 µl of SOC medium was added to the cells and incubated at 37°C with shaking in an orbital shaker at 200 rpm for 60 mins.
The cells were then plated on an LB agar plate supplemented with the 100 µg/ml of ampicillin and incubated at 37°C for 16-20 h.
8.3.3: Expression trials in E.coli
A preculture (5 ml of LB medium with 100µg/ml of ampicillin) was inoculated with a single colony and incubated at 37°C for 16 h. 1 ml of preculture was aseptically transferred to 50 ml LB medium and incubated at 37°C until O.D. 0.5 was obtained. The culture was induced using IPTG at a final concentration of 1 mM at 30oC for four hours.
The cells were collected by centrifugation and suspended in lysis buffer (10 mM Tris, 2 mM EDTA pH 8.0 and complete protease inhibitor cocktail tablet from Roche). The cells were broken by sonication and centrifuged for 15 mins at 3000g to collect the inclusion bodies. The inclusion bodies were suspended in lysis buffer and mixed with 50 µl SDS-PAGE loading buffer and loaded onto a 12% SDS-PAGE gel and stained with Coomassie brilliant blue dye and InVision™ His-tag In-gel Stain. The cells containing the empty pET-22b vector were treated in a similar manner for a negative control.
8.3.4: Construction of the TM-OmpA-NK2R N-terminus fragment fusion plasmid
In order to express an N-terminal fragment of the NK2R, primers were designed to introduce stop codon after DNA sequencing encoding the 32nd amino acid of the NK2R.
Oligonucleotides used are shown in the table 8.3. A PCR was performed as described in section 2.2.2.9 using TM-OmpA-NK2R-pET 22b as the template. The PCR products and the vector were digested with appropriate enzymes, ligated and transformed into XL1-blue cells as described in
83
materials and methods (Section 2.2.2.1, 2.2.2.7, 2.2.2.8). The plasmid DNA was prepared as described in section 2.2.2.2 and sequence verified.
Name Description Codon Sequence 5’-3’
TM-OmpA Forw
Introduces an NdeI site
prior to the start codon AGTCGCATATGATGGCTCCGAAAGATAACA NK2R_32 AA
Table 8.3: Oligonucleotides used for construction of Tm-OmpA-NK2R N-terminus fragment The restriction enzyme sites are underlined; the stop codon sequence shown in bold.
8.3.5: Construction of various TM-OmpA-NK2R fragments fusion plasmid
To solve the problems that we encountered during the initial expression trials, we decided to construct plasmids containing various fragments of the NK2R fused with TM-OmpA. The following fragments of the NK2R were constructed:
1. fragment composed of first 52 amino acids, starts at the N-terminus 2. N-terminus and transmembrane helix I (TM I)
3. fragment composed of first 69 amino acids, starts at the N-terminus 4. transmembrane helix II (TM II)
5. transmembrane helices II and III (TM II-III) 6. transmembrane helices IV and V (TM IV-V)
PCR reactions were performed to introduce a stop codon into the plasmid for the first three constructs as described in section 2.2.2.9. The PCR products and the vector were digested with appropriate enzymes, ligated and transformed into XL1-blue cells as described in materials and methods (Section 2.2.2.1, 2.2.2.7, 2.2.2.8). The plasmid DNA was prepared as described in section 2.2.2.2 and its sequence was verified.
For the last three constructs PCR was performed to introduce an enterokinase cleavage site at the N-terminus and a stop codon at the C-terminus. The restriction digestion, ligation and transformations were performed as described in section 8.3.1. Oligonucleotides used for the construction of various fragments of NK2R fusion protein are shown in the table 8.4.
84
Expression of GPCR - TM-OmpA fusion protein
Name Description Codon Sequence 5’-3’
TM-OmpA Forw Introduces an NdeI site prior to the start codon
AGTCGCATATGATGGCTCCGAAA GATAACA
NK2R_52 AA Rev
Introduces an HindIII site and stop codon ATGCGAAGCTTTGAGGCATTACC CGTCACGGCCACCAGCACCAGGG NK2R_ TM I
Rev
Introduces an HindIII site and stop codon GGCCAAGCTTTGACCAGATGACG ATGGCATTACCC
NK2R _69 AA Rev
Introduces an HindIII site and stop codon GGCCAAGCTTTGAGTTGGTGACT GTGCGCATCCTCCGATG
NK2R_ TM II Forw
Introduces an EcoRI and an enterokinase cleavage site prior to the start codon
ATGCGAATTCGACGACGACGACA AATACTTCATCGTCAATCTGGCGC NK2R_ TM II
Rev
Introduces an HindIII site and stop codon GGCCAAGCTTTGATTGAAGGCGG CATTGAAGGCAGCCA
NK2R_ TM (II-III) Forw
Introduces an EcoRI and an enterokinase cleavage site prior to the start codon
GATCGAATTCGACGACGACGACA ATGCGCACAGTCACCA
NK2R_ TM (II-III) Rev
Introduces an HindIII site and stop codon GGCGAAGCTTTGAGTACCTGTCG GCAGCA
NK2R_ TM (IV-V) Forw
Introduces an EcoRI and enterokinase cleavage site prior to the start codon
ATGCGAATTCGACGACGACGACA AA TCAGCTCCCAGCACC
NK2R_ TM (IV-V) Rev
Introduces an HindIII site and stop codon GGCCAAGCTTTGATTAGATGACG CTGTAGGCTAC
Table 8.4: Oligonucleotides used for construction of the Tm-OmpA-NK2R fragments
The restriction enzyme sites are underlined; the enterokinase cleavage site sequences are shown in italics; the stop codons are shown in bold.
8.3.6: The effect of rare codons on expression of the NK2R in E.coli
Most amino acids are encoded by more than one codon, and each organism carries its own bias in the usage of the 61 available amino acid codons. In each cell, the tRNA population closely
85
reflects the codon bias of the mRNA population (Ikemura 1981). When the DNA of a heterologous target protein is overexpressed in E. coli, differences in codon usage can impede the translation due to the demand for one or more tRNAs that may be rare or lacking in the population. This may lead to reduced expression levels or complete termination of the translation (Goldman et al. 1995).
To obtain expression of the full length NK2R, I decided to exchange the NK2R codons that are less abundant in E.coli with codons that are more frequently used in E.coli. Previously, the human leukotriene B4 (LTB4) receptor BLT1 was expressed in high yields in E.coli by codon replacement technique (Baneres et al. 2003). The distribution of rare codons in NK2R DNA is shown below:
Red = rare Arginine codons AGG, AGA, CGA, CGG Green = rare Leucine codon CTA
Orange = rare Proline codon CCC
86
Expression of GPCR - TM-OmpA fusion protein In E. coli mRNA, the redundant rare arginine codons AGG and AGA occur at a frequency
of 0.14% and 0.21%, respectively. They were the first rare codons demonstrated to have a detrimental effect on protein expression (Spanjaard and van Duin 1988). AGG/AGA remains the focus of most of the attention on rare codons. Clusters of AGG codons alone do not cause translational problems. The mRNA for the protein bovine placental lactogen (BPL) contains nine single rare AGG/AGA codons out of 200 amino acids (i.e. 4.5%). E. coli K-12 strain expressing BPL yielded less than 5% of total protein from a 10 liter culture (Brinkmann et al. 1989).
In the Nk2R sequence there are six Arginine rare codons in total. The first two rare Arginine codons CGG and AGG occur as clusters in the sequences. These rare codons might interfere in the expression of the NK2R in E.coli.
8.3.7: The QuikChange® Multi Site-Directed Mutagenesis
In order to replace the NK2R codons that are less abundant in E.coli with codons which are more abundant in E.coli the QuikChange® Multi Site-Directed Mutagenesis kit was used. This kit offers a rapid and reliable method for the site-directed mutagenesis of the plasmid DNA at up to five different sites simultaneously. A single mutagenic oligonucleotide is required to mutagenize each site, using a double-stranded DNA template.
The figure 8.3 shows a schematic overview of the QuikChange® Multi Site-Directed Mutagenesis. Step 1 uses a thermal cycling procedure to achieve multiple rounds of mutant strand synthesis (Note: all oligonucleotides were designed to bind the same strand of the template DNA).
The PfuTurbo DNA polymerase then extends the mutagenic primers generating double stranded DNA molecules with one strand bearing multiple mutations and containing nicks. The nicks are sealed by components in the enzyme blend.
In step 2, the PCR reaction product is treated with DpnI restriction endonuclease. The DpnI endonuclease is specific for methylated and hemimethylated DNA and is used to digest the parental DNA template (Nelson and McClelland 1992).
In Step 3, the reaction mixture, enriched with multiple mutated single stranded DNA, is transformed into XL10-Gold ultracompetent cells. These cells convert the mutated single stranded DNA into a duplex form.
87
Figure8.3: Overview of the QuikChange Multi Site-Directed Mutagenesis method See text for details.
8.3.8: Site directed mutagenesis to exchange rare codons in the NK2R DNA
In order to exchange the rare codons present in the NK2R DNA to codons that are more abundant in E.coli twenty six mutagenic oligonucleotides were designed (Table 8.5). Table 8.6 shows the PCR reaction mix and table 8.7 shows the PCR program employed for the mutagenesis reaction. Initially seven oligonucleotides were used for the mutagenesis reaction. Then, the PCR product was treated with DpnI for one hour at 37oC to digest the parental DNA template. The mixture was then transformed into the XL-10 Gold cells as described in materials and methods (Section 2.2.2.1). The plasmid DNA was prepared as described in section 2.2.2.2 and its sequence was verified. Once the mutations were confirmed the sequence-verified plasmid was used as a template for further mutagenesis reactions to exchange the remaining codons.
88
Expression of GPCR - TM-OmpA fusion protein
S.No. Primer Name Primer Sequence
1 G186T_A187C_G189T CATCCTGGCCCATCGTCGTATGCGCACAGTCA
Components Quantity for 25 µl reaction 10× QuikChange Multi
Table 8.5: Oligonucleotides used for the site directed mutagenesis
The codons exchanged are shown in bold and underlined
Table 8.6: Multi mutagenesis PCR reaction mix
The QuikChange Multi enzyme blend was added immediately prior to setting up the reaction
The QuikChange Multi enzyme blend was added immediately prior to setting up the reaction