INTEGRATED PROTOCOL FOR NUCLEIC ACID EXTRACTION, AMPLIFICATION AND SEQUENCE IDENTIFICATION THROUGH HIGHAMPLIFICATION AND SEQUENCE IDENTIFICATION THROUGH HIGH

DENSITY MICROARRAY

DNA chip technology holds great potential for microbiological diagnostic applications due to its powerful capacity to simultaneously analyze a large number of nucleic sequences (Linet al.2006; Loyet al.2006). In this study, the photolithography chip developed by Affymetrix was used as a particularly powerful tool allowing the simultaneous identification of a large set of waterborne microbes (E. coli,Salmonellaspp., Pseudomonas aeruginosa,E. coliO157:H7, Legionellaspp., L. pneumophila,Cryptosporidiumspp., C.

parvum,Giardiaspp.,G. lamblia, Enteroviruses, Hepatitis A viruses and Noroviruses). For bacteria and

waste

Peristaltic pump

UF1 cartridge Tank

Inoculum

Figure 11.2 Diagram of the Dead-End HFUF prototype setup for spiking and filtering water samples.

Detection of Pathogens in Water Using Micro and Nano-Technology 178

protozoa targets, ribosomal and messenger RNA sequences (rRNA and mRNA) were selected in order to detect viable pathogens through the presence of RNA markers.

Universal protocols were successfully optimized and validated for lysis, RNA extraction and purification from all targeted micro-organisms recovered in UF concentrates. Briefly, 300μl concentrates were equally divided into three tubes and 10μL of lyzozyme (100 mg/ml), 2μL of 100xTrisEDTA buffer and 1μL ofβ-Mercaptoethanol (14.3 M) were added into each tube and incubated for 15 min. at 37°C. Then, 25μL of Proteinase K (.600 mAU/ml), and 385μL of Qiagen lysis solution (RLT solution) containing 1% β-mercaptoethanol were added and incubated for 15 min. at 65°C. Purification was performed using Qiashredder (Qiagen) and Rneasy Mini Kit (Qiagen) columns, adding an additional wash step with the Qiagen RW1 washing buffer. Total RNA was eluted in 25μL of RNAse-free water.

Multiplex one-step RT-PCR amplifications were then carried out to amplify the extracted RNA for 11 microbial targets in only 4 reaction tubes (two for bacteria, one for viruses and one for parasites).

RT-PCR primer sequences (described in Table 11.2) were designed specifically for this study (P.

Renaud, E. Guillot, C. Mabilat, C. Vachon, B. Lacroix, G. Venret, M-A Charvieu, P. Laffaire, April 2004, France, patent number WO0202811), except for Cryptosporidium (Xiao et al. 1999) and Noroviruses (Vinje et al. 1996) primers. 25μl of sample RNA was added to a 25μL RT-PCR mix.

RT-PCR reactions were performed using Access one-step RT-PCR Kit (Promega) according to the manufacturer’s instructions with some modifications (Table 11.2). Thermal cycling conditions were optimized and were the same for all microorganisms tested : 45 min. at 48°C for reverse transcription;

5 min. at 94°C for initial denaturation; 40 cycles of 30 s at 94°C, 1 min. at 55°C, 1 min. at 68°C; and a final extension step of 7 min. at 68°C.

All RT-PCR products were mixed and labeled by incorporation of a biotinylated marker (meta-biotinphenylmethyldiazomethyl (bioMerieux) at 95°C for 25 min. and cleaved into smaller fragments with 36 mM of HCl (Korimbocus et al. 2005). Fragmented labeled DNA was then purified (using QiaQuick PCR purification kit) and denaturated by heating, in order to obtain biotin-labeled single DNA strands.

For the design of high-density DNA probe array specifically dedicated to waterborne pathogens, oligonucleotide sequences which allowed the identification of a total of 47 parameters (38 bacterial taxons, 5 viral taxons, and 4 parasitic taxons) were determined as follows: for each parameter, sequence databases were retrieved from Genebank, in order to determine specific sequences of 20 to 40 bases by comparing sequence alignments. Each sequence was then compared to Genebank, in order to confirm the specificity, and was selected as a reference sequence. The repertoire of selected probes was then synthesized on the array using 4-L or 2-L tiling array strategy such as previously described (Troesch et al.1999; Korimbocuset al.2005). For each relevant base of a given sequence, the chip contained four (or two) probes of equal lengths (20-mer). One probe represented the perfect match, while the others corresponded to the possible mismatches at the interrogating base position, centrally located within the probes. For the 2-L tiling strategy, the perfect match and the most unlikely mismatch were considered.

DNA probe array hybridization was done at 45°C for 45 min on Affymetrix GeneChip Fluidics Station 400, as described by Korimbocuset al.(2005). After the array was washed, the fluorescent signal emitted by the target bound to the probes was detected by a GeneArray scanner at a wavelength of 570 nm and with a pixel resolution of 3μm. The highest signals came from the probes that best matched the target viral sequence. Probe array fluorescence intensities, nucleotide base call, sequence determinations, and reports were generated by functions available on the GeneChip 3.2 software. For each target, the percentage base-call (BC%), as determined by the percentage of homology between the experimentally derived sequence and the reference sequence, tiled on the array, as well the ratio between the median intensity

obtained for the tiled sequence and the median background intensity were considered as criteria for identification.

The Figure 11.3 summarizes the whole multi-detection process. Less than 10 hours are necessary to perform it, leading to results within one day.

To prevent false-positive or false-negative results, different process controls were systematically processed for each analysis. Two negative controls consisting in 300μl sterile distilled water (analyzed from the RNA extraction step) and a negative RT-PCR control in which template RNA was replaced by sterile distilled water were performed. Positive controls were also performed: one process control in Table 11.2 Primer sequences and multiplex RT-PCR conditions.

Multiplex

E. coli& ENTR-F (0.2μM) GGAAGAAGCTTGCTTTGCTGAC PCR buffer (1X), dNTP (0.4 mM), MgSO₄(2.5 mM), AMV-rt (5 U), TFL-pol (5 U), Rnasin (5 U, Promega) Salmonellasp. ENTR-R (0.2μM) CCAGTATCAGATGCAGTTCC

P. aeruginosa PYO-F (0.05μM) GGATAACGTCCGGAAACGGG FAB5RT7

(0.05μM)

TAATACGACTCACTATAGGGAGGAGGA TTACGACTTATCGCGTTAGCTGCGCCA 2

Legionellasp. LGPF-1 (0.05μM) CTTTAAGATTAGCCTGCGTCCG PCR buffer (1X), dNTP (0.6 mM), MgSO4(2.5 mM), AMV-rt (5 U), TFL-pol (5 U), Rnasin (5 U, Promega) L. pneumophila LGPR-1 (0.05μM) GCACCTGTATCAGTGTTCCCGA

E. coli 57U19 (0.5μM) GGCATTCAGTCTGGATCGC

O157 :H7 278L21 (0.5μM) TGACCCACACTTTGCCGTAAT

3

Cryptosporidium XIA2F (0.1μM) GGAAGGGTTGTATTTATTAGATAAAG PCR buffer (1X), dNTP (0.6 mM),

Enterovirus EntB (0.08μM) GGTACCTTTGTRCGCCTG PCR buffer (1X), dNTP (0.6 mM),

Detection of Pathogens in Water Using Micro and Nano-Technology 180

which 300μl of sterile distilled water was spiked withE. coli,EnterovirusandC. parvummix (respectively of 50 cfu/50 pfu/5 oocysts) and positive RT-PCR amplification controls by amplifying target RNA from bacteria, virus or parasite (1 pg in 50μl RT-PCR mix).

Detecting inhibition is also particularly important in environmental samples with low levels of pathogen contamination, as this minimal microbial load may be hidden during analysis. Improvements in RNA purification and PCR amplification were performed as follows:

– By adding a supplementary step to the Qiagen Rneasy purification protocol such as a phenol-chloroform purification

– By adding a PCR facilitator, the T4 gene 32 protein (Monpoehoet al.2000; Jianget al.2005) for the relief of inhibitors of RT-PCR amplification

– By diluting the RNA extract (1/2 or 1/5) producing an ultimate solution before amplification.

11.4 RESULTS

11.4.1 Recovery from 30 L-initial volume to final concentrate

Recovery efficiencies (Table 11.3) for one or two-step UF concentration were quantified by culture-based standard methods for E. coli (Colilert-18 with QuantiTray 2000, Idexx) and MS2 bacteriophage (by a double-agar layer technique according to ISO 10705–2,.2001), and by IMS-IFA (Immuno-Magnetic Separation–Immuno-Fluorescence Assay, NF T90-455 standard method) for Cryptosporidium parvum.

Microbial targets were inoculated into the initial volume of water samples in the lowest range possible (in order to be directly countable). For surface water, indigenous MS2 phages and E. coli cells were used. Except for MS2 phage, similar recovery efficiencies were obtained from surface and drinking water. They were also into the same order of range as those described by Smith and Hill (2009).

Labelling &

Figure 11.3 Integrated protocol for the multi-detection of waterborne pathogens by DNA chip in drinking water (DW) and raw water samples.

11.4.2 Impact of BSA blocking and elution agents on waterborne pathogen recovery using two-step ultrafiltration protocol from 30 L-drinking water

Recovery of pathogens for low seed levels was also studied for the following targets: Legionella pneumophila(ATCC 33152, C. parvum(Iowa isolate) and Poliovirus Type 3 Sabin vaccine strain. For these targets, quantification was made, using real-time PCR after DNA (or RNA) extraction on the 300μl concentrate and following the respective methods: NF T90-471 standard method (iQCheck Legionella pneumophila quantification kit, Biorad); Fontaine and Guillot (2002) and Monpoeho et al.

(2000).

First, it was shown that UF2 protocol including BSA pre-blocking and elution with 1 mM hydroxide sodium solution was essential for a better recovery of enteric viruses (Table 11.4). Similarly, these same pre-treatment and elution conditions significantly improved the total recovery for concentrating 30 L of drinking water into 300μL (corresponding to a 5-Log concentration). The final protocol, including, for both UF steps, pre-treatment with BSA and NaOH elution, allowed small levels of waterborne pathogen targets to be detected, since about 23 copies of enterovirus (Poliovirus), 10 genome units of L. pneumophilaand 0.3C. parvumoccysts could be detected per one liter of drinking water.

Table 11.3 Average recovery of organisms from 30 L of surface water (*Turbidity=13 NTU) or drinking water using an one or two-step UF protocol.

Type of

N=3 independent assays. UF1: first ultrafiltration step, UF2: second ultrafiltration step; SD: standard deviation;

NA: not applicable; NP: not performed.

Detection of Pathogens in Water Using Micro and Nano-Technology 182