3 Material and Methods
3.2 Methods
3.2.4 Biochemistry
To avoid loss of function or degradation, all protein handling was performed on ice if not stated otherwise. As well, repeated freeze-thaw cycles were avoided and protease inhibitor ways added freshly.
3.2.4.1 Oligonucleotide Annealing
Both, activator oligonucleotide (EcoRI linker) and loop-containing XPA binding-substrate (B-ON1/ON8) were purchased as single-stranded oligonucleotides and had to be annealed properly before usage.
- 58 -
Due to its palindromic sequence (GGAATTCC) the EcoRI linker could be annealed to itself. Therefore, lyophilized DNA was solved in 15 mM NaCl to the desired concentration and heated to 95°C for 5 min on a thermal shaker (500 rpm) to denaturize any uncontrolled base-pairing. The thermal shaker was switched off, but the EcoRI linker DNA remained in the thermal block to cool down very slowly (several hours) to RT. Duplex DNA was then stored at -80°C.
Annealing of the loop-containing XPA binding-substrate was performed in a similar way as for the palindromic EcoRI linker, but here two partially complementary oligonucleotides were used. The B-ON1 oligonucleotide was modified on its 5’ end with a biotin-tag for later detection purposes (Biotin-ACCACCCTTCGAACCACAC). ON8 (GTGTGGTTCGCGCGCGAAGGGTGGT) is complementary to B-ON1 on its 5’ and 3’ end, but contains a central, repetitive GC-sequence, forming a loop structure.
To ensure that all biotin-labelled DNA was annealed, ON8 was added in excess (2-fold) and annealing occurred in hybridization buffer (50 mM Tris-HCl, pH7.4; 10 mM MgCl2; 1 mM DTT). Further processing was performed according to the EcoRI linker annealing.
3.2.4.2 SDS-PAGE and Protein Detection
3.2.4.2.1 SDS-PAGE
To separate proteins according to their molecular weight a sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) was utilized. For SDS-PAGE the mini-Protean tetra cell system was used.
When hand-casting gels, the two plates (short and spacer plate) were cleansed thoroughly with 70 % EtOH and assembled in the casting frame. Depending on the target protein size the acrylamide percentage was chosen and according to Table 3.9 the resolving gel was casted. The gel was covered with 2-propanol and allowed to polymerize for 30-60 minutes. 2-propanol was removed and washed with DI water before casting the stacking gel. Again, the gel was allowed to polymerize for 30-60 min.
Table 3.9: Preparation of resolving acrylamide gel for SDS-PAGE (8x7 cm2).
After polymerization, the gel tray was placed in a tank filled with running buffer (25 mM Tris-Base;
192 mM glycine; 0.1% SDS). The comb was removed, and the wells rinsed. Protein samples were mixed either with 5x SDS LD or 1.5x Urea buffer and heated for 5 min at 95°C. Samples were spun down and loaded onto the gel, which was run at 10 mA until samples left the stacking gel and thereafter at 20 mA.
Resolving Gel Acrylamide in resolving gel
8 % 10 % 12 % 15 %
30 % Rotiphorese acrylamide/ bisacrylamide
(37.5:1) (ml) 1.58 1.95 2.4 2.93
H2O (ml) 3.07 2.7 2.25 1.72
Resolving gel buffer (ml) 1.2 1.2 1.2 1.2
10 % APS (w/v) (µl) 49.5 49.5 49.5 49.5
TEMED (µl) 12 12 12 12
- 59 -
Table 3.10: Preparation of stacking acrylamide gel for SDS-PAGE (8x1 cm2).
Stacking Gel
Acrylamide in stacking gel
5 % 30 % Rotiphorese acrylamide/ bisacrylamide (37.5:1) 1.1 ml
H2O 2.2 ml
Stacking gel buffer 3.2 ml
10 % APS (w/v) 66 µl
TEMED 12 µl
3.2.4.2.2 Coomassie Staining
Visualization of protein bands in SDS-PAGE gels was achieved by staining with a Coomassie protein staining solution. To remove any interfering SDS and buffer salts, gels were washed 3x 10 min in DI water before incubating the gel in Coomassie solution. Staining occurred either overnight at 4°C under gentle agitation or for about 60 min with occasional heat up using a microwave. The staining solution was discarded and the gel was rinsed thoroughly in DI water. The gel background was cleared for better visualization by washing in DI water for several hours.
3.2.4.2.3 Western Blotting
The transfer of proteins to PVDF or nitrocellulose membranes was done either by wet or by semi-dry blotting.
Wet Blotting:
After the SDS-PAGE, the gel was rinsed in Towbin buffer (25 mM Tris-Base; 192 mM glycine; 0.1 % SDS; 20 % MeOH) for 5 min. Sponges, blotting paper and nitrocellulose membranes were wetted and equilibrated in Towbin buffer. The blotting chamber was assembled according to the manufacturer’s instructions. Briefly, from positive to negative pole three sponges, three blotting papers, membrane, gel, three blotting papers and three sponges were stacked. Here, it was taken care to remove all air bubbles within the stacks. The chamber was filled with Towbin buffer and placed in an ice bath. Blotting was conducted by applying 600 mA in total (40 mA/h – 300 mA/h).
Semi-Dry Blotting:
For semi-dry blotting the gel was rinsed in Bjerrum Schafer-Nielson buffer (48 mM Tris-Base; 39 mM glycine; 0.05 % SDS; 20 % MeOH) for 5 min. Blotting paper and nitrocellulose membranes were wetted (Bjerrum Schafer-Nielson buffer) and stacked as described for wet blotting. It was taken care to remove all air bubbles between the different stacks. Blotting was conducted by applying 25 V for 30 min.
When proteins were transferred to a PVDF membrane, it was necessary to activate the membrane for 10 min with methanol before equilibration in Bjerrum Schafer-Nielson buffer.
General Aspects of Western Blotting:
The general procedure after western blotting for immunodetection with protein specific antibodies was as followed. After blotting, the membrane was blocked for 1 hour in 5 % skim milk (in TBS-T) at RT if not stated otherwise. After blocking, target proteins were labelled with a first, protein-specific
- 60 -
antibody (in blocking buffer). First antibody incubation was done either for 1 hour at RT or overnight at 4°C. The membrane was washed 3x 5 min in TBS-T and incubated for 1 h at RT in secondary antibody (goat-anti-mouse or goat-anti-rabbit-HRP, 1:2,000 in blocking buffer). After three further washing steps in TBS-T, ECL Advance was applied on the membrane and chemiluminescence was detected using an ImageQuant LAS-4000 mini.
3.2.4.3 In-Vitro PAR Synthesis, PAR Purification and Size-Fractionation
3.2.4.3.1 In-Vitro PAR Synthesis Synthesis of PAR:
PAR was synthesized by an in-vitro PARylation reaction with recombinant PARP-1 in a 10 ml approach. The reaction mix was prepared on ice as listed in Table 3.11. With the addition of β-NAD+
the reaction was started and incubated for 20 min at 37°C in a water bath. The reaction was stopped by adding 10 ml ice-cold 20 % TCA and kept on ice for 15 min. Thereafter, it was centrifuged for 10 min at 9,000 xg (4°C), the supernatant was discarded and the pellet was washed twice with EtOH puriss.
and centrifuged as before. Finally, the supernatant was removed and the pellet air-dried. After this step it was possible to store the synthesized PAR at -20°C until further usage.
Table 3.11: Preparation of in-vitro PARylation reaction mixture. Note that the stock concentration (Y) of recombinant PARP-1 was patch-dependent and therefore volume (X) of used PARP-1 varied to reach a final PARP-1 concentration of 150 nM.
Stock conc. Volume Final conc.
Tris-HCl, pH 7.8 1 M 1 ml 100 mM
MgCl2 1 M 100 µl 10 mM
DTT 1 M 10 µl 1 mM
Histone H1 1 mg/ml 600 µl 60 µg/ml
Histone H2a 1 mg/ml 600 µl 60 µg/ml
EcoRI linker 1 mg/ml 500 µl 50 µg/ml
PARP-1 X Y 150 nM
β-NAD+ 20 mM 500 µl 1 mM
MilliQ water ad 10 ml
Protein and DNA Digestion:
To detach the PAR chains from proteins, the TCA pellet was resuspended in 9 ml of 0.5 M KOH/50 mM EDTA and incubated at 37°C for 10 min (time critical step). The alkaline treatment was neutralized by adding 1 ml 1 M Tris-HCl (pH 8.0) and the pH was adjust directly afterwards with 37 % HCl to pH 7.5-8.0 (critical step, pH was not lowered < 7.5). The PAR solution was aliquoted (1 ml) in 2 ml reaction tubes and the DNA within was digested by adding 50 µl 1 M MgCl2 and 55 µl DNasI (2 mg/ml) and incubating for 2 h at 37°C on a thermal mixer (550 rpm). This was followed by protein digestion overnight (37°C, 550 rpm) by adding 10 µl 100 mM CaCl2 and 11 µl Proteinase K (20 mg/ml).
- 61 - Phenol-Chloroform Extraction:
PAR was further purified by a phenol-chlorophorm extraction. To each reaction mixture 600 µl phenol was added and inverted several times to mix the phases. The solution was centrifuged at 14,000 xg at RT for 10 min and the upper, aqueous phase was transferred to a new reaction tube. 600 µl phenol:chlorophorm:isoamylalcohol (25:24:1) was added and again inverted several times to get a homogeneous solution. Phase separation was again reached by centrifugation as above, and again the upper, aqueous phase was transferred to a new reaction tube. EtOH puriss. was added to a final concentration of 70 % and PAR was precipitated over night at -20°C. On the next day, PAR was pelleted by centrifugation (14,000 xg; 30 min; 4°C), the supernatant was discarded and the pellet air-dried. The pellet was resuspended and washed again in ice cold EtOH puriss. PAR was precipitated overnight again, centrifuged as before, the supernatant discarded and the pellet air dried. Finally, the pellet was resolved in MilliQ water. PAR concentration and purity was determined with a ND-1000 nanodrop. For this, the extinction coefficient (ε=13,500 M-1) and the extinction (E258 nm) at 258 nm was used in Lambert-Beer law:
B =CDEF G H 3.2.4.3.2 HPLC-Based PAR Size-Fractionation
PAR was fractionated as described previously by anion exchange chromatography 541. Briefly, a Dionex DNAPac PA100 (22x250 mm) column on a PU-980 HPLC was used on a preparative scale. 50 mM Tris-HCl (pH 9.0) was used as solvent, with a multi-step gradient up to 1 M NaCl.
PAR fractions were purified by adding EtOH (final conc. 70 %) and overnight precipitation at -20°C.
The fractions were centrifuged for 30 min (9,000 xg; 4°C) and PAR was pelleted. The supernatant was discarded, the pellet air-dried and PAR was solved in adequate volumes of MilliQ water. Concentration was defined as described before.
3.2.4.3.3 Sequencing Gel
Quality of fractionated and unfractionated PAR was controlled by size separation with a modified sequencing gel and subsequent silver staining 542,543. ADP-ribose polymers were separated via electrophoresis in a non-denaturing 20 % acrylamide gel (Table 3.12), which was casted in a Sequi-Gen GT sequencing cell. Before casting, the sequencing cell was prepared as followed under a fume hood.
Both glass plates were cleaned thoroughly with detergent, MilliQ and 70 % EtOH. The outer, free glass plate was coated with 5 ml Bind-silane. The solution was distributed evenly with a paper towel and air dried. The inner, electrophoresis-attached glass plate was coated with 5 ml Repel-silane and again evenly distributed and air dried. This was repeated once. Glass plates were horizontally assembled with spacer and comb and the gel was casted slowly and steadily with a syringe, avoiding air-bubble formation. After polymerization, the electrophoresis cell was assembled and both buffer reservoirs were filled with 1x TBE. The comb was removed, the wells rinsed in TBE and a const. voltage of 800 V was applied for 30 min. Only thereafter PAR was mixed with 6x sequencing gel loading dye and loaded on the gel. Electrophoresis at const. 800 V was performed overnight until the orange G marker almost reached the end of the gel.
- 62 - Table 3.12: Composition of modified silver gel.
Modified Sequencing Gel
% of Acrylamide in stacking gel
20 % 40 % Rotiphorese acrylamide/ bisacrylamide (19:1) 30 ml
5x TBE buffer 12 ml
20 % (v/v) glycerol 10 ml
H2O 7.6 ml
10 % APS (w/v) 300 µl
TEMED 24 µl
PAR was visualized using the Pierce Silver Staining Kit. The electrophoresis unit was disassembled and the free glass plate with the attached sequencing gel was transferred to a plastic tank, in which all further incubation and washing steps were performed. 500 ml silver gel fixing solution (50 % ethanol;
5 % acetic acid) were added and incubated for 15 min at RT. The gel was rinsed carefully with DI water before 450 ml of a 1:15 silver reagent dilution was added for 10 min. The gel was washed again carefully with DI water. 450 ml of a 1:1 mixture of reducer base reagent (1:7.5) and reducer aldehyde reagent (1:7.5) were added to develop the gel. As soon as PAR bands appeared the gel was washed again in DI water and the PAR bands were recorded.
3.2.5 Functional Assays