Analysis on the mechanisms underlying the leupaxin-mediated progression of
prostate cancer
Doctoral thesis
In partial fulfillment of the requirements for the degree
“Doctor rerum naturalium (Dr. rer. nat.)”
in the Molecular Medicine Study Program at the Georg-August University Göttingen
submitted by
Sascha Dierks
born in
Göttingen, Germany
Göttingen, 2014
Members of the Thesis Committee:
Supervisor
Prof. Dr. rer.nat. Peter Burfeind
Department of Human Genetics, University Medical Center Göttingen
Second member of the Thesis Committee Prof. Dr. rer.nat. Dieter Kube
Department of Hematology and Oncology, University Medical Center Göttingen
Third member of the Thesis Committee Prof. Dr. rer.nat. Holger Bastians
Department of Molecular Oncology, University Medical Center Göttingen
Date of Disputation:
AFFIDAVIT
Herewith I declare that my doctoral thesis entitled: "Analysis on the mechanisms underlying the leupaxin-mediated progression of prostate cancer" has been written independently with no other sources and aids than quoted.
Göttingen, November 2014
Sascha Dierks
Table of Contents
1 Introduction ... 1
1.1 The prostate carcinoma – at a glance ... 1
1.2 Cancer cell migration ... 2
1.2.1 The essential mechanisms of cancer cell migration ... 2
1.2.2 Cytoskeletal rearrangement during cancer cell migration ... 4
1.3 Leupaxin (LPXN) - at a glance ... 5
1.3.1 LPXN, a member of the paxillin protein family ... 5
1.4 The function of LPXN ... 7
1.5 The function of LPXN in prostate cancer... 8
1.6 Aims of this study ... 9
2 Materials and Methods ... 12
2.1 Chemicals and Reagents ... 12
2.2 Biochemicals and enzymes ... 14
2.3 Usage ware ... 15
2.4 Technical equipment ... 15
2.5 Sterilization of solution and equipment ... 16
2.6 Ready-to-use Reaction systems ... 16
2.7 Solutions ... 16
2.8 Culture media, antibiotics, agar plates ... 19
2.8.1 Culture media for bacteria ... 19
2.8.2 Agar plates ... 20
2.8.3 Culture media for eukaryotic cell cultures ... 20
2.9 Biologic material ... 21
2.9.1 Bacterial strains ... 21
2.9.2 Eukaryotic cell lines ... 21
2.9.3 Mouse strains ... 21
2.9.4 Synthetic DNA-oligonucleotides ... 22
2.9.5 Synthetic RNA oligonucleotides ... 25
2.9.6 Antibodies ... 26
2.9.6.1 Inhibitory antibodies ... 26
2.9.6.2 Primary antibodies ... 26
2.9.6.3 Secondary antibodies ... 27
2.9.7 Plasmids and Vectors ... 27
2.9.8 Used constructs and plasmids ... 28
2.10 Databases ... 29
2.11 Isolation and purification of nucleic acids ... 29
2.11.1 Minipreparation of plasmid DNA ... 29
2.11.2 Establishment of bacterial glycerol stocks ... 30
2.11.3 Midipreparation of plasmid DNA ... 30
2.11.4 Isolation of total RNA from cell cultures... 30
2.11.5 Determination of nucleic acid concentration... 30
2.12 Cloning techniques ... 31
2.12.1 Cleavage of DNA with restriction endonucleases ... 31
2.12.2 Isolation of DNA fragments from agarose gels ... 31
2.12.3 Dephosphorylation of plasmid DNA ... 31
2.12.4 Ligation of DNA fragments ... 31
2.12.5 Subcloning of PCR and RT PCR products / TA cloning ... 32
2.12.6 Transformation of competent bacteria with plasmid DNA ... 33
2.13 Gel electrophoresis ... 33
2.13.1 Agarose gel electrophoresis of DNA ... 33
2.13.2 Length standard ... 34
2.14 Polymerase Chain Reaction (PCR) ... 34
2.14.1 Amplification of DNA fragments from plasmid DNA ... 34
2.14.2 Reverse Transcription ... 35
2.14.3 Quantitative real time PCR-analyses ... 36
2.14.4 Sequence analysis / DNA-sequencing after Sanger ... 38
2.15 Protein chemical techniques ... 39
2.15.1 Isolation of total protein from cell cultures ... 39
2.15.2 Isolation of nuclear extracts ... 39
2.15.3 Determination of protein concentration ... 40
2.15.4 Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis (SDS-PAGE) ... 40
2.15.5 Transfer of proteins from Polyacrylamide gels to PVDF membranes... 41
2.15.6 Staining of polyacrylamide gels ... 42
2.15.7 Incubation of protein-bound membranes with antibodies ... 42
2.16 Co-Immunoprecipitation... 43
2.17 Duolink® II Proximity Ligation Assay (PLA) ... 44
2.17.1 PLA on cells ... 45
2.18 Electrophoretic mobility shift assay (EMSA) ... 47
2.18.1 Casting of PAGE gels for EMSA ... 47
2.18.2 Radioactive labeling using 5’-fill-in reaction ... 47
2.18.3 Gelshift reaction ... 48
2.19 Cell biological methods ... 49
2.19.1 Cell culture of eukaryotic cells ... 49
2.19.2 Cryo-preservation and revitalization of eukaryotic cells ... 49
2.19.3 Test for Mycoplasma contamination ... 50
2.19.4 Transfection of eukaryotic cells ... 50
2.19.4.1 Transfection of plasmids into eukaryotic cells ... 50
2.19.4.2 Transfection of small interfering RNA (siRNA) into eukaryotic cells ... 50
2.20 Luciferase measurement ... 51
2.21 Analysis of reporter gene measurements ... 51
2.22 Specificity protein-1 (Sp1) reporter assay... 52
2.23 Functional analysis of eukaryotic cells ... 52
2.23.1 Colony formation assay ... 52
2.24 In vivo-studies ... 53
2.24.1 Generation of a conditional LPXN knockout mouse model ... 53
2.24.2 FLP recombination of LPXN knockout ES cells ... 53
2.24.3 Blastocyst injection ... 53
3 Results ... 54
3.1 The interaction of LPXN with Caldesmon and it’s relevance for PCa cell migration ... 54
3.2 Confirmation of LPXN-CaD interaction ... 54
3.2.1 Co-immunoprecipitation of LPXN and l-CaD ... 54
3.2.2 In situ Proximity ligation assay (PLA) of LPXN and CaD ... 55
3.3 Increased interaction of LPXN and CaD during PCa cell migration ... 56
3.4 Increased interaction of LPXN and phosphorylated CaD during PCa cell migration ... 58
3.5 Localization of pCaD-LPXN interaction during migration of PCa cells ... 59
3.6 LPXN interacts with the extracellular signal-regulated kinase (ERK) ... 61
3.7 Basal expression of ERK in PCa cell lines PC-3, DU145 and LNCaP... 62
3.8 Increased interaction of LPXN and ERK during PCa cell migration ... 63
3.9 LPXN mediates phosphorylation status of CaD through interaction with ERK ... 65
3.10 The influence of LPXN on PCa cell adhesion ... 66
3.10.1 Expression of ITGB1 in the established PCa cell lines PC-3, DU145 and LNCaP ... 67
3.10.2 Leupaxin influences ITGB1 expression ... 68
3.10.3 LPXN influences activity of the Specificity protein 1 (Sp1) ... 72
3.11 LPXN affects radio-resistance of PCa cells ... 75
3.11.1 LPXN expression is enhanced upon ionizing radiation ... 81
3.11.2 ITGB1 expression is enhanced upon ionizing radiation ... 82
3.11.3 LPXN knockdown prevents radiation-induced upregulation of ITGB1 expression ... 83
3.12 The interaction of LPXN and the adhesion molecule p120CTN ... 85
3.12.1 The CTNND1 promoter is influenced by LPXN ... 87
3.12.2 LPXN does not directly bind to promoter sequences of the CTNND1 gene ... 88
3.13 Generation of a LPXN gene trap conditional knockout mouse model ... 93
3.13.1 The LPXN targeted trap construct... 93
3.13.2 Excision of reporter/selector cassette ... 94
3.13.3 First blastocyst injection of mouse embryonic stem cells ... 95
3.13.4 Cytogenetic analysis of mouse embryonic stem cells for blastocyst injection ... 95
3.13.5 Rescue of differentiated mES cells by RESGRO® culture medium ... 96
3.13.6 Second blastocyst injection of mouse embryonic stem cells ... 96
3.13.7 Genotyping of LPXN19 chimera offspring ... 97
3.13.8 Establishment of a homozygous LPXNflox/flox conditional knockout mouse model ... 98
3.13.9 Complete knockout of LPXN using the EIIA-Cre-loxP-system ... 98
3.13.10 Genotyping of LPXN19 knockout mice ... 100
3.13.11 Phenotypic analysis of LPXN19 knockout mice ... 101
4 Discussion ... 102
4.1 Summary of results ... 102
4.2 Paxillin proteins in cytoskeletal rearrangements and migration ... 104
4.3 Interaction of LPXN and CaD and its implications in prostate cancer ... 108
4.3.1 Caldesmon and its role in cytoskeletal rearrangements ... 108
4.3.2 LPXN modulates cytoskeletal rearrangements through interaction with CaD ... 111
4.4 The role of integrin family proteins in cell adhesion ... 114
4.4.1 Integrin signaling ... 114
4.4.2 Integrins and their implications in radio- and chemo-resistance ... 115
4.4.3 LPXN influences radio-resistance through regulation of integrin expression ... 117
4.5 How does LPXN regulate the expression of the adhesion protein p120-catenin? ... 122
4.5.1 The implications of the cell adhesion molecule p120CTN in LPXN-mediated PCa progression... 122
4.5.2 The nuclear function of paxillin family proteins ... 125
4.6 The physiological role of LPXN ... 128
4.7 Perspectives ... 130
5 Summary ... 134
6 Bibliography ... 137
7 Acknowledgements ... 160
List of Abbreviations
-m -meter
°C Degree Centigrade
A Purinbase Adenin
Ab Antibody
Amp Ampicillin
approx. Approximately
ATP Adenosine-5'-triphosphate
bp Base pair(s)
BSA Bovine serum albumine
C Pyrimidinbase Cytosine
cDNA complementary DNA
Ci Curie (3.7 x 1010Bq)
cm Centimeter
DAPI 4'-6'-Diamidino-2-Phenylindol
dATP Deoxyadenosine-5'-triphosphate
dCTP Deoxycytidine-5'-triphosphate
ddH2O bi-destilled water
dGTP Deoxyguanosine-5'-triphosphate
DMSO Demythl Sulfoxide
DNA Deoxyribonucleic acid
dNTPs Deoxynucloeside-5'-phosphate
ds double stranded
DTT Dithiotreitol
dTTp Deoxythymidine-5'-triphosphate
E.Coli Escherichia Coli
ECM Extracellular matrix
EDTA Ethylenediamine tetraacetic acid EGFP Enhanced green fluorescent protein
EGTA Ethyleneglycol-bis(β-aminoethyle)-N,N,N',N'- tetraacetic acid
EMSA Electrophoretic mobility shift assay
et al. et alteres
etc. et cetera
EtOH Ethanol
Fig. Figure
FITC Fluorescein isothiocyanate
g Gram
G Purinbase Guanosin
h hours
H/E Hematoxylin / Eosin
Kan Kanamycin
Kb Kilobase(s)
KCl Potassium chloride
kDa Kilo Dalton
l Liter
LB Luria-Bertani
LPXN Leupaxin
Luc Luciferase
M Molar
m- Milli-
mA Milliampere
MgCl2 Magnesium chloride
min minutes
ml Milliliter
mM Millimolar
mod. Modified
mRNA Messegner Ribonucleic acid
n Nano = 10-9
NaCl Sodium chloride
nm Nanometer
OD Optical density
oligo(dT) Oligodeoxythymidylic acid
p pico
PAGE Polyacrylamid gel electrophoresis
PBS Phosphate buffered saline
PCa Prostate Cancer
PCR Polymerase chain reaction
pH negative decimal logarithm of the hydrogen ion concentration
PMSF Phenylmethylsulfonyl fluoride
poly(dIdC) Poly-deoxyinosinic-deoxycytidylic acid
RNA Ribonucleic acid
RNAi RNA interference
rpm Rounds per minute
RT Room temperature
RT-PCR Reverse Transcriptase-PCR
SDS Sodium dodecyl sulfate
sec seconds
siRNA small interfering RNA
ss single stranded
SV 40 Simian Virus 40
T Pyrimidine base Thymidine
Tab. Table
Taq Thermus aquaticus
U Unit(s) (Enzymatic activity)
UV Ultraviolett
V Volt
Vol. Volume
w/o without
x g Multiple of acceleration of gravity
X-Gal 5-Bromo-4-Chloro-3-Indolyl-β-D-Galactopyranoside
µ Micro = 10-6
µg Microgram
µl Microliter
µm Micrometer
µM Micromolar
1 Introduction
1.1 The prostate carcinoma – at a glance
In 2008 prostate cancer (PCa) was the second most frequently diagnosed cancer and claimed the sixth leading cause of cancer-related death in men worldwide (Global cancer Facts & Figures 2ndEdt). A majority of these cases (three-quarters) are diagnosed primarily in economically developed countries, but are emerging in developing nations as well. In Germany PCa is the most common cancer type with 65830 (26.1 % of total cancer burden) diagnosed cases in 2010, followed by lung (13.9 %) and intestinal (13.4 %) cancer. With 12676 (10.8 % in 2010) deaths it claims the third leading cause of cancer-related death among men in Germany (Krebs in Deutschland 2009/2010, 2013).
Therefore, PCa is a serious health problem and a disease of increasing significance both, in Germany and worldwide.
Well-established risk factors for the development of PCa are age, race, and family history.
Age clearly is a risk factor, since the ten-year likelihood for a 75-year old man to get PCa is 6 %, whereas a man aged 35 has only a 0.1 % risk to develop PCa. A predisposition among close relatives has been documented and might account for 9 % of PCas.
However, a distinct genetic mutation has not been reported (Krebs in Deutschland 2009/2010, 2013). In addition, there are some discordant risk factors like diet, hormones and environmental cues that have been subject to extensive studies but did not reveal trusty evidence yet.
Within the last years the prostate cancer incidence has increased constantly. This is mainly due to prostate specific antigen (PSA) testing. The PSA test measures the blood level of PSA, a protein that is exclusively produced in the prostate. These levels can be used as a tumor marker as the blood levels of PSA are increasing with increasing size and growth of the prostate. Therefore, PSA testing detects clinically important tumors, but also those that grow slowly and are not life threatening. However, there are men suffering from PCa that do not show elevated PSA levels and additional reasons for a high PSA level exist. However, PSA testing has been extensively discussed, since a clear correlation of PSA and PCa was not shown so far (Kilpelainen et al. 2011). In addition to this, the PSA test cannot distinguish between locally defined and advanced PCa that would require different therapies.
The prostate tumor starts to develop as a hormone-dependent lesion and usually is apparent when men become concerned about urinary and sexual dysfunction. This early state tumor is growing slowly and is not life threatening, which is why active surveillance, instead of surgery, irradiation or hormone therapy is the favored treatment option of these tumors. However, a subset of these lesions will progress and result in an advanced setting of prostate cancer, which is characterized by higher invasive and metastatic capacities. Until today there is no effective therapy available for the advanced state of PCa, which is why it is always attended by a poor prognosis for the patient (Trachtenberg, Blackledge 2002; Edwards, Bartlett, John M S 2005). Although many genetic and epigenetic alterations for prostate carcinoma have been proposed, the exact cellular and molecular mechanisms underlying the progression from a locally defined to an advanced prostate carcinoma remain unknown, illustrating the difficulty of diagnosis and the need of new improvements in PCa therapy.
1.2 Cancer cell migration
1.2.1 The essential mechanisms of cancer cell migration
Metastatic spread, predominantly to the bone marrow, is the main cause of mortality in most prostate cancer patients. This complex process requires a number of genetic events in tumor cells that are incompletely understood. Cells have to invade and migrate through the surrounding tissue, escape from the primary tumor site to the circulation and form metastasis in distant organs. Therefore, a key feature of metastatic spread is cancer cell migration. Cancer cells possess a number of migration and invasion mechanisms, which mainly rely on the regulation of polarization, membrane extensions or protrusions, cell adhesion and cytoskeletal rearrangements (Fig. 1.1).
Fig. 1.1: Schematic overview of the processes required for migration. Cell migration relies on several components such as cell polarity, protrusion formation, the formation of new adhesions and cytoskeletal rearrangements that act all together to enable migration. The regulation of these processes is vital for the cell and deregulated in cancer cells. Nuc=Nucleus (Taken and modified from Ridley et al. 2003 and http://www.cellmigration.org).
Cell polarity is a major requirement for the determination of the direction of migration.
Environmental cues like chemoattractants or breakdown of cell-cell contacts (wound healing) predetermine this direction of migration and define a cell front and rear. The organization of the cytoskeleton finally establishes a stable polarity of the cell. At the leading edge of the cell a high frequency of actin reassembly is generating membrane protrusions to explore the environment and form focal adhesions. The generation of protrusions requires a scaffold of cytoskeletal structures that is supporting the expansion of the plasma membrane, as well as a contact to the extracellular matrix to provide traction forces for movement. The actin polymerization in these protrusions plays a major role for their stability and turnover. The Arp2/3 complex attaches to the side of already existing actin filaments and starts to add actin monomers resulting in a branched actin network. This actin network connects to the substratum via cell surface receptors of the cadherin and integrin family. Integrins consist of an α- and a β-subunit, which can form non-covalent heterodimers. They are composed of an extracellular ligand-binding site and a cytoplasmic domain linking the cytoskeletal network to the signal transduction pathways. Interestingly, integrins can mediate bidirectional signaling. On the one hand, intracellular signals can modulate the activity of integrins at
the plasma membrane (inside-out signaling). On the other hand, signals coming from the cellular environment through ligand-binding of ECM proteins are transmitted to affect intracellular processes (outside-in signaling) (Hynes 2002a; Lau et al. 2009). Upon integrin ligation downstream signaling pathways are activated and focal complexes of a large array of proteins are formed. The mature focal adhesion is composed of kinases and adapter proteins that facilitate signaling through their corresponding pathways.
Adapter proteins like Paxillin, ARA55 and Leupaxin, which belong to the paxillin protein family reside at focal adhesion sites and link the cytoskeleton to the extracellular matrix (ECM). These proteins are of major importance for the vital processes of migration, as the loss of intercellular adhesion is a prerequisite for the development and progression of cancer.
Another group of cell surface proteins involved in cell-cell adhesion is the cadherin protein family. Cadherins are trans-membranous proteins composed of an extracellular domain that is binding to cadherins of the neighboring cells and an intracellular domain that associates with catenins to build the basis for the formation of adhesion complexes.
Usually cadherins are responsible for cell-cell contacts that are important for maintenance of the tissue structure and prevent motility, which is why cadherins are known as suppressors of invasion and metastasis of epithelial cells (Paredes et al. 2012).
Carcinomas derive from epithelial cells and deregulation of E-cadherin is a common feature of these tumor cells.
All these proteins have specific functions in their component processes and act together to establish dynamic contacts between the extracellular environment and the cytoskeleton to generate contractile forces essential for cell migration.
1.2.2 Cytoskeletal rearrangement during cancer cell migration
Besides cell adhesion the motility of malignant tumor cells is depending on the stability and assembly of the cytoskeleton. The dynamics of the actin-cytoskeleton are regulated by the small GTPases of the Rho family. These GTPases are known as molecular switches in signaling pathways, as they hydrolyze GTP and are cycling between a GTP-bound (active) and a GDP-bound (inactive) form. The Rho family is divided into several subgroups, among these the Rac, cdc42 and Rho GTPases are the best characterized.
These GTPases are master regulators of the actin polymerization to generate stress fibers, filopodia and lamellipodia, respectively. These cytoskeletal structures are
indispensible for migration. The regulation of small Rho GTPases relies on a variety of activator and repressor proteins that target GTP-hydrolysis.
Another group of proteins that directly binds to actin such as cofilin, filamin or caldesmon regulates the stabilization of the actin cytoskeleton. These proteins facilitate the assembly and disassembly of the cytoskeleton by their affinity to actin. Thus, reduced binding of these actin-stabilizing proteins results in dynamic actin structures and facilitates cytoskeletal remodeling.
The investigation of the cellular and molecular mechanisms involved in cell adhesion and cytoskeletal rearrangements will add to the understanding of how cancer cells can disseminate and will lead to the development of new treatment options.
1.3 Leupaxin (LPXN) - at a glance
1.3.1 LPXN, a member of the paxillin protein family
The LPXN gene is located on chromosome 11q12 and possesses 9 exons, which produces a 386 amino acid protein. Leupaxin (LPXN) was originally identified in cells of hematopoietic origin in 1998 by Lipsky et al. (Lipsky et al. 1998). Due to its high sequence homology to the focal adhesion protein paxillin it was assigned to the paxillin protein family. The paxillin protein family consists of the eponymous paxillin, the androgen receptor-associated protein 55 (ARA55) formerly known as hydrogen peroxide- inducible clone 5 (HIC-5) and leupaxin (LPXN). Proteins of the paxillin protein family are characterized by their subcellular localization at focal adhesion sites. Focal adhesion sites are macromolecular assemblies of a large array of proteins that exhibit multiple protein-protein interactions including structural or membrane-spanning proteins that bind to their ligands in the extracellular matrix (ECM) as well as signaling proteins that mediate regulatory effects of ECM adhesion (Turner 2000).
Another characteristic of the paxillin protein family is the presence of a multiple of two highly conserved domain structures. The four (ARA55 and leupaxin) or rather five (paxillin) LD motifs at the N-terminal region of the proteins are composed of a leucine- rich amino acid sequence with an invariant leucine (L)-aspartic acid (D) pair. The C- terminal region harbors four approximately 55 amino acid long LIM domains, which contain conserved cysteine, histidine and aspartic acid residues. The LIM domain was first discovered in the homeobox-transcription factors Lin-11, Isl-1 and Mec-3 (=LIM) in
Caenorhabditis elegans (Way, Chalfie 1988). This protein domain displays highly conserved residues that guarantee the formation of a tandem zinc finger motif, which seems to be essential for secondary structure formation (Kadrmas, Beckerle 2004).
Usually zinc finger motifs are present in transcription factors and known to facilitate DNA binding. However, the function of LIM domains was long time believed to be restricted to protein-protein-interactions, but the presence of a LIM domain is emerging as a hallmark of proteins that can associate with the actin cytoskeleton, the transcriptional machinery or directly with DNA (Nishiya et al. 1998; Muller et al. 2002).
Fig. 1.1: Tandem zinc finger motif of LIM domains. Highly conserved residues generate a tandem zinc finger motif with a spacer of two amino acids. The formation of a tandem zinc finger motif seems to be essential for proper LIM domain function. Usually, zinc finger motifs are found in DNA binding proteins.
Taken from (Kadrmas, Beckerle 2004).
For ARA55 DNA binding via its LIM domains was described. This binding turned out to require zinc for the proper formation of the LIM domain. Each of the four LIM domains contributed to DNA binding of a poly(A) stretch such as those present in the 3’-end of mRNAs. Since, a consensus binding sequence was not found and a target gene was not described, ARA55 was suggested to associate with secondary DNA structures to exert its nuclear function. For paxillin it was shown that LD-motifs as well as LIM domains are important for protein-protein-interactions and localization to focal adhesion sites (Brown et al. 1996; Brown et al. 1998; Dawid et al. 1998). In addition, the LIM domains of LPXN were described to be similar in focal adhesion targeting by tyrosine phosphorylation but were distinct from paxillin function in cell adhesion and spreading (Chen, Kroog 2010).
In focal adhesions (FAs) paxillin proteins have various functions. Paxillin for instance binds to the cytoplasmic tail of several integrins and is thereby able to mediate signals
from the cellular environment into the cell through direct or indirect interaction with structural or signaling molecules like vinculin, PTP-PEST or the focal adhesion kinase (FAK) (Shen et al. 1998; Turner 2000). In addition, Paxillin is able to regulate the rho- family GTPases, which are major players of actin-cytoskeleton and adhesion dynamics (Petit et al. 2000).
1.4 The function of LPXN
In contrast to paxillin, there is only little evidence about the function of LPXN today and contradictory results are making the situation more complicated. Originally, LPXN was found to be expressed in hematopoietic cells (Lipsky et al. 1998). In this publication LPXN was described to form a complex with the non-receptor tyrosine kinase PYK2, belonging to the FAK family of kinases, to influence cell motility, spreading and apoptosis. In osteoclasts, LPXN associates with the sarcoma kinase, SRC, and is involved in bone resorption. In addition, LPXN localizes to the podosomal/sealing zone complex, which in other cells is known as focal adhesion (Gupta et al. 2003). In B-cells, LPXN plays an inhibitory role. Interaction of LPXN and LYN, a critical SRC family tyrosine kinase in B-cell receptor (BCR) signaling, is induced by BCR stimulation resulting in a suppression of BCR signaling (Chew, Lam 2007). Initially, LPXN was described as a cytoplasmic protein residing at focal adhesions. In rodent aortic smooth muscle cells LPXN interacts with the (FAK) to form a complex that attenuates nuclear accumulation of LPXN. In the nucleus LPXN functions as a serum response factor (SRF) cofactor to induce smooth muscle differentiation-marker gene expression (Sundberg-Smith et al. 2008). Obviously, LPXN is able to shuttle between the nuclear and cytoplasmic compartment.
Consequently, LPXN might be more than a focal adhesion protein and takes part in processes beyond FA formation.
The only clinically relevant observation of a LPXN mutation until today was an acute myeloid leukemia (AML) patient who was carrying a translocation (t(11;21)(q12;q22)).
This translocation fused the RUNX1 gene with the LPXN gene, which produced a RUNX1/LPXN fusion protein. Both proteins, wild type RUNX1 as well as the RUNX1/LPXN fusion protein were present in the nuclei of hematopoietic cells, where they were competing for the binding site in the promoter of colony-stimulating factor 1 receptor (CSF1R). Consequently, CSF1R expression was reduced, which resulted in disturbed proliferation and differentiation of the cells. Interestingly, subcutaneous
injection of pEGFP-N1-RUNX1/LPXN stably transfected NIH/3T3 cells into BALB/c nude mice resulted in development of carcinomas after 28 days (Dai et al. 2009). This study is providing in vitro evidence that LPXN might display a candidate gene associated with carcinogenesis. However, despite the functions mentioned above, only little is known about the physiological role of LPXN. Especially the molecular mechanisms of LPXN mediated processes are incompletely understood.
1.5 The function of LPXN in prostate cancer
First expression of LPXN in PCa was noticed as an Atlas™-array hybridization was conducted on micro-dissected human prostate carcinoma specimen in our research group (Voigt, 2003). Further studies confirmed focal overexpression exclusively in epithelial carcinoma cells in 22 % of prostate carcinomas analyzed and showed that LPXN expression was correlating with the gleason score of the corresponding carcinoma (Kaulfuss et al. 2008). These findings were supported by western blot analysis of LPXN expression in the PCa cell lines PC-3, DU145 and LNCaP, which showed that cell lines that represented the advanced setting of PCa (PC-3 and DU145) displayed higher expression levels of LPXN than non-invasive and androgen-dependent LNCaP cells (Kaulfuss et al. 2008). Moreover, LPXN was influencing the migration and invasion of PCa cells, especially of the invasive cell lines PC-3 and DU145. Downregulation of LPXN reduced the invasion of these cells and also a significant reduction in migration was observed (Kaulfuß, 2006). Overexpression of LPXN had promoting effects on migration and invasion in PC-3 cells (Beckemeyer, 2007). Interestingly, we could show that LPXN shuttles between the cytoplasm/membrane and the nucleus and is able to transactivate the androgen receptor. This activation results in increased transcription of androgen- responsive genes such as PSA (Kaulfuss et al. 2008).
The involvement of LPXN in PCa progression was further strengthened by in vivo studies using the transgenic adenocarcinoma of the mouse prostate (TRAMP) mouse model.
These TRAMP mice were bred with a mouse model that specifically overexpressed LPXN in the prostate. Double transgenic TRAMP/LPXN-mice resulting from this mating showed increased numbers of poorly differentiated PCa and distant metastasis as compared to control TRAMP mice. Using murine primary tumor cells isolated from the prostate of double transgenic TRAMP/LPXN-mice it was shown that LPXN is enhancing the invasion and migration abilities of these cells (Kaulfuß et la. 2009, von Hardenberg,
2010). In addition, LPXN-mediated invasion of PCa cells was described to involve the cell adhesion molecule p120catenin (p120CTN), which displayed negative correlation with LPXN expression. p120CTN is a major component of the adhesion complex, which also contains β-catenin. The expression of p120CTN has dramatic effects on the stabilization of the adhesion complexes. As mentioned earlier cell adhesion is a critical feature of cell migration and is severely affected by the stabilization of the adhesion complex.
Overexpression of LPXN causes p120CTN expression to decrease, leading to a destabilization of the adhesion complexes, to the reduction of cell-cell contacts and subsequent accumulation of β-catenin in the nucleus. The induction of β-catenin target gene expression such as matrix metalloproteases (e.g. MMP-7) finally leads to degradation of the extracellular matrix and will enable invasion into the surrounding tissue (Kaulfuss et al. 2009). The expression of multiple matrix metalloproteases is a known hallmark of tumor cell invasion (Ellerbroek, Stack 1999; Stetler-Stevenson 2001).
This mechanism is leaving an explanation for the invasive growth of PCa with LPXN overexpression. However, the molecular mechanism that drives LPXN-mediated migration of PCa cells still remained elusive.
To investigate how LPXN might influence prostate cancer cell migration, a yeast-2- hybrid screening was conducted on a prostate specific cDNA library, which identified the actin-binding protein caldesmon (CaD) as a putative interaction partner of LPXN (von Hardenberg, 2007). CaD was demonstrated to reduce invasion of breast and intestinal tumor cells by regulation of podosome and invadopodia formation (Yoshio et al. 2007). In addition, CaD was shown to regulate cell growth and survival of vascular smooth muscle cells via the cytoskeletal tension-FAK-ERK1/2 axis (Yokouchi et al.
2006). As a protein that is implicated in cytoskeletal rearrangements CaD might display a putative candidate to execute LPXN-associated changes in migration of PCa cells. The elucidation of the molecular mechanisms underlying the LPXN-mediated progression of PCa might be of great value for patients with advanced prostate carcinoma and might also open new avenues for therapeutic intervention.
1.6 Aims of this study
In the present thesis the molecular mechanisms of LPXN-mediated PCa progression are investigated. Based on previous findings the underlying mechanism of LPXN-mediated
migration of PCa cells is elucidated. In addition, not only the pathological but also the physiological role of LPXN is subject of the thesis.
The main aims were:
Analyses on the putative LPXN interaction partner CaD and its effect on PCa cell migration
o Confirmation of the interaction of CaD and LPXN in prostate cancer cells o Analyses of the interaction of CaD and LPXN by co-immunoprecipitation o Analyses of the interaction of CaD and LPXN by in situ proximity ligation
assay (PLA)
Analyses on the interaction of CaD and LPXN during PCa cell migration
o Analyses on the putative LPXN interaction partner ERK during PCa cell migration
Analysis on the influence of LPXN on adhesion of PCa cells
Analysis on the influence of LPXN on the expression of the adhesion molecule p120CTN
o Cloning of p120CTN promoter fragments into the reporter plasmid pGL4.16 luc2CP/Hygro
o Identify LPXN responsive elements in the p120CTN promoter region using luciferase reporter gene assays
o Identify LPXN binding sites in the p120CTN promoter region using EMSA
Analysis on the influence of LPXN on the expression of β1 integrin (ITGB1) o Analysis of β1 integrin (ITGB1) expression after LPXN knockdown o Analysis of β1 integrin (ITGB1) expression after LPXN overexpression
Analysis of LPXN-mediated radio-resistance of PCa cells
o Analysis on the survival of PCa cells after LPXN knockdown and exposure to ionizing irradiation
o Analysis on the survival of PCa cells after inhibition of β1 integrin (ITGB1) and exposure to ionizing irradiation
Analysis on the effect of ionizing irradiation on LPXN expression
o Analysis of LPXN expression in PCa cells after exposure to ionizing irradiation
Analysis on the effect of ionizing irradiation on ITGB1 expression
o Analysis of β1 integrin (ITGB1) expression in PCa cells after exposure to ionizing irradiation
Generation of a conditional knockout mouse model for LPXN
o Purchase of an ES cell clone with a LPXN targeted trap construct
o Excision of the reporter/selector cassette to generate a conditional allele o Blastocyst injection of mutant ES cells
o Breeding of chimera to establish a conditional knockout mouse model for LPXN
2 Materials and Methods
2.1 Chemicals and Reagents
Chemicals Manufacturer
5-Bromo-4-Chloro-3-indolyl-α-D-
galactopyranosid(X-α-Gal) Carl Roth GmbH, Karlsruhe, Germany Adenosintriphosphate (ATP) Biomol GmbH, Hamburg, Germany
Agar Carl Roth GmbH, Karlsruhe, Germany
Agarose Life Technolgies, Darmstadt, Germany
Ammonium persulfate (APS) Carl Roth GmbH, Karlsruhe, Germany
Ampicillin Carl Roth GmbH, Karlsruhe, Germany
Ampuwa Fresenius AG, Bad Homburg, Germany
Bacto-Trypton Carl Roth GmbH, Karlsruhe, Germany
Borica cid Scharlau Chemie S.A., Barcelona, Spain
Cell culture media PAN, Aidenbach, Germany
Dimethylsulfoxide Carl Roth GmbH, Karlsruhe, Germany
Dithiotreitol (DTT) Biomol GmbH, Hamburg, Germany
DNA Stain G Serva GmbH, Heidelberg, Germany
dNTPs (100 mM) Life Technolgies, Darmstadt, Germany
Ethanol Chemie Vertrieb Hannover, Hannover,
Germany
Ethidiumbromid Sigma-Aldrich, Deisenhofen, Germany
Ethylendiamine-tetraacetic acid (EDTA) ICN, Aurora, USA Ethylenglycol-bis(β-aminoethyl)-N,N,N',N'-
tetraacetat (EGTA) Carl Roth GmbH, Karlsruhe, Germany
Ficoll® 400 AppliChem GmbH, Darmstadt,
Germany
Formaldehyde Carl Roth GmbH, Karlsruhe, Germany
Glycerol Carl Roth GmbH, Karlsruhe, Germany
Glycin Carl Roth GmbH, Karlsruhe, Germany Igepal CA-630 (NP-40) Sigma-Aldrich, Deisenhofen, Germany
Isopropanol Carl Roth GmbH, Karlsruhe, Germany
Kanamycin Sigma-Aldrich, Deisenhofen, Germany
Magnesium chloride hexahydrate Carl Roth GmbH, Karlsruhe, Germany
Methanol Carl Roth GmbH, Karlsruhe, Germany
N,N,N',N'-Tetramethylethylenediamine
(TEMED) Carl Roth GmbH, Karlsruhe, Germany
NuPAGE™ LDS Sample buffer (4x) Life Technolgies, Darmstadt, Germany NuPAGE™ MES Running buffer (20x) Life Technolgies, Darmstadt, Germany NuPAGE™ See Blue Plus2 Life Technolgies, Darmstadt, Germany
Orange G Sigma-Aldrich, Deisenhofen, Germany
PD98059 (MEK1 Inhibitor) #9900S Cell Signaling, Danvers, MA, USA
Penicillin/Streptomycin PAN, Aidenbach, Germany
Phenylmethylsulfonyl flouride (PMSF) Sigma-Aldrich, Deisenhofen, Germany Poly(deoxyinosinic-deoxycytidylic) acid
sodiumsalt Sigma-Aldrich, Deisenhofen, Germany
Potassium chloride Carl Roth GmbH, Karlsruhe, Germany
RNase inhibitor MBI, St. Leon-Rot, Germany
Roti®Nanoquant Carl Roth GmbH, Karlsruhe, Germany
Roti®Phorese (29:1) Carl Roth GmbH, Karlsruhe, Germany Simply Blue Safe Stain Life Technolgies, Darmstadt, Germany Sodiumdodecylsulfate (SDS) Serva GmbH, Heidelberg, Germany
Tris AppliChem GmbH, Darmstadt,
Germany
Triton X-100 Fluka, Deisenhofen, Germany
Tween 20 Merck, Darmstadt, Germany
Vectashield with DAPI VectorLab, Burlingame, USA
Yeast extract Carl Roth GmbH, Karlsruhe, Germany
α-P33-Deoxyadenosine 5'-triphosphate (dATP) Hartmann Analytic GmbH, Braunschweig, Germany
2.2 Biochemicals and enzymes
Biochemical Manufacturer
Albumin fraction V Biomol GmbH, Hamburg, Germany
BigDye® Life Technologies, Darmstadt, Germany
Complete Mini Protease Inhibitor Cocktail
Tablets Roche, Mannheim, Germany
Direct PCR Lysis Reagent Peqlab, Erlangen, Germany
DNAse Sigma-Aldrich, Deisenhofen, Germany
Fetal bovine serum (SeraPlus) PAN, Aidenbach, Germany MangoTaq-DNA-Polymerase Bioline, Luckenwalde, Germany
MycoZAP™ Spray Lonza, Cologne, Germany
Phalloidin, FITC-labeled Sigma-Aldrich, Deisenhofen, Germany Phosphatase Inhibitor Mix II, solution Serva GmbH, Heidelberg, Germany Phusion™ High-Fidelity DNA Polymerase Finnzymes, Espoo, Finland
Proteinase K Carl Roth GmbH, Karlsruhe, Germany
Restriction Enzymes New England Biolabs, Ipswich, USA Reverse Transcriptase SuperScript II Life Technologies, Darmstadt, Germany
RNase A AppliChem GmbH, Darmstadt, Germany
T4 DNA Ligase Life Technologies, Darmstadt, Germany
Trypsin/EDTA solution PAN, Aidenbach, Germany
Human Epidermal Growth Factor (EGF)
#8916SF Cell Signaling, Danvers, MA, USA
DNA Polymerase I, Klenow-fragment New England Biolabs, Ipswich, USA
2.3 Usage ware
Usageware Manufacturer
10, 13, 50 ml Cellstar® Tubes Greiner-bio-one, Kremsmünster, Austria
384-well plates, white ABgene, Hamburg, Germany
6-, 24-well cell culture plates Sarstedt, Nürnbrecht, Germany Corning Inc., New York, USA
Blotting Paper GB 002, 003, 004 Schleicher &Schnüll, Dassel, Germany
Cell culture flasks Sarstedt, Nürnbrecht, Germany
Coverglass 24x60mm Menzel Gläser, Braunschweig, Germany
FALCON culture slides Becton Dickinson GmbH, Heidelberg, Germany
Flat-bottomed Nuclon™ surface 96-well cell
culture plates Nunc A/S, Danmark
Membrane filter Millipore, Billerica, USA
Microcentrifuge Tubes Sarstedt, Nürnbrecht, Germany NuPAGE™ 4 - 12 % Bis-Tris Gels Life Technologies, Darmstadt
Petri dishes Greiner Nunc., Nürntingen, Germany
Pipet tips Sarstedt, Nürnbrecht, Germany
PVDF-Membrane GE Healthcare, Munich, Germany
Quarz-Cuvette Hellma, Mühlheim, Germany
Sterile Single-use filter Minisart Sartorius, Göttingen, Germany Nunc® F96 MicroWell™ white Nunc A/S, Danmark
2.4 Technical equipment
Technical equipment Manufacturer
FluorChem® Q Alpha Innotech, Logan, Utah, USA
Confocal Laser Scanning Microscope IX81 Olympus, Hamburg, Germany
SynergyMx Bio Tek, Bad Friedrichshall, Germany
Irradiation device 225A Gulmaymedical, Camberley, UK
Fujifilm FLA-5100 Fuji Life Science, Düsseldorf, Germany
HT7900 Fast Real-Time PCR System Applied Biosystems GmbH, Darmstadt, Germany
2.5 Sterilization of solution and equipment
Laboratory equipment, solutions and culture media were autoclaved at 121 °C and 105 Pa for 60 min or sterilized at 220 °C over night.
2.6 Ready-to-use Reaction systems
Reaction system Manufacturer
Direct PCR tail reagent Peqlab, Erlangen, Germany
ECL Prime GE Healthcare, Munich, Germany
Myco Alert® Mycoplasma Detection Kit Lonza, Cologne, Germany
peqGold Total RNA Kit Peqlab, Erlangen, Germany
NucleoSpin® Extract II Macherey & Nagel, Düren, Germany
Plasmid Midi Kit Life Technologies, Darmstadt, Germany
Platinum® SYBR®-Green qPCR Super Mix-
UDG Life Technologies, Darmstadt, Germany
PhosSTOP Phosphatase Inhibitor Roche, Mannheim, Germany Duolink® in situ Kit Olink Bioscience, Uppsala, Sweden MSB® Spin PCR apace Invitek, Berlin, Germany
MicroSpin Columns GE Healthcare, Munich, Germany
2.7 Solutions
Solutions for routine applications were prepared according to (Maniatis et al. 1982).
Required chemicals were dissolved in ddH2O and autoclaved or filtered under sterile conditions when necessary.
Solutions Composition
AP Buffer 100 mM NaCl
50 mM MgCl2
100 mM Tris/HCl pH 9.5
AP Staining Solution 45 µl NBT (75 mg/ml in DMF)
35 µl BCIP (50 mg/ml in DMF)
in 10 ml AP-Buffer
Blocking Buffer (Western Blot) 1x TBS-Tween
5 % low-fat dry milk
Blocking Buffer (PLA) 1x PBS
3 % BSA
Coomassie Staining Solution 30 % (v/v) Methanol
10 % (v/v) Glacialacetic acid
0.05 % (w/v) Coomassie Brilliant Blue R250
Cytoplasmic Extraction Buffer 20 mM HEPES pH 7.4 10 mM KCl
10 % (v/v) Gylcerol 1 mM EDTA
0.1 % IGEPAL-CA-360 (NP-40) 3 mM DTT
1 Tablet/ 10 ml Complete Mini protease inhibitor
EMSA Shift Buffer 100 mM HEPES, pH 7,9
200 mM KCl
5 mM MgCl2
20 % Ficoll
0.5 mM EGTA
2.5 mM EDTA
EMSA Running Buffer Stock Solution 1x TBE
88 mM Boric acid
2 mM EDTA
140 mM Tris pH 8.0
Lysis Buffer for protein (modified
RIPA) 150 mM NaCl
1 mM EDTA
50 mM Tris-HCl, pH 7.4
1 % IGEPAL-CA-360 (NP-40)
0.25 % Natriumdeoxycholat
1 Tablet/10 ml Complete Mini protease
inhibitor
100 µl /10 ml Phosphatase-Inhibitor-Mix II,
solution
Nuclear Extraction Buffer 20 mM HEPES pH 7.4 420 mM KCl
20 % (v/v) Glycerol 1 mM EDTA
3 mM DTT
1 Tablet/10 ml Complete Mini protease inhibitor
P1 Buffer (Plasmid Preparation) 50 mM Tris-HCl, pH 8.0
10 mM EDTA
100µg/ml RNase A
P2 Buffer (Plasmid Preparation) 200 mM NaOH
1 % SDS
P3 Buffer (Plasmid Preparation) 3 M Potassium acetate (pH 5.5) Potassium Phosphate (1M) 0.17 KH2PO4
0.72 K2HPO4
10x PBS 1.37 M NaCl
81 mM Na2PO4
27 mM KCl
14.7 mM KH2PO4
Stop Mix 1 95 % Formamide
20 mM EDTA
0.05 % Bromphenolblau
0.05 % Xylencyanol
Stop Mix 2 15 % Ficoll 400
200 mM EDTA
0.1 % Orange G
10x TBS 1.37 M NaCl
100 mM Tris
Adjusted to pH 7.6 using HCl
1x TBS-Tween (TBS-T) 1x TBS
0.1 % Tween 20
Transfer Buffer IIa (Western Blot) 25 mM Tris pH 8.3
150 mM Glycin
20 % Methanol
5x Tris-Boricacid-EDTA (TBE) Buffer 445 mM Tris/HCl, pH 8.0
445 mM Boricacid
10 mM EDTA
20x Turbo Buffer 0.2 M NaOH
Adjusted to pH 8.0 using solid H3BO3
Washing Buffer (Western Blot) 1x TBS-Tween
2.5 % low-fat dry milk
X-Gal Stock solution 20 mg X-Gal/ml N.N.-Dimethyl-foramide
2.8 Culture media, antibiotics, agar plates
2.8.1 Culture media for bacteria
Luria-Bertani medium (LB medium)
10g/l Bacto-Trypton 5g/l Yeast Extract 10g/l NaCl
pH 7.0
The culture medium was prepared using bi-destilled water, autoclaved and kept at 4 °C.
For selection ampicillin (50 µg/ml final concentration) or kanamycin (25 µg/ml final concentration) were added to the medium, respectively.
2.8.2 Agar plates
Before autoclaving 1.5 % (w/v) Agar-Agar was added to the liquid LB medium. After the medium was autoclaved it was cooled down to 55°C on a stirring plate before antibiotics were added in a corresponding concentration (ampicillin: 50 µg/ml, kanamycin:
25 µg/ml). Finally, the medium was poured into petri dishes and kept in a sterile plastic bag at 4°C.
2.8.3 Culture media for eukaryotic cell cultures
Media used for culture of eukaryotic cells were purchased from PAN, Aidenbach, Germany. Before use fetal bovine serum (FBS) and antibiotics (penicillin/streptomycin) were added. For cell culture the following media were used:
Medium for PC-3, DU145 and LNCaP cells:
RPMI 1640 (PAN, Aidenbach, Germany) 100 µg/ml Streptomycin 100 U/ml Penicillin
10 % fetal bovine serum (FBS)
Medium for HeLa cells:
MEM (PAN, Aidenbach, Germany) 100 µg/ml Streptomycin
100 U/ml Penicillin
10 % fetal bovine serum (FBS)
ES cell medium:
Dulbecco’s MEM (DMEM) (Life Technologies, Germany) 0.1 mM Non essential amino acids
1.0 mM Sodium pyruvate 10.0 µM β-Mercaptoethanol 2.0 mM L-Glutamine
20 % Fetal calf serum (FCS)
1000 U/ml Recombinant leukaemia inhibitory factor (LIF)
For cryopreservation of the cells in liquid nitrogen 8 % DMSO have been added to the medium.
2.9 Biologic material
2.9.1 Bacterial strains
For the transformation of plasmids into competent bacterial cells, the Escherichia coli strain DH5α (Hanahan 1983) was used and purchased from Life Technologies, Karlsruhe, Germany.
2.9.2 Eukaryotic cell lines
PC-3 Human prostate adenocarcinoma cell line (bone metastasis), ATCC, Rockville, USA, castration resistant cells (Kaighn et al. 1979; Ohnuki et al. 1980)
DU145 Human prostate adenocarcinoma cell lines (brain metastasis), ATCC, Rockville, USA, castration resistant cells (Stone et al. 1978)
LNCaP Human prostate adenocarcinoma cell line (lymphnode metastasis), ATCC, Rockville, USA, androgen dependent (Horoszewicz et al.
1983)
HeLa Human cervix adenocarcinoma cell line, ATCC, Rockville, USA
2.9.3 Mouse strains
All experiments were conducted according to the European and German protection of animals act. The number of sacrificed animals and the stress and pain they were suffering was kept to the minimum. Euthanasia of mice was performed either by CO2- asphyxation or cranial dislocation. Mice were kept at a 12 hours light/dark cycle at 22°C and 55 ±5 % relative humidity. C57BL/6 wild type mice were obtained from a colony of our own department. EIIA-Cre mice (Dooley et al. 1989) were kindly provided by Nils Brose and Klaus-Armin Nave (Max Planck Institute of Experimental Medicine, Göttingen, Germany)
2.9.4 Synthetic DNA-oligonucleotides
For the generation of PCR products and for quantitative real time PCR analyses as well as for the EMSA experiments synthetic oligonucleotides were purchased from Eurofins MWG Operon (Ebersberg, Germany). Sequences are listed starting from 5’- to 3’- end.
Primer used for EMSA:
Fragment Sequence
8 Fw 5'- TTTT TATGCCTGGTTCCTATTGGAAGCTCACAGGGGCTG -3' Rev 5'- TTTT CAGCCCCTGTGAGCTTCCAATAGGAACCAGGCATA -3' 9 Fw 5'- TTTT GGCTGACATCACTTAGGAAAGCGAAGGGGGTAGGG -3' Rev 5'- TTTT CCCTACCCCCTTCGCTTTCCTAAGTGATGTCAGCC -3' 10 Fw 5'- TTTT TAGGGCTGCCAGATCAGTTTGTCACCACCCAGGCT -3' Rev 5'- TTTT AGCCTGGGTGGTGACAAACTGATCTGGCAGCCCTA -3' 11 Fw 5'- TTTT AGGCTCCCTTGCCTTTGGCTGGGTGCAACTTCCAT -3' Rev 5'- TTTT ATGGAAGTTGCACCCAGCCAAAGGCAAGGGAGCCT -3' 12 Fw 5'- TTTT TCCATTTTAGGTGTTGGATCTGAGGGGGAAAAAAA -3' Rev 5'- TTTT TTTTTTTCCCCCTCAGATCCAACACCTAAAATGGA -3' 13 Fw 5'- TTTT AAAAAAGAGAGAGGGAGAGAGAGAGAAAGAAGAGC -3' Rev 5'- TTTT GCTCTTCTTTCTCTCTCTCTCCCTCTCTCTTTTTT -3' 14 Fw 5'- TTTT AGAGCAGGAAAGATCCCGAAAGGAGGAAGAGGTGG -3' Rev 5'- TTTT CCACCTCTTCCTCCTTTCGGGATCTTTCCTGCTCT -3' 15 Fw 5'- TTTT GGTGGCGAAAAATCAACTGCCCTGCTGGATTTGTC -3'
Rev 5'- TTTT GACAAATCCAGCAGGGCAGTTGATTTTTCGCCACC -3' 16 Fw 5'- TTTT TTGTCTTTCTCAGCACCTTGGCGAAGCCTTGGGTT -3' Rev 5'- TTTT AACCCAAGGCTTCGCCAAGGTGCTGAGAAAGACAA -3' 17 Fw 5'- TTTT GGGTTTCTTTCTTAAAGGACTGATTTTTAGAACTC -3' Rev 5'- TTTT GAGTTCTAAAAATCAGTCCTTTAAGAAAGAAACCC -3' 18 Fw 5'- TTTT AACTCCACATTTGAGGTGTGTGGCTTTTGAAGAAA -3' Rev 5'- TTTT TTTCTTCAAAAGCCACACACCTCAAATGTGGAGTT -3' 19 Fw 5'- TTTT AGAAAATGTATGTACTGACGGGAAAAGGAGGATAA -3' Rev 5'- TTTT TTATCCTCCTTTTCCCGTCAGTACATACATTTTCT -3' 1-2 Fw 5'- TTTT TGTCTCCCTTGCCTCTTCCGCCCCCCTCAGCTCT -3' Rev 5'- TTTT AGAGCTGAGGGGGGCGGAAGAGGCAAGGGAGACA -3' 2-3 Fw 5'- TTTT CAGTAATTCCTCAGAGATTGTACAGTCTCTCCAC -3' Rev 5'- TTTT GTGGAGAGACTGTACAATCTCTGAGGAATTACTG -3' 3-4 Fw 5'- TTTT TTAAATATAAATATATAAATATAAATATATATAT -3' Rev 5'- TTTT ATATATATATTTATATTTATATATTTATATTTAA -3' 4-5 Fw 5'- TTTT TATAAACTTCCCCCTGTCTTTCTCTCCTCTCTTT -3' Rev 5'- TTTT AAAGAGAGGAGAGAAAGACAGGGGGAAGTTTATA -3' 5-6 Fw 5'- TTTT TTTTAATTTTCTATAATAAAGTTTCCTATTGGAT -3' Rev 5'- TTTT ATCCAATAGGAAACTTTATTATAGAAAATTAAAA -3' 6-7 Fw 5'- TTTT AGGTCAGCTCCCTGATTTATGCCTGGTTCCTATTG -3' Rev 5'- TTTT CAATAGGAACCAGGCATAAATCAGGGAGCTGACCT -3' 7-8 Fw 5'- TTTT AAGCTCACAGGGGCTGACATCACTTAGGAAAGCG -3' Rev 5'- TTTT CGCTTTCCTAAGTGATGTCAGCCCCTGTGAGCTT -3' 8-9 Fw 5'- TTTT AGGGGGTAGGGCTGCCAGATCAGTTTGTCACCAC -3' Rev 5'- TTTT GTGGTGACAAACTGATCTGGCAGCCCTACCCCCT -3' 9-10 Fw 5'- TTTT CAGGCTCCCTTGCCTTTGGCTGGGTGCAACTTCC -3' Rev 5'- TTTT GGAAGTTGCACCCAGCCAAAGGCAAGGGAGCCTG -3' 10-11 Fw 5'- TTTT TTTTAGGTGTTGGATCTGAGGGGGAAAAAAAAGA -3' Rev 5'- TTTT TCTTTTTTTTCCCCCTCAGATCCAACACCTAAAA -3' 11-12 Fw 5'- TTTT AGAGGGAGAGAGAGAGAAAGAAGAGCAGGAAAGA -3' Rev 5'- TTTT TCTTTCCTGCTCTTCTTTCTCTCTCTCTCCCTCT -3' 12-13 Fw 5'- TTTT CCCGAAAGGAGGAAGAGGTGGCGAAAAATCAACT -3' Rev 5'- TTTT AGTTGATTTTTCGCCACCTCTTCCTCCTTTCGGG -3'
13-14 Fw 5'- TTTT CCCTGCTGGATTTGTCTTTCTCAGCACCTTGGCG -3' Rev 5'- TTTT CGCCAAGGTGCTGAGAAAGACAAATCCAGCAGGG -3' 14-15 Fw 5'- TTTT AGCCTTGGGTTTCTTTCTTAAAGGACTGATTTTT -3' Rev 5'- TTTT AAAAATCAGTCCTTTAAGAAAGAAACCCAAGGCT -3' 15-16 Fw 5'- TTTT GAACTCCACATTTGAGGTGTGTGGCTTTTGAAGA -3' Rev 5'- TTTT TCTTCAAAAGCCACACACCTCAAATGTGGAGTTC -3' 16-17 Fw 5'- TTTT AATGTATGTACTGACGGGAAAAGGAGGATAAGCA -3' Rev 5'- TTTT TGCTTATCCTCCTTTTCCCGTCAGTACATACATT -3'
Vector-specific primer:
Primer name Sequence
Sp6new 5'- TTAGGTGACACTATAGAATACTCAAGC -3'
T7new 5'- AATACGACTCACTATAGGGCGAATTGG -3'
pGL3-fw 5'- CTAGCAAAATAGGCTGTCCCCAGTGC -3'
pGL4-rev-129 5'- GCCCTTCTTAATGTTTTTGGCATCTTC -3'
p120CTN-specific primer:
Primer name Sequence
p120Xho-240fw 5'- CTCGAGTAAAAAGCCCTTGTTCCTTGTCTCCCTTGCC -3' p120Xho-508fw 5'- CTCGAGGCTCTAATGCAATTAATCCAAAAC -3' p120Xho-1024fw 5'- CTCGAGGGCATAAAATGTTCTTGACATGAGA -3' p120Xho-1942fw2 5'- CTCGAGCCTACACTAGAGTGCAATGGCATG -3' p120Bgl-TSrev 5'- AGATCTCCTGTGAGCTTCCAATAGGAACCA -3' p120Bgl+100rev 5'- AGATCTCTAAAATGGAAGTTGCACCCAGCCAAAG -3' p120Bgl+329rev 5'- AGATCTGACAAAAATTCGACTTGCTTATCCT -3'
Human-specific primer for quantitative real time PCR:
Primer name Sequence
TBP-Fw 5'- AGCCTGCCACCTTACGCTCAG -3'
TBP-Rev 5'- TGCTGCCTTTGTTGCTCTTCCA -3'
PBGD-Fw 5'- GCAATGCGGCTGCAACGGCGGAAG -3'
PBGD-Rev 5'- CCTGTGGTGGACATAGCAATGATT -3'
LPXN-CDS-F1 5'- CCCAGAGCACTTCTTCTGCT -3'
LPXN-CDS-R1 5'- GCTAAGAAATCCTTTCGGCA -3'
ITGB1-Q2-Fw 5'- CCCATTGTAAGGAGAAGGATGTTG -3'
ITGB1-Q2-Rev 5'- CAAGGCCAATAAGAACAATTCCAG -3'
Mouse-specific primer for genotyping:
Primer name Sequence
LPXN-5’ 5'- CTCAGGCTGTAATGGGTATGAAG -3'
LPXN-3’ 5'- GCTATGGCTTTACAGCTCTGTTCT -3'
LPXN-Fw 5'- AGTTGGATGAGCTCATGGCCCACC -3'
LoxR 5'- TGAACTGATGGCGAGCTCAGACC -3'
mLPXN-In-3-4-Fw 5'- AGTTCTCCTTACTTTTGCCAGCA -3'
mLPXN-In-4-5-Rev 5'- CGGCGTGATCATGCAGAA -3'
2.9.5 Synthetic RNA oligonucleotides
The used small interfering RNAs were purchased from Life Technologies (Darmstadt, Germany).
Human LPXN “siLPXN”
Target sequence: 5’-GGGGCAGCUCGUGUAUACUACCAAU-3’
Sense strand: 5’-GGGGCAGCUCGUGUAUACUACCAAUdTdT-3’
Anti-sense strand: 5’-AUUGGUAGUAUACACGAGCUGCGCCdTdT-3’
Luciferase (Photinuspyralis) “siLuc”
Target sequence: 5’-CGUACGCGGAAUACUUCGA-3’
Sense strand: 5’-CGUACGCGGAAUACUUCGAdTdT-3’
Anti-sense strand: 5’-UCGAAGUAUUCCGCGUACGdTdT-3’
2.9.6 Antibodies
2.9.6.1 Inhibitory antibodies
Antibody Source
β1-integrin inhibitory antibody, clone AIIB2, monoclonal antibody, rat
Kindly provided by Prof. Dr. Nils Cordes, OncoRay, Dresden, Germany
Rat IgG – Isotype Control (ab37361) Abcam, Cambridge, UK
2.9.6.2 Primary antibodies
Primary antibody Manufacturer
Anti-LPXN (283 G), monoclonal
antibody, mouse ICOS Corp., Bothell, USA
Anti-Caldesmon (8-L-Caldesmon), monoclonal antibody, mouse (#610660)
BD Transduction Laboratories, Heidelberg, Germany
Anti-Integrin β1 (D2E5) monoclonal
antibody, rabbit (#9699) Cell Signaling, Danvers, MA, USA Anti-phospho-Caldesmon Ser-789,
polyclonal antibody, rabbit (sc-12931)
Santa Cruz Biotechnology, Heidelberg, Germany
Anti-p44/42 MAPK (ERK1/2),
polyclonal antibody, rabbit Cell Signaling, Danvers, MA, USA Anti-phospho-p44/42 MAPK
(ERK1/2) (Thr202/Tyr204) D13.13E4 Cell Signaling, Danvers, MA, USA
Anti-STAT1α p91 (C-24), polyclonal antibody, rabbit
Santa Cruz Biotechnology, Heidelberg, Germany
Anti-α-Tubulin (clone B-5-1-2),
monoclonal antibody, mouse Sigma-Aldrich, Deisenhofen, Germany Anti-Leupaxin (N-terminal), polyclonal
antibody, rabbit (SAB4200010) Sigma-Aldrich, Deisenhofen, Germany Anti-cmyc Tag (clone 4A6),
monoclonal antibody, mouse Sigma-Aldrich, Deisenhofen, Germany
2.9.6.3 Secondary antibodies
Secondary antibody Manufacturer
Anti-rabbit IgG, alkaline phosphatase
conjugated (A-3687), goat Sigma-Aldrich, Deisenhofen, Germany Anti-rabbit IgG (H+L), HRP (horse
radish peroxidase) conjugated, goat
Dianova Jackson ImmunoResearch, Hamburg, Germany
Anti-rabbit IgG, Cy3-conjugated
(C2306) Sigma-Aldrich, Deisenhofen, Germany
Anti-mouse IgG, alkaline phosphatase-
conjugated (A-3688), rabbit Sigma-Aldrich, Deisenhofen, Germany Anti-mouse IgG (H+L), HRP-
conjugated, rabbit
Dianova Jackson ImmunoResearch, Hamburg, Germany
Anti-mouse IgG, Cy3-conjugated
(C2181) Sigma-Aldrich, Deisenhofen, Germany
2.9.7 Plasmids and Vectors
Plasmid/Vector Source
pGEM-Teasy Promega, Wisconsin, USA
pGL4.16 luc2CP/Hygro Promega, Wisconsin, USA pGL4.50 luc2CP/CMV/Hygro Promega, Wisconsin, USA
pCAGGS-FLPe kindly provided by Prof. Dr. Ibrahim
Adham
pEGFP-LPXN Dr. S. Kaulfuß, 2006
pEGFP-LPXN-NLS Sascha Dierks, 2011
pEGFP-C1 Clontech-Takara, Saint-Germain-en-Laye,
France pBACe3.6-CTNND1
(RZPDB737G032171D) ImaGenes GmbH, Berlin, Germany
pCMV-Myc Clontech-Takara, Saint-Germain-en-Laye,
France
pCMV-Myc-LPXN Dr. S. v.Hardenberg, 2010
pCMV-Myc-Caldesmon Dr. S. v.Hardenberg, 2010
pRL-Luc Promega, Wisconsin, USA
2.9.8 Used constructs and plasmids
Construct Plasmid/Vector Source Primer/ restriciton site pGL4.16-p120CTN-
200-TS
pGL4.16 luc2CP/Hygro
pBACe.3.6 -CTNND1
P120Xho-240fw / p120Bgl- TSrev
pGL4.16-p120CTN- 200-100
pGL4.16 luc2CP/Hygro
pBACe.3.6 -CTNND1
P120Xho-240fw / p120Bgl+100rev pGL4.16-p120CTN-
200-300
pGL4.16 luc2CP/Hygro
pBACe.3.6 -CTNND1
P120Xho-240fw / p120Bgl+329rev pGL4.16-p120CTN-
500-TS
pGL4.16 luc2CP/Hygro
pBACe.3.6 -CTNND1
P120Xho-508fw / p120Bgl- TSrev
pGL4.16-p120CTN- 500-100
pGL4.16 luc2CP/Hygro
pBACe.3.6 -CTNND1
P120Xho-508fw / p120Bgl+100rev pGL4.16-p120CTN-
500-300
pGL4.16 luc2CP/Hygro
pBACe.3.6 -CTNND1
P120Xho-508fw / p120Bgl+329rev pGL4.16-p120CTN-
1kb-TS
pGL4.16 luc2CP/Hygro
pBACe.3.6 -CTNND1
P120Xho-1048fw / p120Bgl+TSrev pGL4.16-p120CTN-
1kb-100
pGL4.16 luc2CP/Hygro
pBACe.3.6 -CTNND1
P120Xho-1048fw / p120Bgl+100rev pGL4.16-p120CTN- pGL4.16 pBACe.3.6 P120Xho-1048fw /
1kb-300 luc2CP/Hygro -CTNND1 p120Bgl+329rev pGL4.16-p120CTN-
2kb-300
pGL4.16 luc2CP/Hygro
pBACe.3.6 -CTNND1
P120Xho-1942fw2 / p120Bgl+300rev
2.10 Databases
Usage Programm
Restriction site analysis
NEB Cutter 2.0
(http://tools.neb.com/NEBcutter2/index.
php)
WEB Cutter 2.0
(htp://rna.lundberg.gu.se/cutter2) Analysis of DNA- and protein
sequences
BLAST-program (Altschulet al. 1990) (http://ncbi.nlm.nih.gov)
Bioinformatics
Ensembl v32 (http://www.ensembl.org) Nation Center for Biotechnology
Information (http://ncbi.nlm.nih.goc) Primer design Primer3 (http://frofo.wi.mit.edu/chi-
bin/primer3/primer3_www.cgi)
2.11 Isolation and purification of nucleic acids
2.11.1 Minipreparation of plasmid DNA
For rapid isolation of recombinant plasmids, a small amount of plasmid DNA was prepared. Therefore, 1 ml of a bacterial overnight-culture was centrifuged at 5000 x g and the pellet was resuspended in 250 µl P1 solution. After adding 250 µl of P2 (modified alkaline lysis) to the suspension, it was incubated at RT for 5 min. Next, 250 µl of P3 (neutralization) was pipetted to the sample and centrifuged at 13.000 x g. The supernatant was transferred into a reaction tube containing 500 µl of ice cold 0.7 vol isopropanol. The plasmid DNA was precipitated and centrifuged at 16.000 x g for 45 min.
Afterwards, the DNA pellet was washed with 200 µl of 70 % ethanol. Finally, the DNA was dried and resolved in 20 – 30 µl ddH2O.
2.11.2 Establishment of bacterial glycerol stocks
100 µl sterile glycerol was added to 1 ml of a bacterial suspension, well mixed and stored at -80°C.
2.11.3 Midipreparation of plasmid DNA
For isolation of larger amounts of ultra-pure plasmid DNA, the PureLink™ HiPure Plasmid Midiprep Kit from Life Technologies (Darmstadt, Germany) was used. This kit uses affinity chromatography columns to purify the plasmid DNA. The purification was performed according to the manufacturer’s instructions. DNA purified by this method can be used for the transfection of cell lines, restriction analysis, subcloning or sequencing.
2.11.4 Isolation of total RNA from cell cultures
For isolation of total RNA from cell cultures the pegGOLD Total RNA Kit (Peqlab, Erlangen, Germany) was used according to the manufactures instructions.
2.11.5 Determination of nucleic acid concentration
The concentration of nucleic acids was determined by a spectral photometer (BioPhotometer, Eppendorf, Hamburg). After the blank value was set, the absorption maximum of the nucleic acids (260nm) was measured. Simultaneously, contaminations by proteins (280nm) or salts (320nm) were detected. The concentration of nucleic acids was calculated according to the Lambert’s law.
Lower concentrations were determined by agarose gel electrophoresis. A certain amount of DNA was loaded onto an agarose gel and run with a DNA standard (MassRuler DNA Ladder, Thermo Scientific, Langenselbold, Germany), for which the amount of DNA for each band was known. After the gel was run, a photograph of the stained DNA was taken and the concentration of the sample was estimated from the band intensities.
2.12 Cloning techniques
2.12.1 Cleavage of DNA with restriction endonucleases
For enzymatic cleavage of DNA by restriction endonucleases, a restriction reaction in a total volume of at least 10 µl was prepared. Per µg DNA 1 U of the respective restriction enzyme was used. Together with the corresponding buffer the reaction was incubated at 37 °C for 1 – 2 hours or overnight. In case the DNA was cleaved by two restriction endonucleases, the buffer was chosen for sufficient activity of both enzymes or a sequential restriction was performed.
2.12.2 Isolation of DNA fragments from agarose gels
For isolation of DNA fragments from agarose gels, the NucleoSpin™ Extract II Kit (Macherey & Nagel, Düren, Germany) was used. After the DNA fragments were separated by gel electrophoresis on an agarose gel, they were cut out of the gel using a sterile scalpel and dissolved in the corresponding buffer at 50°C. Subsequently, the DNA- agarose solution was loaded onto the columns and purified according to the manufacturer’s instructions. The DNA was eluted in ddH2O.
2.12.3 Dephosphorylation of plasmid DNA
To avoid religation of linearized plasmid DNA, the terminal 5’-phosphate group of the vector was removed by alkaline phosphatase. Therefore, the DNA was incubated with 2 U alkaline phosphatase for 1 hour at 37°C. After dephosphorylation the DNA was purified using silica membrane columns (Invitek, Berlin, Germany) and resuspended in ddH2O.
2.12.4 Ligation of DNA fragments
In a ligation reaction, a phosphodiester bond is formed between the 3’-hydroxy- and 5’- phosphate group of the linearized DNA. This enzymatic reaction is catalyzed by the T4 DNA ligase leading to the generation of recombinant DNA molecules.
The following reaction mixture was used:
25 – 50 ng vector DNA (digested) 30 – 120 ng insert DNA
1 µl T4 DNA ligase (5 U/µl) 1 µl ligation buffer (10 x) ad 10 µl H2O
The ligation reaction was carried out at RT for 2 hours or at 4°C overnight.
2.12.5 Subcloning of PCR and RT PCR products / TA cloning
(Clark 1988); (Hu 1993)
Taq- and other polymerases possess a terminal transferase activity that results in the non-template addition of a single nucleotide to the 3'-ends of PCR products. This terminal transferase activity is the basis of the TA cloning strategy. For cloning of PCR products, the pGEM-Teasy vector system that has 5‘-dT overhangs was used. For products that were amplified with PhusionTM High-Fidelity DNA polymerase (Finnzymes, Finland), which does not carry such a terminal transferase activity, the terminal dA had to be added before the PCR product could be cloned into the pGEM-Teasy vector.
Therefore, the following A-tailing reaction was conducted:
7 µl PCR product
0.7 µl MangoTaq DNA polymerase (1 U/µl) 0.3 µl MgCl2 (50nM)
1 µl dATP (2 mM)
1 µl 10 x polymerase buffer
The reaction mixture was incubated for 30 min at 70°C.
