Up-regulation of endoplasmic reticulum stress induced genes of the unfolded protein response in the liver of periparturient dairy cows

R E S E A R C H A R T I C L E

Open Access

Up-regulation of endoplasmic reticulum stress

induced genes of the unfolded protein response

in the liver of periparturient dairy cows

Denise K Gessner

, Gloria Schlegel

, Robert Ringseis

, Frieder J Schwarz

and Klaus Eder

Abstract

Background: In dairy cows, the periparturient phase is a stressful period, which is commonly associated with strong metabolic adaptations and the development of pathophysiologic conditions and disorders. Some of the symptoms occurring in the liver, such as the development of fatty liver, are similar to those observed under the condition of endoplasmic reticulum (ER) stress. Therefore, we hypothesized, that in the liver of dairy cows ER stress is induced during the periparturient phase, which in turn leads to an induction of the unfolded protein response (UPR). In order to investigate this hypothesis, we determined relative mRNA concentrations of 14 genes of the ER stress-induced UPR in liver biopsy samples of 13 dairy cows at 3 wk antepartum and 1, 5 and 14 wk postpartum. Results: We found, that the mRNA concentrations of 13 out of the 14 genes involved in the UPR in the liver were significantly increased (1.9 to 4.0 fold) at 1 wk postpartum compared to 3 wk antepartum. From 1 wk postpartum to later lactation, mRNA concentrations of all the genes considered were declining. Moreover, at 1 wk postpartum, mRNA concentration of the spliced variant of XBP1 was increased in comparison to 3 wk antepartum, indicating that splicing of XBP1– a hallmark of ER stress - was induced following the onset of lactation.

Conclusion: The present study reveals, that ER stress might be induced during the periparturient phase in the liver of dairy cows. We assume that the ER stress-induced UPR might contribute to the pathophysiologic conditions commonly observed in the liver of periparturient cows, such as the development of fatty liver, ketosis or inflammation. Keywords: Dairy cow, Liver, ER stress, Unfolded protein response

Background

In dairy cows, the periparturient phase representing the time interval between 3 wk before to 3 wk after parturition is associated with strong metabolic adaptations [1]. Pro-duction of milk leads to a strong increase of the energy re-quirement, which however cannot be met as the food intake capacity is limited. Thus, during early lactation, dairy cows are typically in a negative energy balance, which is compensated by a stimulation of lipolysis in adipose tis-sue. This leads to strongly increased plasma concentrations of non-esterified fatty acids (NEFA), which are partially taken up into the liver. As the capacity of the liver for β-oxidation during the periparturient phase is insufficient,

NEFA are incorporated into triacylglycerols (TAG). As very low-density lipoproteins (VLDL) cannot be produced at sufficient amounts due to a low synthesis of Apo B, TAG are stored in the liver leading to fatty liver syndrome. Moreover, there is commonly a strong stimulation of ketogenesis during early lactation, which can result in ketosis [1-3].

Previously, it has been shown, that increased plasma levels of NEFA, such as observed in dietary or genetic models of obesity or diabetes, are leading to stress of the endoplasmic reticulum (ER) in the liver [4-6]. ER stress is defined as an imbalance between the folding capacity of the ER and the protein load, resulting in the accumu-lation of unfolded or misfolded proteins in the ER lumen [5]. The disturbance of the ER homeostasis activates an adaptive response known as the unfolded protein re-sponse (UPR), which aims to restore ER homeostasis and functions by triggering three kinds of protective

* Correspondence:klaus.eder@ernaehrung.uni-giessen.de

1_{Institute of Animal Nutrition and Nutrition Physiology,}

Justus-Liebig-Universität Giessen, Heinrich-Buff-Ring 26-32, Giessen D-35392, Germany

Full list of author information is available at the end of the article

© 2014 Gessner et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited.

cellular responses: (i) up-regulation of ER chaperones, such as immunoglobulin heavy-chain binding protein (BiP), to assist in the refolding of proteins; (ii) attenu-ation of protein translattenu-ation, and (iii) degradattenu-ation of mis-folded proteins by the proteasome by a process called ER-associated degradation (ERAD) [7,8]. If ER stress-induced damage is too strong and homeostasis cannot be restored, the UPR can lead to cell death by the induc-tion of apoptosis [9,10]. Sensing of stress in the ER lumen is mediated by three ER stress transducers: inosi-tol requiring 1 (IRE1), PKR-like ER kinase (PERK), and activating transcription factor 6 (ATF6) [5,8]. Under non-stress conditions these transducers are bound to the abundant luminal chaperone BiP preventing them from activating downstream events. When misfolded proteins are accumulating in the ER lumen, BiP dissociates from the stress transducers in order to chaperone the mis-folded proteins, which leads to an activation of ER stress transducers and an initiation of the UPR [9,11]. Activation of PERK stimulates the phosphorylation of eukaryotic ini-tiation factor (eIF) 2α, which attenuates protein translation [12]. IRE1 activation causes unconventional splicing of X-box binding protein 1 (XBP1) mRNA and translation into the transcription factor XBP1 [8]. XBP1 up-regulates ER chaperons, components of ERAD and stimulates phospholipid biosynthesis, which leads to an expansion of the ER membrane [5-7]. IRE1 activation moreover leads to an activation of nuclear factor kappa B (NF-κB), a tran-scription factor involved in inflammation, and an induc-tion of pro-apoptotic genes [5,13]. ATF6 is a transcripinduc-tion factor, which is activated by processing via site 1 and site 2 proteases in the Golgi. The activated ATF6 induces the ex-pression of genes involved in ERAD, lipid biosynthesis, ER expansion and protein folding [5].

Interestingly, activation of the UPR, such as observed in models of obesity or diabetes or induced by applica-tion of chemical ER stress inducers, leads to a variety of symptoms in the liver, which are similar to those ob-served in periparturient dairy cows, such as the develop-ment of fatty liver [14-16], an induction of fibroblast growth factor (FGF) 21 [17], an enhancement of the antioxidant and cytoprotective capacity by activation of nuclear factor E2-related factor 2 (Nrf2) [18,19], and an induction of inflammation [20,21].

The fact that periparturient cows have commonly strongly increased plasma concentrations of NEFA and the similarities between the metabolic changes observed in the liver of periparturient cows and those induced by ER stress, prompted us to the hypothesis that the peri-parturient phase in dairy cows is associated with the development of ER stress in the liver. In order to investi-gate this hypothesis, we determined mRNA concen-trations of several important components of the three branches of the UPR operating as chaperons, foldases,

components of ERAD or inducers of apoptosis (Table 1) in liver biopsy samples of dairy cows during the peripar-urient phase. mRNA concentrations of these genes have been proposed as reliable markers of ER stress [22-25]. Results

Performance parameters of the cows used in this experi-ment have recently been reported [34]. Milk yield of the cows, in average from wk 1 to wk 14 was approximately 33 kg/d, average feed intake was 18.5 kg DM/d. The on-set of lactation led to a strong negative energy balance of about -65 MJ NEL/d in wk 1. At 14 wk postpartum, the cows had a slightly positive energy balance. Plasma NEFA concentrations showed their peak values at 1 wk

postpartum while plasma β-hydroxybutyric acid (BHBA)

concentrations were highest at 1 wk and 5 wk postpar-tum. Liver TAG concentrations were highest at 5 wk postpartum [34]. The cows considered in this study, moreover, showed increased mRNA concentrations of tumor necrosis factorα and acute phase proteins (C-re-active protein, haptoglobin, serum amyloid A) being in-dicative of a pro-inflammatory condition and increased mRNA concentrations of various Nrf2 target genes and of FGF21 in the liver at 1 wk postpartum [35,36].

To detect an activation of the UPR due to ER stress, we determined mRNA concentrations of BiP (encoded by HSPA5) and 13 downstream genes of the three ER stress sensors by qRT-PCR and the mRNA concentration of the spliced variant of XBP1 (sXBP1) by standard RT-PCR. The mRNA concentrations of all the UPR target genes, with the only exception of WARS, were elevated from 3 wk antepartum to 1 wk postpartum (Table 2). Moreover, at 1 wk postpartum, mRNA concentration of sXBP1 was in-creased in comparison to 3 wk antepartum, indicating that splicing of XBP1 was induced following the onset of lacta-tion (Figure 1). From 1 wk postpartum to later lactalacta-tion, mRNA concentrations of all the genes involved in the UPR were declining. However, relative mRNA concentra-tions of some genes considered (ATF4, CASP3, EDEM1, WARS, XBP1) were also significantly increased at 5 wk postpartum in comparison to 3 wk antepartum (Table 2). The mRNA concentrations of most of the genes consid-ered were not different between 14 wk postpartum and 3 wk antepartum, while mRNA concentrations of ATF4 and the 114 bp unspliced XBP1 were higher at 14 wk postpar-tum than at 3 wk anteparpostpar-tum.

We also determined the mRNA concentrations of genes associated with DNA damage, DNA repair, and cell cycle (ATM, BRCA1, HSBP1, HSPA8, MSH2, RPS9, XRCC5) (Table 3). Those genes are not regulated by ER stress, and thus can be used to evaluate whether ER stress is specifically induced. However, we observed that the mRNA concentra-tions of most of these genes (with the exception of BRCA1) showed the same expression pattern as the abovementioned

ER stress-regulated genes (increase from 3 wk antepartum to 1 wk postpartum and decrease from 1 wk to 14 wk post-partum) indicating that genes involved in DNA damage, DNA repair, and cell cycle are similarly regulated in the liver of cows during lactation as ER stress-regulated genes.

Discussion

In the present study, we observed that BiP, a chaperone which is considered as the master regulator of the UPR [5], and several downstream genes of the three ER stress transducers (IRE1, PERK, ATF6) are up-regulated in the

Table 1 Functions of the ER stress-induced genes considered in this study

Component1 Function Reference

ATF4 Indicator of PERK activation, transcription factor which contributes to the transcriptional activation of chaperones and foldases

[5] BAK1 ER stress induced pro-apoptotic gene of the BCL-2 family proteins [10] BAX ER stress induced pro-apoptotic gene of the BCL-2 family proteins [26]

HSPA5 (encoding BiP) Chaperon, master regulator of UPR [5,27]

CASP3, CASP8, CASP9 (encoding caspases 3, 8, 9)

ER stress induced members of a family of cysteine proteases which are critical mediators of apoptosis

[9,13,27,28] DDIT3 (encoding CHOP) Non ER localised transcription factor, induced by ER stress through PERK and ATF6, mediates ER

stress induced apoptosis

[29] EDEM1 ER stress induced target of IRE, component of the ER-associated degradation system (ERAD) [29,30] HERPUD1 (encoding HERP) ER stress induced target of ATF6, a resident membrane protein involved in the ERAD complex [31] PDIA4 ER stress induced target of PERK, one of the most important ER resident protein folding enzymes

with chaperone activity in preventing the aggregation of unfolded substrates

[25] DNAJC3 (encoding P58IPK) ER stress induced target of IRE, a molecular chaperone [32] WARS ER stress induced target of PERK, ATF4 target gene, aminoacyl-tRNA synthetase involved in protein

synthesis

[33] XBP1 ER stress induced target of IRE, transcription factor which induces the transcriptional activation of

chaperones

[5]

1

ATF4 = activating transcription factor 4; BAK1 = BCL2-antagonist/killer 1; BAX = BCL2-associated X protein; CASP = apoptosis-related cysteine peptidase;

DDIT3 = DNA-damage-inducible transcript 3; DNAJC3 = DnaJ (Hsp40) homolog, subfamily C, member 3; EDEM1 = ER degradation enhancer, mannosidase alpha-like 1;HERPUD1 = homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1; HSPA5 = heat shock 70 kDa protein 5;

PDIA4 = protein disulfide isomerase family A, member 4; WARS = tryptophanyl-tRNA synthetase; XBP1 = X-box binding protein 1.

Table 2 Relative mRNA concentrations of ER stress-induced genes in the liver of Holstein cows at 3 wk antepartum and 1, 5 and 14 wk postpartum1

Gene2 3 wk antepartum (n = 13) 1 wk postpartum (n = 13) 5 wk postpartum (n = 13) 14 wk postpartum (n = 13)

ATF4 1.00 ± 0.25a 3.14 ± 0.25c 2.08 ± 0.26b 1.65 ± 0.24b BAK1 1.00 ± 0.29a 2.10 ± 0.30b 1.56 ± 0.29ab 1.59 ± 0.28ab BAX 1.00 ± 0.36a 3.02 ± 0.39b 1.98 ± 0.35ab 1.52 ± 0.35a CASP3 1.00 ± 0.31a 2.54 ± 0.27b 2.07 ± 0.26b 1.71 ± 0.26ab CASP8 1.00 ± 0.25a 2.48 ± 0.24b 1.88 ± 0.23ab 1.73 ± 0.23ab CASP9 1.00 ± 0.37a 2.45 ± 0.35b 1.89 ± 0.34ab 1.84 ± 0.36ab DDIT3 1.00 ± 0.17a 1.86 ± 0.17b 1.58 ± 0.17ab 1.41 ± 0.17ab DNAJC3 1.00 ± 0.15a 1.89 ± 0.17b 1.49 ± 0.17ab 1.43 ± 0.15ab EDEM1 1.00 ± 0.21a 1.70 ± 0.21b 1.69 ± 0.20b 1.25 ± 0.22ab HERPUD1 1.00 ± 0.45a 3.96 ± 0.37b 2.27 ± 0.43a 1.66 ± 0.38a HSPA5 1.00 ± 0.29a 2.74 ± 0.27b 1.64 ± 0.26a 1.41 ± 0.24a PDIA4 1.00 ± 0.25a 1.92 ± 0.28b 1.34 ± 0.24ab 1.23 ± 0.25ab WARS 1.00 ± 0.35a 2.03 ± 0.31ab 2.31 ± 0.29b 1.93 ± 0.30ab XBP1 (unspliced) 1.00 ± 0.25a 3.14 ± 0.25c 2.08 ± 0.26b 1.65 ± 0.24b 1

mRNA concentrations of genes are expressed relative to the mRNA abundance at 3 wk antepartum.

2

Abbreviations of gene names: see Table1. Values are means ± SEM.

a,b,c

liver of dairy cows at early lactation (Figure 2). It has been assumed that mRNA concentrations of ER chaperons, ERAD components, such as BiP, HERP, WARS, PDIA4, P58IPK, EDEM1, XBP1, and ATF4, or genes, that are in-volved in the induction of apoptosis, such as Chop or cas-pases, are reliable markers of ER stress [22-24,27,37]. Thus, the present study strongly suggests the presence of ER stress in the liver of dairy cows during early lactation, which was associated with induction of the UPR. This sug-gestion is supported by the present finding, that the mRNA concentration of sXBP1 in the liver was increased at 1 wk postpartum, indicative of an increased XBP1 spli-cing, which is considered a hallmark of ER stress [8]. The observed activation of XBP1 by unconventional splicing of XBP1 mRNA 1 wk postpartum agrees with a recent study of Loor [38] who found an up-regulation of 39 target genes of XBP1 in the liver of dairy cows during the transi-tion from late pregnancy to lactatransi-tion by transcriptome analysis.

From the present study, the metabolic reasons for the production of ER stress during early lactation cannot be explained. However, it has been shown that an increased load of the liver with fatty acids induces ER stress, with

saturated fatty acids being more deleterious in this re-spect than unsaturated fatty acids [6,16,37]. Saturated fatty acids are less readily converted into TAG than un-saturated fatty acids, and thus travel to the ER in the free form, where they may disrupt ER morphology and func-tion [16]. Thus, it is likely that the elevated concentra-tions of NEFA, consisting mainly of saturated fatty acids and oleic acid [41], in the blood of the cows in early lac-tation could contribute to the induction of ER stress in the liver. ER stress induction in the liver of cows during early lactation could also be due to the occurrence of a pro-inflammatory condition. Periparturient cows exert commonly an inflammation-like condition in the liver, induced by various events such as injuries and trauma during calving stress, mammary gland oedema, uterus involution, infectious or metabolic diseases, parasites or endotoxins from the gut [42-44]. A pro-inflammatory condition during early lactation has also been observed in the cows considered in this study [35]. As inflamma-tion strongly induces ER stress [18], activainflamma-tion of the UPR in the liver of the cows could have been triggered by the pro-inflammatory condition. The finding that the expression of UPR target genes was declining from 1 wk Figure 1 Activation of XBP1 by unconventional splicing following the onset of lactation. Representative images from two cows

demonstrating the unspliced (155 bp) and the spliced (129 bp) XBP1 mRNA as determined by conventional RT-PCR. The ATP5B mRNA was determined as reference gene.

Table 3 Relative mRNA concentrations of genes associated with DNA damage, DNA repair and cell cycle in the liver of Holstein cows at 3 wk antepartum and 1, 5 and 14 wk postpartum1

Gene2 _{3 wk antepartum (n = 13) 1 wk postpartum (n = 13) 5 wk postpartum (n = 13) 14 wk postpartum (n = 13)}

ATM 1.00 ± 0.21a 2.29 ± 0.21b 1.94 ± 0.35ab 1.81 ± 0.26ab BRCA1 1.00 ± 0.22 1.71 ± 0.27 1.59 ± 0.20 1.33 ± 0.23 HSBP1 1.00 ± 0.23a 3.04 ± 0.42b 2.14 ± 0.24ab 1.65 ± 0.34a HSPA8 1.00 ± 0.24a 2.01 ± 0.24b 1.78 ± 0.23ab 1.22 ± 0.27a MSH2 1.00 ± 0.20a 4.04 ± 0.61b 1.81 ± 0.22a 1.41 ± 0.23a RPS9 1.00 ± 0.20a 3.68 ± 0.28c 2.23 ± 0.29b 1.64 ± 0.31ab XRCC5 1.00 ± 0.21a 3.69 ± 0.54c 2.35 ± 0.27b 1.43 ± 0.26a 1

mRNA concentrations of genes are expressed relative to the mRNA abundance at 3 wk antepartum.

2

ATM = ataxia telangiectasia mutated; BRCA1 = breast cancer 1, early onset; HSBP1 = heat shock factor binding protein 1; HSPA8 = heat shock 70 kDa protein 8; MSH2 = mutS homolog 2; RPS9 = ribosomal protein S9; XRCC5 = X-ray repair cross-complementing protein 5-like.

Values are means ± SEM.

a,b,c

postpartum to later lactation supports the hypothesis that ER stress in early lactation was caused mainly by high plasma levels of NEFA and the inflammatory condi-tion. However, the finding that some of the UPR target genes remained up-regulated even at 14 wk postpartum– when the cows were already in a positive energy balance– suggests that a certain degree of ER stress could also be induced by the high metabolic activity of the liver during lactation, without being burdened by high NEFA concentrations or inflammation.

Many biochemical alterations in the liver induced by UPR under pathophysiologic conditions such as obesity, diabetes or chronic inflammation are similar to those observed in the liver of periparturient dairy cows, with fatty liver development being one important example. ER stress-induced fatty liver is caused by an increased expression of genes involved in lipogenesis, a reduced

expression of genes involved in fatty acid oxidation and lipolysis, and an impairment of the production of VLDL required for the export of TAG from the liver [14,45-47]. As these biochemical alterations leading to fatty liver are very similar to those observed in the liver of periparturient dairy cows [1,2,48], it is likely that the ER stress-induced UPR is involved in the development of fatty liver in periparturient cows. Other similarities between various biochemical alterations induced by ER stress and those observed in the liver of periparturient dairy cows are the induction of inflammation, an activa-tion of Nrf2 pathway and an up-regulaactiva-tion of FGF21. As mentioned above, inflammation can directly induce ER stress. However, ER stress and the concomitant UPR also enhance the inflammatory process [18], suggesting that ER stress could contribute to the induction of the pro-inflammatory condition in the liver of periparturient Figure 2 Endoplasmic reticulum (ER) stress signal transduction (Modification of [21]). Genes considered in the liver of periparturient dairy cows in this study are shown in bold. ER stress in early lactating cows might be induced either by inflammation and/or high concentrations of NEFA deriving from plasma due to strong lipolysis in adipose tissue. In response to ER stress, the three ER stress sensors PKR-like ER kinase (PERK), inositol requiring 1 (IRE1), and activating transcription factor 6 (ATF6) are activated by dissociation from BiP. In turn, genes of the UPR including those considered in this study (ATF4, DDIT3, PDIA4, WARS, EDEM1, DNAJC3, HSPA5, CASP3, CASP8, CASP9, HERPUD1, BAK1, BAX) are up-regulated. Increased mRNA concentrations of FGF21 and target genes of NF-κB and Nrf2, which are also induced by ER stress in the liver of periparturient cows, have been recently reported [34,35,39,40].

cows. Nrf2 is a transcription factor which regulates the transcription of a great number of genes with antioxida-tive and cytoprotecantioxida-tive functions [49,50]. Activation of this transcription factor during the periparturient phase in the liver of the cows has been considered as a com-pensatory means to protect the liver against the deleteri-ous effects of pro-inflammatory cytokines and reactive oxygen species (ROS) [36]. The fact that ER stress also causes an activation of Nrf2, probably as a means to counteract oxidative stress provoked under ER stress conditions [18,19] suggests that the observed activation of Nrf2 in the liver of dairy cows at early lactation might also be caused by the UPR.

FGF21 is a hormonal regulator which stimulates hepatic lipid oxidation, ketogenesis and gluconeogenesis during energy deprivation [51-53]. Recently, it has been found that the expression of FGF21 in the liver and plasma levels

of FGF21 are increased in dairy cows during the peripar-turient phase, and that there is even a relationship between hepatic TAG content and plasma FGF21 concentration in dairy cows [34,39,40]. More recently, it has been observed that FGF21 is directly induced by ER stress, mediated by an activation of the PERK cascade [17]. Thus, it is likely that the up-regulation of FGF21 in the liver of periparturi-ent cows is mediated by an ER stress-induced UPR. The fact that FGF21 stimulates ketogenesis indicates that ER stress present in the liver of periparturient cows might en-hance the development of ketosis via an up-regulation of FGF21.

Based on the similarities between various biochemical alterations induced by ER stress and those observed in the liver of dairy cows during the periparturient phase, it is probable that the induction of ER stress and the concomi-tant UPR contribute to pathophysiologic conditions during

Table 4 Characteristics of gene specific primers used for qPCR

Gene1 _{Forward primer (from 5′ to 3′) Reverse primer (from 5′ to 3′) PCR product size (bp) NCBI GenBank}

Reference genes

ATP5B GGACTCAGCCCTTCAGCGCC GCCTGGTCTCCCTGCCTTGC 229 NM_175796.2

PPIA GGCAAATGCTGGCCCCAACACA AGTACCACGTGCTTGCCATCCA 87 NM_178320.2

RPL12 CACCAGCCGCCTCCACCATG CGACTTCCCCACCGGTGCAC 84 NM_205797.1

Target genes

ATF4 TGGTCTCAGACAACAGCAAG AGCTCATCTGGCATGGTTTC 130 NM_001034342.2

ATM GTGTTGAGGCACTTTGTGATGC GTTTGATAATGGGCTGGTCTGC 111 NM_001205935.1

BAK1 TACTTCACCAAGATCGCGTC ACGATGGCTACGCTCTTGAT 254 NM_001077918.1

BAX TCTGACGGCAACTTCAACTG ATGGTCACTGTCTGCCATGT 224 NM_173894.1

BRCA1 TGCCGAGACAAGATCAAGAGG TAATTTCAGTGCAGAGGCTGAGG 149 NM_178573.1

CASP3 CCGAGGCACAGAACTGGACTG TCGCCAGGAAAAGTAACCAGGTG 133 NM_001077840.1

CASP8 TACCAGCGAGGAGGAGATGAAG CATCCAGCTTACATTTGGCAATC 164 NM_001045970.2

CASP9 AAACAGGATGACCCATCAAAGC ATTCAGGACATAGGCCAGATCG 203 NM_001205504.1

DDIT3 AGTCACTGCCTTTCTCCTTC TCTTCCTCCTTGTTTCCAGG 133 NM_001078163.1

DNAJC3 GTACGAAGGTGCTGAATGTG ATCAGGGTCACCATCTACTG 133 NM_174756.3

EDEM1 CCCCTACCCTCGGGTGAATCT GTGGAATCCCCCAGCAGTCG 126 NM_001103092.2

HERPUD1 CCGTGTTTCTCAGTATCCTC TCTTGATTCACAGCCTCCTG 169 NM_001102265.2

HSBP1 CGCGAACAAACGGAAGTATAGG CAGGTCATCAATGCGACTGC 207 NM_001113316.2

HSPA5 CAAGTTGATGTTGGAGGTGG AAGCCTCAGCAGTTTCCTTC 94 NM_001075148.1

HSPA8 AACGTGCTGATCTTTGATTTAGGG TTCTCCACCCAAGTGAGTATCTCC 114 NM_174345.4

MSH2 AACAGAAAGCCCTGGAGTTGG TTATTCTTTGCGATGACCTCAGC 226 NM_001034584.1

PDIA4 AGGTTTGACGTGAGTGGCTA CATCGAAGTTGTCCTTGGTC 175 NM_001045879.2

RPS9 GTGAGGTCTGGAGGGTCAAA GGGCATTACCTTCGAACAGA 108 NM_001101152.2

WARS AAGCAGACGAGGACTTTGTG TTCGGTTTACCAGCTCCTTG 123 NM_174218.1

XBP1 unspliced GTTGAGACAGCGGTTGGGAATG CGTAGTCTGAGTGCTGCGGAC 114 NM_001034727.3 XBP1 spliced & unspliced TGACTGAAGAGGAAGCAGAG CAATGCCATCAGAGTCCATG 129/155 NM_001271737.1

XRCC5 GTTTCAGTGTCTGCTTCACAGAGC TTCTTGATGACTTCCGTCAGAGG 165 NM_001102141.1

1_{ATP5B = ATP synthase; PPIA = peptidylprolyl isomerase A; RPL12 = ribosomal protein L12; other abbreviations of gene names are explained in footnotes of Tables} 1 and3.

this phase, such as the development of fatty liver, ketosis, and hepatic inflammation. The existence of ER stress in the liver of dairy cows, moreover, might be of relevance for glucose homeostasis as it has been shown that ER stress impairs gluconeogenesis [54,55], a pathway, which is of extraordinary relevance in high yielding dairy cows.

It should be noted that the induction of ER stress gene network expression in dairy cows has been also observed in the mammary gland during the transition from preg-nancy to lactation [56]. The physiological relevance of that pathway, however, might be different between liver and mammary gland. While ER stress induced UPR in the liver might be regarded as a means to maintain ER homeostasis and liver function, ER stress signalling in the mammary gland might be involved in mammary lipogenesis and milk protein synthesis [56].

Conclusion

In overall, the present study reveals the existence of ER stress in the liver of dairy cows during early lactation. Since ER stress causes many biochemical adaptations and symp-toms similar to those observed in the liver of periparturient cows, such as the development of fatty liver, ketosis or in-flammation, it is assumed that the ER stress-induced UPR might contribute to the pathophysiologic conditions com-monly observed in the liver of periparturient cows.

Methods

Animals

For this investigation, liver biopsy samples from a re-cently performed trial with dairy cows, which has been described in detail [34], were used. All procedures for this trial were approved by the Bavarian state animal care and use committee. The trial included twenty Holstein cows (four primi- and sixteen multiparous, 2.7 ± 1.1 parities, mean ± SD) as experimental animals with an experimental period from 3 wk antepartum until 14 wk postpartum. The animals were housed in a freestall-barn. They received a partial mixed ration (PMR) for ad libitum intake of basic feed with separate and limited intake of concentrate. PMR consisted (dry matter, DM, basis) of 33.7% grass silage, 44.9% maize silage, 6.4% hay, and 14.9% concentrate. The concentrate was individually allocated at four computer-operated feeding stations with an auto-matic feeding program (DeLaval Alpro, Glinde, Germany). It was composed of 24.8% grain maize, 21.8% wheat, 20.1% soybean meal, 15.2% dried sugar beet pulp with mo-lasses, 14.9% barley and 3.2% vitammineral premix in-cluding limestone (DM basis). The allocation of the concentrate was increased from 1.2 to 8.0 kg of DM/d during the first 42 d of lactation, and thereafter, it was dependent on the milk performance of the individual cow. Liver biopsies were taken from the right liver lobe (Lobus hepatis dexter) at 3 wk antepartum, and 1, 5 and 14 wk

postpartum before feeding between 0700 and 0900 h [34]. For this study, samples of 13 cows were available.

Quantitative and standard RT-PCR

Total RNA isolation from liver biopsies, cDNA synthesis and quantitative real-time polymerase chain reaction (qPCR) were carried out as described recently in detail [34]. Expression values of the genes investigated were normalised using the GeNorm normalisation factor [57]. Procedure of normalisation and average expression sta-bility ranking of the six potential reference genes in liver of cows were also performed as described recently [34]. The characteristics of gene-specific primers are shown in Table 4. After normalisation of gene expression data using the calculated GeNorm normalisation factor, means and SEM were calculated from normalised expression data for samples of the same treatment group. The mean of 3 wk antepartum was set to 1 and relative expression ratios of 1, 5 and 14 wk postpartum are expressed as fold changes compared to 3 wk antepartum. To determine the expression of spliced and unspliced XBP1, the PCR run was stopped within the linear range of amplification. Sub-sequently, the PCR products were separated using 2% agarose gel electrophoresis stained with GelRedTM nu-cleic acid gel stain (Biotium, California, USA), visualized under UV light, and digitalized with a digital camera (SynGene, Cambridge, England).

Statistical analysis

Data were statistically evaluated by using the SAS pro-cedure PROC MIXED (version 9.2, SAS Institute Inc., Cary, NC, USA) with week of sampling (-3, +1, +5, +14 wk) and parity of the cow (primi- vs. multiparous) as fixed effects, and individual animal as random effect. For significant t values of the factor week, means were com-pared by the Bonferroni t-test, and differences between means were considered significant for P < 0.05.

Competing interests

The authors declare that they have no competing interests. Authors’ contributions

DKG: Participated in the design of the study, performed the PCR analyses, performed the statistical analyses, and wrote the manuscript. GS: conducted the animal experiment. FJS: supervised the animal experiment; RR: supervised PCR analyses. KE: conceived of the study, and participated in its design and coordination and helped to draft the manuscript. All authors read and approved the final manuscript.

Acknowledgements

Gloria Schlegel was supported by H. Wilhelm Schaumann-Stiftung (Hamburg, Germany).

Author details

1_{Institute of Animal Nutrition and Nutrition Physiology,}

Justus-Liebig-Universität Giessen, Heinrich-Buff-Ring 26-32, Giessen D-35392, Germany.2_{Chair of Animal Nutrition, Center of Life and Food Sciences}

Weihenstephan, Technische Universität München, Liesel-Beckmann-Strasse 6, Freising, Weihenstephan D-85350, Germany.

Received: 10 July 2013 Accepted: 14 February 2014 Published: 20 February 2014

References

1. Drackley JK: Biology of dairy cows during the transition period: the final frontier? J Dairy Sci 1999, 82:2259_–2273.

2. Katoh N: Relevance of apolipoproteins in the development of fatty liver and fatty liver-related peripartum diseases in dairy cows. J Vet Med Sci 2002, 64:293–307.

3. Adewuji AA, Gruys E, van Eerdenburg FJCM: Non-esterified fatty acids (NEFA) in dairy cattle. Vet Quarterly 2005, 27:117_–126.

4. Back SH, Kaufman RJ: Endoplasmic reticulum stress and type 2 diabetes. Ann Rev Biochem 2012, 81:767–93.

5. Cnop M, Foufelle F, Velloso LA: Endoplasmic reticulum stress, obesity and diabetes. Cell 2012, 18:59–68.

6. Fu S, Watkins SM, Hotamisligil GS: The role of endoplasmic reticulum in hepatic lipid homeostasis and stress signaling. Cell Metab 2012, 15:623–634.

7. Marciniak SJ, Ron D: Endoplasmic reticulum stress signaling in disease. Physiol Rev 2006, 86:1133–1149.

8. Ron D, Walter P: Signal integration in the endoplasmic reticulum unfolded protein response. Nature Rev 2007, 8:519–529.

9. Rutkowski DT, Kaufman RJ: A trip to the ER: coping with stress. Trends Cell Biol 2004, 14:20–28.

10. Breckenridge DG, Germain M, Mathai JP, Nguyen M, Shore GC: Regulation of apoptosis by endoplasmic reticulum pathways. Onocogene 2003, 22:8606–8616.

11. Bertolotti A, Zhang Y, Hendershot L, Harding H, Ron D: Dynamic interaction of BiP and the ER stress transducers in the unfolded protein response. Nature Cell Biol 2000, 2:326–332.

12. Harding HP, Zhang Y, Ron D: Protein translation and folding are coupled by an endoplasmic-reticulum-resident kinase. Nature 1999, 397:271–274. 13. Momoi T: Caspases involved in ER-stress-mediated cell death. J Chem

Neuroanat 2004, 28:101–105.

14. Lee JS, Zheng Z, Mendez R, Ha SW, Xie Y, Zhang K: Pharmacologic ER stress induces non-alcoholic steatohepatitis in an animal model. Toxicol Lett 2012, 211:29–38.

15. Pagliassotti MJ: Endoplasmic reticulum stress in nonalcoholic fatty liver disease. Ann Rev Nutr 2012, 32:17–33.

16. Gentile CL, Frye MA, Pagliassotti MJ: Fatty acids and the endoplasmic reticulum in nonalcoholic fatty liver disease. Biofactors 2011, 37:8_–16. 17. Schaap FG, Kremer AE, Lamers WH, Jansen PLM, Gaemers IC: Fibroblast

growth factor 21 is induced by endoplasmic reticulum stress. Biochimie 2013, 95:692–699.

18. Cullinan SB, Zhang D, Hannink M, Arvisais E, Kaufman RJ, Diehl JA: Nrf2 is a direct PERK substrate and effector of PERK-dependent cell survival. Mol Cell Biol 2003, 23:7198–7209.

19. Cullinan SB, Diehl JA: Coordination of ER and oxidative stress signaling: the PERK/Nrf2 signaling pathway. Int J Biochem Cell Biol 2006, 38:317–332. 20. Rath E, Haller D: Inflammation and cellular stress: a mechanistic link

between immune-mediated and metabolically driven pathologies. Eur J Nutr 2011, 50:219–233.

21. Zhang K, Kaufmann RJ: From endoplasmic-reticulum stress to the inflammatory response. Nature 2008, 454:455–462.

22. Wu CX, Liu R, Gao M, Zhao G, Wu S, Wu CF, Du GH: Pinocembrin protects against ischemia/reperfusion injury by attenuating endoplasmic reticulum stress induced apoptosis. Neurosci Lett 2013, 546:57–62. 23. Kovacs WJ, Charles KN, Walter KM, Shackelford JE, Wikander TM, Richards

MJ, Fliesler SJ, Krisans SK, Faust PL: Peroxisome deficiency-induced ER stress and SREBP-2 pathway activation in the liver of newborn PEX2 knock-out mice. Biochim Biophys Acta 2012, 1821:895–907.

24. Samali A, Fitzgerald U, Deegan S, Gupta S: Methods for monitoring endoplasmic reticulum stress and the unfolded protein response. Int J Cell Biol 2010, 2010:830307.

25. Thomas M, George NI, Saini UT, Patterson TA, Hanig JP, Bowyer JF: Endoplasmic reticulum stress responses differ in meninges and associated vasculature, striatum, and parietal cortex after a neurotoxic amphetamine exposure. Synapse 2010, 64:579–593.

26. Hetz C, Bernasconi P, Fisher J, Lee AH, Bassik MC, Antonsson B, Brandt GS, Iwakoshi NN, Schinzel A, Glimcher LH, Korsmeyer SJ: Proapoptotic BAX and

BAK modulate the unfolded protein response by a direct interaction with IRE1alpha. Science 2006, 312:572–576.

27. Shi K, Wang D, Cao X, Ge Y: Endoplasmic reticulum stress signaling is involved in mitomycin C (MMC)-induced apoptosis in human fibroblasts via PERK pathway. PloS One 2013, 8:e59330.

28. Masud A, Mohapatra A, Lakhani SA, Ferrandino A, Hakem R, Flavell RA: Endoplasmic reticulum stress-induced death of mouse embryonic fibroblasts requires the intrinsic pathway of apoptosis. J Biol Chem 2007, 282:14132–14139.

29. Oyadomari S, Mori M: Roles of CHOP/GADD153 in endoplasmic reticulum stress. Cell Death Differ 2004, 11:381_–389.

30. Ron E, Shenkman M, Groisman B, Izenshtein Y, Leitman J, Lederkremer GZ: Bypass of glycan-dependent glycoprotein delivery to ERAD by up-regulated EDEM1. Molecul Biol Cell 2011, 22:3945_–3954.

31. Morito D, Nagata K: ER stress proteins in autoimmune and inflammatory diseases. Front Immunol 2012, 3:48.

32. Huber AL, Lebeau J, Guillaumot P, Pétrilli V, Malek M, Chilloux J, Fauvet F, Payen L, Kfoury A, Renno T, Chevet E, Manié SN: p58(IPK)-mediated attenuation of the proapoptotic PERK-CHOP pathway allows malignant progression upon low glucose. Molec Cell 2013, 49:1049–1059. 33. Han J, Back SH, Hur J, Lin YH, Gildersleeve R, Shan J, Yuan CL, Krokowski D,

Wang S, Hatzoglou M, Kilberg MS, Sartor MA, Kaufman RJ: ER-stress-induced transcriptional regulation increases protein synthesis leading to cell death. Nat Cell Biol 2013, 15:481_–490.

34. Schlegel G, Keller J, Hirche F, Geißler S, Schwarz FJ, Ringseis R, Stangl GI, Eder K: Expression of genes involved in carnitine synthesis and uptake in the liver of dairy cows in the transition period and at different stages of lactation. BMC Vet Res 2012, 8:28.

35. Schlegel G, Ringseis R, Keller J, Schwarz FJ, Windisch W, Eder K: Expression of fibroblast growth factor 21 in the liver of dairy cows in the transition period and during lactation. J Anim Physiol Anim Nutr 2013, 97:820–829. 36. Gessner DK, Schlegel G, Keller J, Schwarz FJ, Ringseis R, Eder K: Expression

of target genes of nuclear factor E2-related factor 2 in the liver of dairy cows in the transition period and at different stages of lactation. J Dairy Sci 2013, 96:1038_–1043.

37. Nivala AM, Reese L, Frye M, Gentile CL, Pagliassotti MJ: Fatty acid-mediated endoplasmic reticulum stress in vivo: differential response to the infusion of Soybean and Lard Oil in rats. Metabolism 2013, 62:753–760. 38. Loor JJ: Genomics of metabolic adaptations in the peripartal cow. Animal

2010, 4:1110–1139.

39. Schoenberg KM, Giesy SL, Harvatine KJ, Waldron MR, Cheng C, Kharitenkov A, Boisclair YR: Plasma FGF21 is elevated by the intense lipid mobilization of lactation. J Endocrinol 2011, 152:4652_–4661.

40. Carriquiry M, Weber WJ, Fahrenkrug SC, Crooker BA: Hepatic gene expression in multiparous Holstein cows treated with bovine somatotropin and fed n-3 fatty acids in early lactation. J Dairy Sci 2009, 92:4889–4900.

41. Rukkwamsuk T, Geelen MJ, Kruip TA, Wensing T: Interrelation of fatty acid composition in adipose tissue, serum, and liver of dairy cows during the development of fatty liver postpartum. J Dairy Sci 2000, 83:52–59. 42. Bionaz M, Trevisi E, Calamari L, Librandi F, Ferrari A, Bertoni G: Plasma

paraoxonase, health, inflammatory conditions, and liver function in transition dairy cows. J Dairy Sci 2007, 90:1740–1750.

43. Bertoni G, Trevisi E, Han X, Bionaz N: Effects of inflammatory conditions on liver activity in puerperium period and consequences for performance in dairy cows. J Dairy Sci 2008, 91:3300–3310.

44. Trevisi E, Amadori M, Cogrossi S, Razzuoli E, Bertoni G: Metabolic stress and inflammatory response in high-yielding, periparturient dairy cows. Res Vet Sci 2012, 93:695–704.

45. Zhang C, Chen X, Zhu RM, Zhang Y, Yu T, Wang H, Zhao H, Zhao M, Ji YL, Chen YH, Meng XH, Wei W, Xu DX: Endoplasmic reticulum stress is involved in hepatic SREBP-1c activation and lipid accumulation in fructose-fed mice. Toxicol Lett 2012, 212:229–240.

46. Qiu W, Su Q, Rutledge AC, Zhang J, Adeli K: Glucosamine-induced endoplasmic reticulum stress attenuates apolipoprotein B100 synthesis via PERK signaling. J Lipid Res 2009, 50:1814–1823.

47. Ota T, Gayet C, Ginsberg HN: Inhibition of apolipoprotein B100 secretion by lipid-induced hepatic endoplasmic reticulum stress in rodents. J Clin Invest 2008, 118:316–332.

48. Loor JJ, Dann HM, Everts RE, Oliveira R, Green CA, Guretzky NA, Rodriguez-Zas SL, Lewin HA, Drackley JK: Temporal gene expression profiling of liver

from periparturient dairy cows reveals complex adaptive mechanisms in hepatic function. Physiol Genomics 2005, 23:217–226.

49. Kim J, Cha Y-N, Surh Y-J: A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders. Mut Res 2010, 690:12–23. 50. Nair S, Doh ST, Chan JY, Kong AN, Cai L: Regulatory potential for

concerted modulation of Nrf2- and Nfkb1-mediated gene expression in inflammation and carcinogenesis. Br J Cancer 2008, 99:2070–2082. 51. Badman MK, Pissios P, Kennedy AR, Koukos G, Flier JS, Maratos-Flier E:

Hepatic fibroblast growth factor 21 is regulated by PPARalpha and is a key mediator of hepatic lipid metabolism in ketotic states. Cell Metab 2007, 5:426–437.

52. Inagaki T, Dutchak P, Zhao G, Ding X, Gautron L, Parameswara V, Li Y, Goetz R, Mohammadi M, Esser V, Elmquist JK, Gerard RD, Burgess SC, Hammer RE, Mangelsdorf DJ, Kliewer SA: Endocrine regulation of the fasting response by PPARalpha-mediated induction of fibroblast growth factor 21. Cell Metabol 2007, 5:415–425.

53. Lundåsen T, Hunt MC, Nilsson LM, Sanyal S, Angelin B, Alexson SE, Rudling M: PPARalpha is a key regulator of hepatic FGF21. Biochem Biophys Res Comm 2007, 360:437–440.

54. Li Y, Xu S, Giles A, Nakamura K, Lee JW, Hou X, Donmez G, Li J, Luo Z, Walsh K, Guarente L, Zang M: Hepatic overexpression of SIRT1 in mice attenuates endoplasmic reticulum stress and insulin resistance in the liver. FASEB J 2011, 25:1664–1679.

55. Seo HY, Kim MK, Min AK, Kim HS, Ryu SY, Kim NK, Lee KM, Kim HJ, Choi HS, Lee KU, Park KG, Lee IK: Endoplasmic reticulum stress-induced activation of activating transcription factor 6 decreases cAMP-stimulated hepatic gluconeogenesis via inhibition of CREB. Endocrinol 2010, 151:561–568. 56. Invernizzi G, Naeem A, Loor JJ: Short communication: endoplasmic

reticulum stress gene network expression in bovine mammary tissue during the lactation cycle. J Dairy Sci 2012, 95:2562–2566.

57. Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F: Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 2002, 3:0034.1–0034.11.

doi:10.1186/1746-6148-10-46

Cite this article as: Gessner et al.: Up-regulation of endoplasmic reticulum stress induced genes of the unfolded protein response in the liver of periparturient dairy cows. BMC Veterinary Research 2014 10:46.

Submit your next manuscript to BioMed Central and take full advantage of:

• Convenient online submission • Thorough peer review

• No space constraints or color figure charges • Immediate publication on acceptance

• Inclusion in PubMed, CAS, Scopus and Google Scholar • Research which is freely available for redistribution

Submit your manuscript at www.biomedcentral.com/submit