University of Veterinary Medicine Hannover
Characterization of the heparin-binding activity of the bovine respiratory syncytial
virus fusion protein
THESIS
submitted in partial fulfillment of the requirements for the degree
DOCTOR OF PHILOSOPHY - Ph.D. -
in the field of Virology
at the University of Veterinary Medicine Hannover
by
Diana Panayotova Dimitrova Ruse, Bulgaria
Hannover, Germany, 2005
Advisory Committee: 1. Prof. Dr. T. Schulz
2. Prof. Dr. P. Valentin-Weigand
First Evaluation: 1. Priv.-Doz. Dr. G. Zimmer, Institute of Virology, University of Veterinary Medicine, Hannover, Germany
2. Prof. T. Schulz, Institute of Virology, Medical High School, Hannover,
Germany
3. Prof. P. Valentin-Weigand, Institute of Microbiology, University of Veterinary Medicine, Hannover, Germany
Second Evaluation: Priv.-Doz. Dr. A. Maisner, Institute of Virology, Philipps-University, Marburg, Germany
Date of Oral Examination: 10.11.2005
2.1 TAXONOMY AND CLASSIFICATION... 9
2.1.1 Epidemiology and clinical factors ... 11
2.1.2 Pathogenesis, pathology and immune response... 11
2.1.3 Morphology and genome structure... 13
2.1.4 BRSV proteins... 14
2.1.5 RSV fusion protein ... 16
2.1.6 Heparin binding of RSV ... 17
2.2 AIMS OF THE STUDY... 19
3 MATERIALS... 20
3.1 CELL LINES... 20
3.2 VIRUSES AND BACTERIA... 21
3.3 PLASMIDS... 21
3.4 CELL CULTURE MEDIUM... 22
3.5 CULTURE MEDIUM FOR BACTERIA... 23
3.6 BUFFERS AND SOLUTIONS... 24
3.7 SYNTHETIC OLIGONUCLEOTIDES... 27
3.8 ENZYMES... 29
3.9 ANTIBODIES... 29
3.10 KITS... 30
3.11 SUBSTRATES... 30
3.12 TRANSFECTIONS REAGENTS... 31
3.13 CHEMICALS... 31
3.14 PCR AND GEL ELECTROPHORESIS COMPONENTS... 33
4 METHODS ... 34
4.1 CELL CULTURE... 34
4.2 VIRUS PROPAGATION... 35
4.2.1 BRSV... 35
4.3 VIRUS TITRATION... 35
4.3.1 Immunoplaque test for BRSV ... 35
4.4 REPLICATION KINETICS... 36
4.5 INFECTION INHIBITION ASSAY... 36
4.6 TRANSIENT TRANSFECTION OF MAMMALIAN CELLS... 37
4.6.1 Transfection of BSR-T7/5 cells ... 37
4.6.2 Generation of recombinant BRSV... 37
4.7 DNA RECOMBINATION METHODS... 39
4.7.1 Polymerase Chain Reaction... 39
4.7.2 Site-specific mutagenesis... 40
4.7.3 Molecular Cloning... 42
4.7.3.1 Cleavage of DNA with restriction enzymes ...42
4.7.3.2 Recovery of DNA from agarose gels...42
4.7.3.3 Ligation...43
4.7.3.4 Preparation of competent E. coli...44
4.7.3.5 Transformation of E. coli...45
4.7.3.6 Colony PCR...45
4.7.3.7 Plasmid DNA preparation...46
4.7.3.8 Sequencing ...46
4.7.4 Construction of plasmids containing modified BRSV genomes ... 47
4.8.4 Cell surface biotinylation and immunoprecipitation ... 50
5 RESULTS... 52
5.1 GENERATION OF RECOMBINANT BRSV ... 52
5.1.1 Modification of BRSV using reverse genetics ... 52
5.1.2 Mutagenesis of the F gene ... 54
5.1.3 Recombinant BRSV rescue ... 56
5.2 ANALYSIS OF THE BRSV MUTANTS... 60
5.2.1 Viral replication kinetics... 60
5.2.2 Effect of soluble GAGs on infection with BRSV-∆G/GFP and BRSV-GFP mutants. .... 63
5.2.3 Effect of heparin on infection with BRSV-∆G/GFP and BRSV-GFP mutants. ... 64
5.2.4 Analysis of mutations at position K75 and K77 ... 68
5.2.5 Analysis of F protein cell surface transport ... 68
5.2.6 Fusion activity of F mutants ... 70
5.2.6.1 Biotinylation and immunoprecipitation of the mutant F proteins...71
5.3 GENERATION OF MBP-F2 HYBRIDS... 72
6 DISCUSSION ... 73
6.1 MBP-BASIC AMINO ACID EPITOPE IN F2 SUBUNIT IS NOT SUFFICIENT FOR INTERACTION WITH HEPARIN... 74
6.2 MOST OF THE POINT MUTATIONS IN THE PUTATIVE BINDING DOMAIN OF THE F PROTEIN DO NOT AFFECT VIRUS VIABILITY... 74
6.3 EFFECT OF DIFFERENT GAGS AS INHIBITORS OF RECOMBINANT BRSV INFECTION... 75
6.4 ROLE OF K80N AND R85N MUTATIONS... 75
6.5 LYSINES AT POSITIONS 75 AND 77 OF THE F2 SUBUNIT PLAY AN ESSENTIAL ROLE FOR F PROTEIN FUNCTION... 76
6.6 EXCHANGE OF LYSINES 63 AND 66 HAS A MODULATING EFFECT ON BRSV INFECTIVITY... 76
6.7 G PROTEIN MAY COMPENSATE FOR POINT MUTATIONS IN THE F2 SUBUNIT... 77
6.8 RSV ATTACHMENT TO THE CELL SURFACE INVOLVES ADDITIONAL CELLULAR RECEPTOR(S) ... 78
6.9 CONCLUSIONS... 78
7 SUMMARY... 80
8 ZUSAMMENFASSUNG ... 82
9 REFERENCES ... 84
10 SEQUENCES... 94
11 ACKNOWLEDGEMENTS... 96
Ab antibody
bp base pair
BRSV bovine respiratory syncytial virus cDNA complementary DNA CPE cytopathic effect
DNA deoxyribonucleic acid dNTP 2´-deoxynucleoside 5’-triphosphates DTT dithiothreitol
E. coli Escherichia coli et al. et alii (alitar)
EDTA ethylenediamine tetraacetic acid F protein fusion protein
FITC fluoresceinesothiocyanat GAGs glycosaminoglycans FCS fetal calf serum G protein glycoprotein
HBD heparin-binding domain h hour
HRSV human respiratory syncytial virus
kb kilo base
kDa kilo dalton
kV kilo volt
LB Luria Bertani
L protein large protein M molar
M protein matrix protein m milli
µ micro min minute
mA milli ampere
ml milliliter
mM milli molar
MOI multiplicity of infection ORF open reading frame
ng nano gram
nm nano meter
N protein nucleus protein Nr. number
NS protein non-structural protein nt nucleotide
OD optical density pmol pikomol
P protein phospho protein
PAGE polyacrylamide gel electrophorese PBS phosphate buffer saline
PBSM phosphate buffer saline without Ca2 and Mg2
pfu plaque forming unit
PCR polymerase chain reaction
RNA ribonucleic acid RSV respiratory syncytial virus
RV rabies virus
RT room temperature SDS sodium dodecyl sulfate SH protein small hydrophobic protein TAE tris-acetat-EDTA
Taq Thermus aquaticus
TBE tris borate EDTA
TEMED N, N, N’, N’-tetramethlethylendiamin
1 Introduction
The human respiratory syncytial virus (HRSV) and the bovine respiratory syncytial virus (BRSV) are the most common and important causes of lower respiratory tract illness in young infants and calves leading to bronchitis, bronchiolitis, and pneumonia. These related viruses share common epidemiological, clinical, and pathological characteristics. More than 70% of calves exhibit a positive serological response against BRSV by the age of 12 months.
The envelope of the respiratory syncytial viruses (RSV) contains three glycoproteins: the attachment protein G, the fusion protein F, and the small hydrophobic protein SH.
An attachment function has been attributed to the G protein. However the isolation of a RSV deletion mutant (cp-52) which lacks the SH and G proteins suggests that the F protein is sufficient to mediate attachment to cellular receptors. The primary function of the F protein is to mediate fusion between the viral and the cellular membrane.
The attachment of both BRSV and HRSV to the cell surface depends on heparin-like structures. The heparin-binding activity of HRSV has been attributed to the G protein which contains basic amino acid clusters that might be responsible for this interaction. Apart from the G protein, the F protein was also shown to bind to heparin. The F2 subunit of the F protein also contains a cluster of basic amino acids. The role of this domain in virus infection was investigated in this work.
2 Bovine respiratory syncytial virus (BRSV)
2.1 Taxonomy and classification
Bovine respiratory syncytial virus (BRSV) is a negative-strand RNA virus classified in the family Paramyxoviridae, order Mononegavirales (Collins et al.,2001) (Table 1). Paramyxoviridae are subdivided into two subfamilies. The Paramyxovirinae includes Sendai virus, measles virus, mumps virus, Newcastle disease virus, simian virus 5 and human parainfluenza viruses while the second subfamily Pneumovirinae is represented by the genera Pneumovirus and Metapneumovirus. Pneumoviruses differ from other paramyxoviruses in several aspects: (1) eight or ten encoded mRNAs are typical for pneumoviruses compared with six or seven for paramyxoviruses; (2) proteins not present in paramyxoviruses are: NS1, NS2, M2-1 and M2-2; (3) pneumoviruses lack the V, D and C proteins present in some paramyxoviruses; (4) the unusual mucin-like G attachment protein of pneumoviruses is structurally distinct from the hemagglutinin-neuraminidase (HN) or the hemagglutinin (H) attachment proteins of other paramyxoviruses .
The genus Metapneumovirus consists of human metapneumovirus and avian pneumovirus (APV). These viruses lack the NS1 and NS2 genes and have a different gene order with respect to the F and M2 genes (Collins et al.,2001).
Table 1: Family Paramyxoviridae
Genus: Meta- pneumovirus Human meta- pneumovirus Avian pneumovirus
Subfamily: Pneumovirinae Genus: Pneumovirus Bovine respiratory syncytial virus Human respiratory syncytial virus (RSV) Caprine RSV Ovine RSV Pneumonia virus of Mice (PVM)
Henipa viruses: Hendravirus Nipahvirus Tupaia- Paramyxovirus
Genus: Morbillivirus Measles virus Canine distemper virus Phocine distemper virus Rinderpest virus Peste des petites- ruminants virus
Genus: Rubulavirus Mumps virus Human parain- Fluenza virus types 2 and 4 Simian virus 5 (canine parain- fluenza virus type 2) Newcastle disease virus
Family: Paramyxoviridae Subfamily: Paramyxovirinae Genus: Respirovirus Human parain- fluenza virus types 1 and 3 Bovine para- influenza virus type 3 Sendai virus
2.1.1 Epidemiology and clinical factors
HRSV and BRSV are closely related and show common epidemiological, clinical and pathological characteristics. They are the most common and important cause of lower respiratory tract illness in calves and young infants (Van der Poel et al., 1994). BRSV was first diagnosed in 1967 by Paccoud and Jacquier in Switzerland. The virus was first detected in Japan, Belgium and Switzerland, and it was isolated later in England and USA (Murphy et al., 1999). The presence of BRSV in cattle herds has been recognized worldwide (Bryson et al.,1978). Severe respiratory symptoms in calves are almost exclusively observed during autumn and winter seasons (Van der Poel et al., 1994; Murphy et al., 1999).
Calves that are born early in the year are most likely to suffer from the early syndrome in their first summer before they are weaned. The clinical signs associated with the early syndrome typically include coughing, nasal and ocular discharge, and an elevated temperature. The severity of the early syndrome is usually quite mild and the calves will often completely recover. However, the early syndrome can predispose the calves to secondary bacterial infection leading to a more severe and often fatal pneumonia. The early signs are often mild and transient and would include such features as a high-pitched dry cough, clear nasal and ocular discharge, mild anorexia, and mild depression (Backer et al., 1997). The later signs of this disease are often more evident and include increased temperature, severe anorexia, and significant weight loss. Often the eyes and surrounding tissues will swell.
2.1.2 Pathogenesis, pathology and immune response
Initially, an animal inhales the aerosolized virus. The virus is able to infect both ciliated and nonciliated cells of the upper and lower respiratory tract. Cytopathological changes in these cells result in a necrotizing bronchiolitis. Numerous cytokines and chemokines are released by infected cells and serve as chemoattractants for inflammatory cells, particularly neutrophils. BRSV is often associated with secondary bacterial infections suggesting either an immuno-suppressive activity of the virus or a role in producing mechanical damage allowing the entry of bacterial pathogens or a combination of both.
In experimentally infected calves the virus causes complete loss of the ciliated epithelium 8-10 days after infection so that pulmonary clearance is compromised facilitating secondary infections. At necropsy, subpleural and interstitial emphysema may be seen in all lobes of the lungs. A characteristic finding is the presence of syncytia in the lungs which are usually larger than those associated with parainfluenza virus type 3 infection (Murphy et al.,1999).
Both cell-mediated and antibody-mediated immune responses contribute to the efficient protection of animals. A hallmark of RSV infection is that the immune response is short-lived and reinfections are common. Neutralizing antibodies are induced by the F and G proteins as evaluated in calves vaccinated with recombinant vacinia virus encoding these proteins. High titers of neutralizing antibodies are induced by the F protein, whereas the G protein only induces a low level of complement-dependent neutralizing antibodies (Taylor et al., 1997; Thomas et al., 1998). Maternal antibodies are commonly present in calves but do not provide complete protection against infection (Kimman et al., 1998). Although infection can occur in the presence of neutralizing antibodies, they provide some protection as high antibody titers decrease the severity of the disease in both children and calves (Kimman and Westenbrink, 1990). Attempts to develop a vaccine against HRSV were not successful so far. In vaccination studies, increased lung pathology was observed after application of formalin-inactivated preparations associated with an Arthus-type reaction, antibody mediated enhancement of macrophage infection, complement activation, and hypersensitivity reactions. This immunopathology may be a consequence of a predominant Th2 response of helper cells with the preferential release of inflammatory cytokines (Murphy et al., 1999). For more than 18 years BRSV vaccines have been developed and used in some European countries (Valarcher et al., 2000). Modified-live virus (MVL) and inactivated single fraction and combination vaccines are currently available; nevertheless, their efficacy and potential disease enchancing properties remain controversial (Backer et al., 1997;
Bowland and Shewen, 2000). It has been shown that MLV and inactivated BRSV vaccines stimulate distinctively different antibody responses in cattle. Differences in T lymphocyte responses have also been reported, and it has been suggested that natural infection and MLV vaccines stimulate T helper 1 (TH-1)-type responses, whereas inactivated BRSV stimulates T helper 2 (Th-2)-type responses (Gerschwin et al., 1998; West et al., 1999, 2000)
2.1.3 Morphology and genome structure
BRSV virions include irregular spherical particles from 150 to 300 nm in diameter (Fig. 1). Virion preparations can include a high content of filamentous forms 60 to 100 nm in diameter and up to 10 µm in length (Berthiaume et al., 1974). The virion contains an helical nucleocapsid enveloped by a lipid bilayer derived from the host-cell plasma membrane. BRSV lacks the hemagglutination and neuraminidase activities present in several members of the Paramyxovirinae. However, the absence of an hemagglutinin is not a general hallmark of pneumoviruses because PVM is able to agglutinate erythrocytes.
Figure 1. Schematic structure of BRSV
The BRSV genome is a single-stranded, negative-sense RNA of 15 200 nucleotides, and encode 11 proteins (Fig. 2) (Buchholz et al., 1999). BRSV transcription and replication are similar to those of other Mononegavirales members.
The viral genomic RNA is tightly encapsidated by the N protein and serves as a template for replication and transcription. The N, P, and L proteins, together with the RNA genome are the virus-specific components required for RNA replication (Grosfeld et al., 1995; Yu et al., 1995). It has been shown that these components
L
P N G
F
RNA M SH
M2
lipid envelope
protein (Collins et al., 1996; Fearns and Collins, 1999 ). RNA replication involves the synthesis of a full-length, positive-sense, encapsidated RNA, called the antigenome, which serves as the template for the synthesis of negative-strand genomes.
Transcription initiates at the 3’ genomic promoter and copies the genes by a linear, sequential, start-stop mode that yields subgenomic mRNAs (Kuo et al., 1996;
Zamora and Samal, 1992). Each gene begins with a conserved 10 nt start (GS) motif that directs initiation of transcription, and ends with a 12-13 nt end (GE) motif that directs polyadenylation and release of the mRNA (Kuo et al.,1997). For the members of the Mononegavirales, the gene order appears to be a important factor dictating the relative molar amounts of viral mRNAs synthesized during virus infection (Collins et al., 1983). The efficiency of gene transcription decreases with increasing distance from the promoter (Barik, 1992). The first nine BRSV genes are separated by intergenic regions of variable length and sequence, the role of which in transcription is not clear (Hardy and Wertz, 1999). The last two genes, M2 and L overlap, by 67 nt and are expressed as separate mRNAs. The M2 mRNA contains two open reading frames (ORFs) that slightly overlap (Collins et al.,1990) (Figure 2); the upstream ORF1 encodes the M2-1 protein and the downstream ORF2 the M2-2 protein which appears to be involved in regulating the balance between transcription and RNA replication (Bermingham and Collins, 1999).
Figure 2. Schematic structure of the BRSV genome
2.1.4 BRSV proteins
The BRSV genome encodes eleven proteins:
N is the major nucleocapsid protein. It binds tightly to genomic and antigenomic RNA.
NS1
3‘ 5‘
NS2 N P M SH G F M2-1/2 L
L is the major polymerase subunit.
P is the most heavily phosphorylated RSV protein. It serves as a polymerase cofactor.
M2-1 is encoded by the 5’ proximal ORF of the M2-mRNA and serves as a transcription elongation factor.
M2-2 is encoded by the second internal ORF of the M2-mRNA and is a putative negative regulatory factor for replication and transcription (Bermingham and Collins, 1999).
There are three viral transmembrane glycoproteins:
SH (small hydrophobic protein) is a small protein of unknown function (Olmsted and Collins, 1989; Samal and Zamora, 1991). SH is dispensable for virus replication in cell culture (Bukreyev et al., 1997). However, recombinant RSV lacking SH are attenuated in vivo (Bukreyev et al., 1997; Whitehead et al., 1999).
G is the attachment glycoprotein, a heavily glycosylated type II membrane protein that does not share any sequence or structural homologies with attachment proteins of other paramyxoviruses (Satake et al., 1985; Wertz et al., 1985). It lacks hemagglutinatin and neuraminidase activities. It shows a high degree of species- and strain-specific antigen variation that has led to the definition of serological subgroups (Lerch et al., 1990; Mallipedi and Samal, 1993; Furze et al., 1994). The receptor- binding activity of the G protein was demonstrated using G-specific antibodies that inhibited virus attachment (Levine et al., 1987).
F glycoprotein mediates membrane fusion and syncytium formation. It is the major antigen inducing neutralizing antibodies.
M is the non-glycosylated matrix protein and has a central role in organizing the virus envelope (Teng and Collins, 1998). Recent studies suggest that the M protein may play a role in early stages of infection by inhibiting host cell transcription (Ghildyal et al., 2003).
NS1 and NS2 are small proteins detected in only trace amounts in purified virions and therefore have been considered to be nonstructural. NS1 is a putative negative regulatory factor for replication and transcription. Recombinant RSV lacking NS1 or NS2 are infectious and replicate in cell cultures (Collins et al., 2001) but show marked reduction in replication efficacy in vivo (Whitehead et al., 1999; Teng et al., 2000). These genes have been shown to function as interferon antagonists
2.1.5 RSV fusion protein
The RSV F protein is synthesized as a non-active precursor F0 which is cleaved in the trans-Golgi network by the cellular protease furin. The cleavage occurs at two conserved furin consensus cleavage sites and results in the generation of three products: a large subunit F1 with a highly conserved hydrophobic N terminus, the fusion peptide; the small subunit F2, and a glycosylated peptide of 27 amino acids (pep27) (Gonzales-Reyes et al., 2001; Zimmer et al., 2001, 2002). Pep 27 was found to be dispensable for viral replication in vitro. It is subject to additional posttranslational modifications and is secreted by the infected cells as a biologically active tachykinin (Zimmer et al., 2003). The two subunits F1 and F2 are arranged in a disulfide-linked complex that represents the biologically active form of the F protein.
The F protein is a type I membrane protein that contains a hydrophobic transmembrane domain near the C-terminus of the F1 subunit. The carboxyterminal domain is composed of 24-amino acids and is located in the cytoplasm. The classical role of the fusion (F) protein is to direct viral penetration by a fusion event between the viral envelope and the host cell plasma membrane whereby the nucleocapsid is delivered into the cytoplasm. In addition, when the F protein is expressed on the cell surface of infected cells, it mediates fusion with neighboring cells resulting in giant, multinucleated syncytia.
The pneumovirus and paramyxovirus F proteins do not show significant sequence similarity (Collins et al., 1984). However, in both genera the fusion proteins have similar structural features like a similar length, and the location of hydrophobic domains, heptad repeats, and cysteine residues. A common feature of fusion proteins is that upon proteolytic activation an hydrophobic fusion peptide is exposed that triggers the fusion reaction (Dutch et al., 2000). The RSV F protein can mediate entry and syncytium formation in the absence of other RSV proteins. This feature discriminates it from most other paramyxovirus fusion proteins which require the assistance of the homologous attachment protein to show fusion activity. Although the RSV F protein can mediate syncytium formation by itself, coexpression of the G and SH proteins has been shown to increase fusion efficiency (Heminway et al., 1994).
2.1.6 Heparin binding of RSV
Heparan sulfate and chondroitin sulfate B belong to a group of glycosaminoglycans (GAGs). These two types GAGs are major binding sites for respiratory syncytial virus on the cell-surface. Glycosaminoglycans are unbranched polymers of repeating disaccharide units. Some of them are found as a proteoglycans covalently linked to membrane proteins on the cell surface of most mammalian cells. One of the prominent physico-chemical properties of GAGs is the presence of a large and varying number of negative charges. Heparin is frequently used as a convenient analog of heparin sulfate for experimental purposes (Lindahl et al., 1994). The heparin-binding properties of RSV were reported for the first time by Krusat and Streckert in 1997, who showed that heparin is a potent antagonist of RSV infection. A cellular protein receptor for RSV has not been identified, however there is evidence that cell surface glycosaminoglycans (GAGs) are important for efficient infection, at least in vitro. It was shown that RSV infection can be inhibited by preincubation of the virus with soluble GAGs such as heparin. In addition, RSV infection was significantly reduced following treatment of the cells with enzymes that remove GAGs from the cell surface. It was also shown that mutant cell lines with defects in GAGs synthesis are not efficiently infected by RSV (Krusat and Streckert, 1997; Bourgeois et al., 1998 Hallak et al., 2000; Karger et al., 2001; Techaarpornkul et al., 2002). Binding of RSV to GAGs is primary mediated by the G protein (Krusat and Streckert, 1997). Feldman et al. (1999) suggested that region with clusters of positively charged amino acids that share similarity with heparin-binding domains from other viral and mammalian proteins represents the major GAG-binding domain.
However, subsequent studies using recombinant viruses showed that this site can be deleted without affecting infectivity or susceptibility to neutralization by soluble GAGs (Teng and Collins, 2002). Analysis of the G protein C-terminus revealed that the postulated heparin-binding domain expands to residue 187-231 (Shields et al., 2003) confirming the work of Teng and Collins (2002) that the HBD is not confined to the previously reported residues 184-198 (Feldman et al., 1999). Another report suggested that heparin-like structures associated with the G protein are involved in RSV infection (Bourgeois et al., 1998), but these data have not been confirmed.
It was shown that heparan sulfate and dermatan sulfate are the two cell surface GAGs which are important for efficient RSV infection (Hallak et.al., 2000a).
other GAGs that do not contain IdUA did not inhibit RSV infection. Furthermore, sulfation at specific GAG positions and the length of the saccharide chains have also been found to be important for RSV infection (Hallak et al., 2000b).
The observation that the biologically derived cold-passaged mutant cp-52 which lacks the G and the SH proteins is still dependent on heparin suggests that the F protein also binds to GAGs on the cell surface to initiate infection (Feldman et al., 2000). A similar observation was made when the G gene was deleted from HRSV and BRSV (Karger et al., 2001; Techaarpornkul et al., 2002). When the GAG dependence of a recombinant virus with F protein as its only glycoprotein was compared to an isogenic virus containing the complete genome, it turned out that attachment and infection by both viruses required cell surface heparan sulfate. All these data suggest that both G and F protein bind to HS. A region in the F protein responsible for heparin binding have not been identified so far.
2.2 Aims of the Study
As outlined in the literature review above, the currently available data on the mechanisms of RSV interaction with the cell surface do not provide a complete picture of the receptor-binding properties of the virus. However, there is evidence that the F protein of RSV plays a role not only in fusion, but also in attachment to the cell surface. This interaction probably includes recognition of cell surface glycosaminoglycans.
A better understanding of the interaction of the F protein with heparin-like structures requires analysis of the precise location, distribution and structure of its heparin-binding domains. The identification of putative heparin-binding domains in the F protein as well as the identification of additional receptors will provide the possibility to develop therapeutics that block RSV infection.
The present study was based on the working hypothesis that a cluster of basic amino acids in the F2 subunit of the BRSV fusion protein is involved in heparin- binding. Evidence for this hypothesis are: 1) the cluster of basic amino acids in the F2 subunit shows similarity with other heparin-binding domains (HBDs); 2) the F2 subunit determines species specific infection of HRSV and BRSV, respectively; 3) only F2 subunit contains variable regions in F protein.
Aim of this study was the characterization of the basic domain in the F2 subunit of BRSV using site-directed mutagenesis. By generation of recombinant viruses the effect of the mutations on virus infection and replication was studied.
3 Materials
3.1 Cell lines
BHK-21-cells
An established cell line derived from baby hamster kidney. The cell line was provided by the Institute for Virology, University of Veterinary Medicine Hannover.
Vero cells
An established cell line derived from African Green Monkey. The cell line was provided by the Institute for Virology, University of Veterinary Medicine Hannover.
BSR T7/5 cells
This cell line is derived from the BHK-21 cell line. The cells stably express T7 RNA polymerase (Buchholz et al., 1999). The cell line was provided by Dr.
Conzelmann, Max-von-Pettenkofer-Institute, München.
PT-cells
An established cell line derived from calf kidney epithelia. The cell line was provided by Dr. Riebe, Federal Research Institute of Animal Health, Insel Riems.
3.2 Viruses and bacteria
Bovine respiratory syncytial virus
BRSV ATue 51908 was provided by Dr. Conzelmann, Max-von-Pettenkofer- Institute, München.
XL1-Blue E. coli
In this work, the XL1-Blue E. coli cells purchased from Stratagene company were used for propagation of plasmids.
3.3 Plasmids
pTM1
This plasmid contains a T7 promoter and a T7 termination signal. It contains also IRES from EMC (Moss et al., 1990) and was used for cytoplasmic expression in cells with T7 RNA polymerase.
pCR 3.1
This plasmid was purchased from Invitrogen company was used for expression in mammalian cells.
pcR 2.1
This plasmid purchased from Invitrogen company was used as a TA cloning vector.
pBluescript-BRSV (pBRSV)
This plasmid contains the complete genome of BRSV strain ATue51908. The vector was provided by Dr. Conzelmann from Max-von-Pettenkofer-Institute.
3.4 Cell culture medium
DMEM (Dulbecco’s Minimal essential medium), pH 6,9
DMEM powder 13.53g
NaHCO3 2.2g
dH2O to1l
Double concentrated DMEM, pH 6.9
Edulb powder 27.06 g
NaHCO3 4.4 g
dH2O to1 l
EMEM (Eagle’s Minimum Essential Medium), pH 7
EMEM powder 9.6 g
NaHCO3 2.2 g
dH2O to 1 l
The powder was provided from GIBCO BRL Life Technologies company. Per liter of medium were added 0.05 g of streptomycin sulfate and 0.006 g of penicillin G (Sigma).
Versen-Trypsin 0.125%, pH 7.0
NaCl2 8.0 g
KCl 20 g
Na2HPO4 x 12 H2O 2.31 g
KH2PO4 x 2 H2O 0.20 g
CaCl2 0.13 g
MgSO4 x 7 H2O 0.10 g
Tyrosine 1.25 g
Versen (EDTA) 1.25 g
Streptomycin 0.05 g
Penicillin 0.06 g
dH20 to 1 l All reagents were sterile-filtrated.
MEM (2X ) with glutamine GIBCO BRL Life Technologies
Fetal calf serum (FCS) Biochrom
Not essential amino acids Biochrom
Pyruvate Invitrogen
3.5 Culture medium for bacteria
LB-medium, pH 7.0
Trypton 10 g
NaCl2 10 g
Yeast extract 5 g
dH2O to 1 l
For preparation of LB agar, 20 g of agar-agar to 1 liter LB-medium was added and autoclaved. When the medium was cooled to 50°C, ampicillin (50mg/ml) was added (final concentration 50µg/ml) and the medium was poured into petri dishes.
SOC medium
Trypton 2%
NaCl2 10 mM
Yeast extract 0.5%
KCl2 2.5 mM
MgCl2 x 6H2O 10 mM
Glucose 20 mM
3.6 Buffers and solutions
10 X TBE buffer
TRIS 108 g
Boric acid 53.4 g
EDTA 7.4 g
dH2O to 1 l
10 X TAE buffer, pH 8.0
TRIS 40 mM
Sodium acetate X 3 H2O 20 mM
dH2O to 1 l
PBS, pH 7.5
NaCl 8 g
KCl 0.2 g
Na2HPO4 1.15 g
KH2PO4 0.12 g
MgCl2 x 6 H2O 0.1 g
CaCl2 x 2 H2O 0.132 g
dH2O to 1 l
PBSM, pH 7.5
NaCl 8 g
KCl 0.2 g
Na2HPO4 1.15 g
KH2PO4 0.12 g
dH2O to 1 l
PBSM 0.1 % Tween
PBSM 1 l
Tween-20 2 ml
SDS running buffer for PAGE (10X stock solution)
SDS 10 g
Tris 30 g
Glycin 144 g
dH20 to 1 l
Stacking gel for PAGE
acrylamide/bisacrylamide 30% 0.83 ml
1 M Tris-HCl, pH 6.8 0.63 ml
10% SDS 50 µl
10% ammonium persulfate (APS) 50 µl
TEMED 10 µl
Separating gel 10%
acrylamide/bisacrylamide 30% 3.3 ml
1 M Tris-HCl, pH 8.8 2.5 ml
10% SDS 100 µl
10% ammonium persulfate (APS) 100 µl
TEMED 16 µl
H2O 4 ml
SDS sample buffer (2X)
1 M Tris HCl, pH 6.8 100 mM
SDS 4%
Glycerol 20 %
Bromophenol blue 0.02 %
Anode buffer I, pH 9.0
1 M Tris 300 ml
Ethanol or Methanol 200 ml
H2O 500 ml
Anode buffer II, pH 7.4
1 M Tris 25 ml
Ethanol 200 ml
H2O 775 ml
Cathode Buffer, pH 9.0
Amino-n-caproic acid 5.25 g
1 M Tris 25 ml
Ethanol 200 ml
H2O 775 ml
Fixation solution for protein gels
Methanol 400 ml
concentrated acidic acid 100 ml
H2O 500 ml
NP40-lysis buffer
Sodium deoxycholate 0.5 %
Nonidet P40 1%
Tris HCl, pH 7.5 50 mM
NaCl2 150 mM
Protease inhibitor „Complete“ 1 tabl
Phosphate buffer, pH 7
Na2HPO4 50 mM
NaH2HPO4 50 mM
Sodium acetate buffer, pH 5.5
Sodium acetate 150 mM
MgSO4/HEPES buffer
MgSO4 100 mM
HEPES 50 mM
CaCl2 buffer, pH 7.0
CaCl2 0.9 g
Glycerin 15 ml
Pipes 0.3 g
dH2O to 100 ml
3.7 Synthetic oligonucleotides
The following oligonucleotides were synthesized by MWG, Ebersberg.
Used synthetic oligonuceotides:
N Name Sequence
1 PVM-F2-S TTTTGAATTCAATACATTAACAGAAAAATACTATGAG 2 PVM-F2-AS TTTTGTCGACTCACCTCTTCTTCCTTTTGGACTTCAA 3 Mal-S GAGCGGTCGTCAGACTGTCGATG
4 MBP-hF2-AS3 TTTTGTCGACTCATCTTCTGGCTCGATTGTTTGCTGCTGGTGTGCT 5 F2-Mal-S TTTGAATTCTGTTTTGCTTCTAGTCAAAAAACATCAC
6 hF2(K80N)-AS TCTAATTCTTTGGTTTATCAGATTTTCGTTGGC
7 hF2(K80N)-S AATCGTATAAACCAAGAATTAGATAAATATAAAAATGC 8 Bdouble-S AGTACTGATTCAAACGTGAACTTAATAAAGCAAGAACTA 9 Bdouble-AS TTGCTTTATTAAGTTCACGTTTGAATCAGTACTTTTACA
10 GFP-ins-S GTTGGGGCAAATACAAGTATGGTGAGCAAGGGCGAGGAGCTGTTC 11 GFP-ins-AS TTATATGGAGGTGTGTTGTTACTTGTACAGCTCGTCCATGCCGAGAG
T
12 bGdel-AS CTCGCCCTTGCTCACCATACTTGTATTTGCCCCAACATCTGTATGTAA 13 bGdel-S GACGAGCTGTACAAGTAACAACACACCTCCATATAATATCAATTA 14 bF(K63/66N)-S ATAGAGTTGAGCAACATACAAAACAATGTGTGTAAAAGTACT 15 bF(K63/66N)-AS TTTACACACATTGTTTTGTATGTTGCTCAACTCTATTGTTAC 16 bFmut(70)S AACAATGTGTGTAACAGTACTGATTCAAAAGTG
17 bFmut(70)AS TGAATCAGTACTGTTACACACATTGTTTTGTAT
18 bF(75)S AGTACTGATTCAAACGTGAAATTAATAAAGCAA 19 bF(75)AS TATTAATTTCACGTTTGAATCAGTACTTTTACA 20 bF(77)S GATTCAAAAGTGAACTTAATAAAGCAAGAACTA 21 bF(77)AS TTGCTTTATTAAGTTCACTTTTGAATCAGTACT 22 bF(80)S GTGAAATTAATAAACCAAGAACTAGAAAGATAC 23 bF(80)AS TTCTAGTTCTTGGTTTATTAATTTCACTTTTGA 24 bF(85)S CAAGAACTAGAAAATTACAACAATGCAGTAGTG 25 bF(85)AS TGCATTGTTGTAATTTTCTAGTTCTTGCTTTAT 27 BRSV(PflMI) ATCCAATCAAGTACAGCATACACC
28 HF(XhoI)S TATACTCGAGACAATGGAGTTGCCAATCCTCAAAGCAAATGC 29 HF-TM(NehI)-AS TATAGCTAGCTCAGTTACTAAATGCAATATTATTTATAC 30 PCR3.1 (BGHrev.) TAGAAGGCACAGTCGAGG
31 BF-AS(EcoRi) ACTGAGAGGTGTGGTAATACC
32 BF63-S ATAGAGTTGAGCAACATACAAAAAAATGTGTGT 33 BF63-AS ATTTTTTTGTATGTTGCTCAACTCTATTGTTAC 34 BF66-S AGCAAAATACAAAACAATGTGTGTAAAAGTACT 35 BF66-AS TTTACACACATTGTTTTGTATTTTGCTCAACTC 36 BF(75/77/80)-S AGTACTGATTCAAACGTGAACTTAATAAACCAAGAA 37 BF(75/77/80)-AS TTCTAGTTCTTGGTTTATTAAGTTCACGTTTGAATC
Table 2. Used synthetic oligonuceotides.
3.8 Enzymes
NheI New England Biolabs
NotI MBI Fermentas
SpeI New England Biolabs
BstE II New England Biolabs
Eco R I MBI Fermentas
XhoI MBI Fermentas
T4 DNA Ligase (5 U/µl) MBI Fermentas
Pfu DNA Polymerase MBI Fermentas
Taq DNA Polymerase MBI Fermentas
calf intestine alkaline phosphatase (CIAP)
MBI Fermentas
Streptavidin-peroxidase (HRP)-complex Amersham/Pharmacia Endoglycosidase H (Endo H) Calbiochem
N-glycosidase F (1U/µl) Roche
3.9 Antibodies
Name Provided by:
Mouse anti-RSV polyclonal antibody Biosoft Mouse anti-RSV F monoclonal N4
antibody
provided by Dr. G. Taylor, Compton, England
Mouse anti-RSV F monoclonal N13 antibody
provided by Dr. G. Taylor, Compton, England
Mouse anti-RSV F monoclonal N19 antibody
provided by Dr. G. Taylor, Compton, England
18G6 anti-RSV matrix protein monoclonal antibody
provided by Dr. Zimmer, Institute of Virology, TiHo
anti-mouse IgG, biotin conjugate SIGMA Peroxidase-conjugated rabbit anti-
mouse immunoglobuline
DAKO
Rabbit Anti-F2-MBP New England Biosoft
anti-HRSV monoclonal antibody Serotec, Oxford, United Kingdom anti-MBP antibody, peroxidase
conjugate
Sigma
3.10 Kits
QIAquick PCR Purification Kit Qiagen QIAquick Gel Extraction Kit Qiagen
Rneasy Mini Kit Qiagen
QIAfilter Plasmid MIDI und MAXI Kit Qiagen Qiaex II Gel Extraction Kit Qiagen
Original TA Cloning Kit Invitrogen
BCA Protein Assay Pierce
Expand Reverse Transkriptase Roche
3.11 Substrates
BM Chemiluminescence Blotting Substrate (POD)
Roche
Super Signal West Dura Pierce
3.12 Transfections reagents
SuperFect Transfection Reagent Qiagen Lipofectamine 2000 Reagent GibcoBRL
Exgene 500 Fermentas
3.13 Chemicals
Name Company
Acetone Roth
Acrylamide 30% Roth
Agar-Agar Roth
Agarose Biozym
Amino-n-caproic acid Sigma
Ammoniumpersulfate (APS) Bio-Rad
Blocking reagent Roche
Boric acid Roth
CaCl2 Roth
Protease inhibitor cocktail-Complete Roche
1,4-dithiothreitol (DTT) Roth
EDTA Roth
Acidic acid Roth
Ethanol Merck
Ethidium bromide Sigma
Glucose Roth
Glycerol Roth
Glycine Roth
G418 sulfate (geneticin) Calbiochem
Yeast extract Roth
HEPES Roth
2-propanol Roth
Potassium dihydrogen phosphate Roth
Potassium chloride Roth
Leupeptin Roche
Magnesium chloride Roth
Magnesium sulfate Roth
2-Mercaptoethanol Fluka
Methanol Roth
Methylcellulose Sigma
Mowiol Calbiochem
Sodium acetate Merck
Sodium chloride Roth
Sodium deoxycholate Roth
Sodium dodecyl sulfate (SDS) Roth Sodium hydrogen phosphate Roth
Sodium hydroxide Roth
TEMED Roth
Nonidet 40 Roche
Paraformaldehyde Fluka
Pepstatin Roche
Sucrose Roth
Sea plaque agarose Biozym
Tris-Hydroxymethylaminomethane Roth
Triton X-100 Roth
Trypton Roth
Tween-20 Roth
3.14 PCR and gel electrophoresis components
Name Company
2´-deoxynucleoside 5’-triphosphates (dNTPs)
MBI Fermentas
Gene Ruler 100bp leader Plus DNA marker
MBI Fermentas
Lambda DNA EcoRI/HindIII DNA marker MBI Fermentas 6 x loading dye solution MBI Fermentas
4 Methods
4.1 Cell culture
The mammalian cells were cultivated in 75cm2 tissue culture dishes (Nunc) and were passaged twice per week. The cells were washed with PBSM and treated with Versen-Trypsin for 5-15 minutes at 37°C. Afterwards the cells were resuspended in a small volume of medium and diluted 1:40. The cultures were incubated at 37°C in a humidified incubator aerated at 5% CO2 .
BHK-21 cells
The baby hamster kidney cell line BHK-21 was maintained in EMEM supplemented with 5% FCS and 1% non-essential amino acids.
BSR-T7 cells
The cells were maintained in EMEM supplemented with 5% FCS and G418 Geneticin was added to the medium (a selective antibiotic for the T7 RNA polymerase expressing cells).
PT-cells
This cell line was maintained in EMEM supplemented with 5-10% FCS, 1%
non-essential amino acids and 1% pyruvate.
Vero cells
The green African monkey kidney cell line was maintained in DMEM supplemented with 5% FCS.
4.2 Virus propagation
4.2.1 BRSV
BRSV was propagated on Vero cells. Twenty-four hours before infection the cells were treated with Versen-Trypsin and seeded at a concentration of 250.000 cells/ml in 25 cm2 tissue culture dishes (5 ml of cell suspension/dish). The cultures were incubated for 20-24 hours at 37°C. The medium was removed and the cells were infected at a multiplicity of infection (MOI) of 0.1 pfu/cell. Following incubation for 3 hours at 37° C, the virus was removed, complete growth medium was added and the cells were further incubated for 4-5 days at 37°C. The cells were daily monitored for syncytia formation. When an extensive cytopathic effect was detected, virus was released by freezing and thawing, followed by centrifugation at 3000 x g for 10 min at 4°C. The virus was frozen in liquid nitrogen in the presence of 10%
MgSO4/HEPES buffer (100 mM MgSO4 /50 mM HEPES), and stored at –80° C.
4.3 Virus titration
Virus infectious titers were determined by plaque assay. Monolayers of cultivated cells were infected with serial virus dilutions and incubated with medium containing either agarose or methylcellulose. When the primary infected cell released progeny virus, their spread in the culture was restricted to the adjacent cells. As a result, each infectious particle produced a distinct area of infected cells – a plaque.
To enhance the contrast between the plaque and the surrounding monolayer, the cells were stained. The titer was expressed as plaque-forming units per ml (pfu/ml).
4.3.1 Immunoplaque test for BRSV
Vero cells were treated with Versen-Trypsin and seeded on 96-well micro-titer- plates (200.000 cells/ml). The cells were 80-100 % confluent at the time of infection.
Serial 10-fold dilutions (10-2-10-6) of the virus were prepared and 50 µl of each
dilution were added in duplicates to the cell monolayers. The cells were incubated with rocking for 3 hours at 37°C and 200 µl 0.9 % methylcellulose in DMEM with 2 % FCS was added to each well. The microtiter plates were incubated for 2 days at 37°C. After removal of the methylcellulose and two wash steps with PBS buffer, the cells were fixed with 3% paraformaldehyde for 20 min at room temperature. In order to inactivate the paraformaldehyde the cells were washed twice with PBS buffer containing 0.1 M glycine. After permeabilization with 0.2% Triton X-100 for 5 minutes, the cells were incubated for 90 min with the 18G6 antibody directed against the BRSV M protein. After two washing steps the cells were incubated for one hour with peroxidase conjugated IgG anti-mouse antibody. The infected cells were stained by incubating the cells for 10 min with AEC peroxidase-substrate. The plaques were counted under a light microscope.
4.4 Replication kinetics
Four hours before infection, Vero cells were treated with Versen-Trypsin and seeded on 6 well plates at a density of 0.5 x 106 cells per well. The cells were infected with recombinant BRSV at a multiplicity of infection of 0.1 pfu per cell. The cells were incubated with rocking for 3 hours at 37°C. Afterwards, the cells were washed three times with PBS and fresh medium was added. The plates were incubated at 37°C. From each well 0.4 ml samples were taken at 24, 48, 72, 96, 120 and 144 hours post infection, respectively, and frozen in liquid nitrogen in the presence of 10% MgSO4/HEPES. The virus samples were stored at –80°C. The virus titers were determined by immunoplaque test (see 4.3.1.)
4.5 Infection inhibition assay
Heparin from bovine intestinal mucosa, chondroitin sulfate A from bovine trachea, chondroitin sulfate B (dermatan sulfate) from porcine intestinal mucose, chondroitin sulfate C from shark cartilage, hyaluronic acid from bovine vitreous
humor and dextran sulfate were diluted in PBS. The different GAGs (final concentrations of 0.25, 2.5 and 250 µg/ml, respectively), were incubated with recombinant BRSV for 1.5 h at 37°C prior to addition to Vero cells seeded on 12 mm cover slips. Following incubation for 1.5 h at 37°C the infected cells were washed with PBS and covered with methylcellulose in DMEM containing 2 % FCS. Infected cells were detected at 72 hours post infection by fluorescence microscopy (see 4.8.3). The number of GFP expressing cells was determined. The ratio of infected cells in the presence of inhibitor to infected cells in the absence of inhibitor was calculated.
4.6 Transient transfection of mammalian cells
4.6.1 Transfection of BSR-T7/5 cells
BSR-T7/5 cells were transfected with pTM1 plasmids The day before transfection 2-3 x 105 cells per well were seeded in a volume of 2.5 ml of medium.
DNA (1 µg) was diluted in medium without serum. The respective transfection reagent was diluted into antibiotics and FCS free medium and incubated at room temperature. The diluted DNA and transfection reagent were mixed and further incubated at room temperature. The DNA-transfection reagent complex was added to the cells and incubated for 24-48 hours at 37°C.
4.6.2 Generation of recombinant BRSV
Transfection of BSR T7/5 cells was performed with SuperFect transfection reagent. The day before transfection 2-3 x 105 cells per well were seeded in a volume of 2.5 ml of EMEM medium. The cells were 60-80% confluent on the next day. At the day of transfection, 11 µg DNA 5 µg pBRSV containing respective modified BRSV genome (see 4.7.4), 2 µg pP, 2 µg pN, 1 µg pM2, 1 µg pL were diluted in cell growth medium (containing no serum, proteins or antibiotics) to a give a final volume of 300
µl to which 60 µl SuperFect transfection reagent were added. After following incubation for 10 min at room temperature, 2 ml medium with FCS was added to each DNA mix and one ml volume from the mixture was added to each well. After 3 hours incubation at rocking conditions the inoculum was removed from the cells and fresh medium containing serum and antibiotics was added. Transfected cells were split twice, and nine days post transfection viral replication was detected by GFP expression. The recombinant virus was released from the BSRT7/5 cells by freezing and thawing and clarified supernatant was used for propagation of the virus on Vero cells. Five days post infection the infected Vero cells were frozen and thawed and the cell supernatant containing recombinant virus was clarified and stored at –80 °C.
4.7 DNA recombination methods
4.7.1 Polymerase Chain Reaction
The polymerase chain reaction (PCR) was used to amplify segments of double-stranded DNA by a thermostable DNA polymerase (Taq DNA polymerase or Pfu DNA polymerase).
For a standard PCR the following reagents were mixed:
1. H2O 33 µl 2.enzyme buffer (10-fold concentration) 5 µl 3. dNTPs (10 mM) 1 µl 4. forward primer (10µM) 2.5 µl 5. reverse primer (10µM) 2.5 µl l 6. template DNA (20 ng/µl) 1-5 µl 7. Taq DNA polymerase (1-5 units/µl) 2 units
The standard reaction conditions for PCR were.
1 cycle 95°C 2 min denaturation
95°C 60 sec denaturation
10 cycles 56°C 30 sec annealing
72°C 70 sec polymerization
95°C 60 sec denaturation
15 cycles 54°C 30 sec annealing
72°C polymerization 0.5 min/1 kb (Taq) 2 min/1kb (Pfu)
1 cycle 72°C 7 min polymerization
The PCR products were analyzed by agarose-gel electrophoresis and subsequent staining with ethidium bromide.
4.7.2 Site-specific mutagenesis
Site-specific mutagenesis was used in this work to generate modified BRSV F proteins containing point mutations in the F2 subunit. Lysine and arginine residues in the putative heparin binding domain were exchanged by asparagine. Three PCR reactions with two primer pairs were used to create a site-specific mutation (Fig. 3).
One pair of primers (A and B) was used to amplify DNA that contains the mutation site together with upstream sequences. The second pair of primers (C and D) was used in a separate PCR to amplify DNA that contains the mutation(s) site together with downstream sequences. The mutation(s) of interest was located in the overlapping region of the amplified fragments. The fragments were mixed, denatured, annealed to each other, and incubated with Pfu polymerase to obtain a complete double strand cDNA. In a third PCR, this cDNA was amplified with two primers (A and D) that bind to the extreme ends of the fragments.
Figure 3. Scheme of the site-specific mutagenesis
Table 3 summarizes the primers used to generate the indicated mutations in the F2 subunit.
Mutation Primer B Primer C K63N 32 33 K66N 34 35 K75N 18 19 K77N 20 21 K80N 22 23 R85N 24 25 K63/66N 14 15 K75/77N 8 9 K75/77/80N 36 37 Table 3. Primer pairs used for site-specific mutagenesis
Denaturation-hybridization step
In order to join the 5´ and 3´ ends of the target gene the overlapping fragments were mixed, denatured, and annealed to generate heteroduplexes that were extended. In a PCR tube were mixed:
1. amplification product PCR 1 approx. 100 ng 2. amplification product PCR 2 approx. 100 ng
3. enzyme buffer (10x) 5 µl
4. dNTPs (10 mM) 1 µl
5. Pfu DNA polymerase 1 µl
6. H2O to 50 µl
Conditions
1 cycle 95°C 5 min denaturation
95°C 60 sec denaturation
cycles 2 60°C 60 sec annealing
72°C 2 min polymerization
1 cycle 72°C 7 min polymerization
4.7.3 Molecular Cloning
The following plasmid vectors were used for molecular cloning in this work:
pTM1, pCR3.1, pBluescript-BRSV (pBRSV) and pCR 2.1.
4.7.3.1 Cleavage of DNA with restriction enzymes
Restriction endonucleases are bacterial enzymes that recognize specific 4- to 8-bp sequences (restriction sites), and cleave both DNA strands at this site. In order to insert a foreign sequence in a plasmid vector both DNA molecules were treated with appropriate restriction enzymes. Different temperatures and incubation times were used in order to meet the particular reaction conditions. For digestion of plasmid DNA, 2-10 µg were used and the reaction was performed for 1-3 hours with 1-2 units of the respective enzyme. PCR fragments were treated with 2 units of enzyme for 16- 18 hours.
4.7.3.2 Recovery of DNA from agarose gels
DNA molecules cleaved with endonucleases were separated by agarose electrophoresis. A gel containing 0.8% agarose in TAE buffer was prepared. The DNA samples were mixed with gel-loading buffer and loaded into the slots of the gel as follows: in the first slot- a molecular DNA marker was added. The second received an aliquot of the sample, the third slot was left free, and into the next couple of slots
the remaining sample was applied. The electrophoresis was carried out at 80V for 1 hour. The first part of the gel containing the molecular marker and one slot with sample was carefully cut with a scalpel and stained with a solution of ethidium bromide for 5 min. The stained gel was illuminated with ultraviolet light and the regions of the gel containing the DNA fragments were marked. The corresponding region was cut from the unstained part of the gel and collected in tubes. The extraction of the DNA fragments was performed with the QIAquick gel extraction kit or the QIAex II gel extraction kit (Qiagen). DNA concentration was photometrically determined at 260 nm.
4.7.3.3 Ligation
The purified PCR fragment was ligated with the treated purified plasmid DNA under the following condition:
1. PCR DNA fragment 7-15 ng
2. vector DNA 1-5 ng
2. 10x ligase buffer 1-4 µl 3. Bacteriophage T4 DNA ligase 1-4 µl
4. H2O to 10-40 µl
A molar ratio of plasmid vector to PCR DNA fragment of 1:1 to 1:6 was used.
The ligation reaction was performed for 1 hour at room temperature or for 16-18 hours at 14°C.
4.7.3.4 Preparation of competent E. coli
Chemicompetent E. coli
E.coli XL-1Blue were used for preparation of chemically competent bacteria.
A single bacterial colony was picked from an agar plate and propagated in 50 ml of LB medium overnight at 37°C with vigorous agitation. The overnight culture was used to inoculate 1l of LB medium which was incubated for 3 hours at 37°C with agitation.
When the optical density at 600 nm reached 0.5 the bacterial cells were transferred to 50 ml centrifugation tubes and cooled on ice for 10 minutes. The cells were pelleted by centrifugation at 2800 g for 10 minutes at 4°C and resuspended in 12.5 ml ice-cold CaCl2 buffer. After centrifugation as above the cell pellet was resuspended in 2.5 ml of ice-cold CaCl2 buffer. The cell sediment was aliquoted and frozen in liquid nitrogen and stored at –80°C.
Electrocompetent bacteria
E.coli XL-1Blue were used for preparation of electrocompetent bacteria. A single colony of E. coli from a was picked from an agar plate and propagated in 50 ml of LB medium overnight at 37°C with vigorous agitation. The overnight culture was used to inoculate 1l of LB medium which was incubated at 37°C with agitation. When the OD600 of the culture reached 0.4, the flasks was transferred to an ice-water bath for 15 minutes. Bacteria were harvested by centrifugation for 15 minutes at 4°C. The cell pellet was resuspended in 1 l of ice-cold H2O and again subjected to centrifugation. The supernatant was decanted and the cells were resuspended in 500 ml of ice-cold 10% glycerol. The cells were sedimented by centrifugation and resuspended in 20 ml of ice-cold 10% glycerol, and again pelleted by centrifugation.
The pellet was resuspended in 2 ml of ice-cold 10 % glycerol. The cell sediment was aliquoted and frozen in liquid nitrogen and stored at –80°C.
4.7.3.5 Transformation of E. coli
Transformation of E. coli by electroporation
Electrocompetent cells were thawed on ice. Plasmid DNA in a volume of 1-2 µl was added (10 pg to 25 ng) to the bacteria. The electroporation apparatus was set to 25 µF capacitance, 2.5 kV voltage, and 200 Ohm resistance. The DNA/cell mixture was transferred into a pre-cooled electroporation cuvette. The dry cuvette was placed in the electroporation device and a pulse of electricity was delivered to the cells for 4- 5 milliseconds with a field strength of 12.5 kV/cm. After the pulse, the electroporation cuvette was removed and 1 ml of LB medium was added at room temperature. The cells were transferred to a polypropylene tube and the cultures were incubated for 1 hour at 37°C with rotation. A volume of 100 µl from the transfected bacteria were plated onto LB agar containing ampicillin (50µg/ml) and incubated for 16-18 hours at 37°C.
Heat-shock transformation of E. coli
Plasmid DNA (1-50ng) was added to 100 µl of chemicompetent E. coli and incubated on ice for 30 min. The bacteria were heated at 42 °C for 30 sec in a water bath. The tubes were rapidly transferred to an ice bath and cooled for 5 min. 250 µl SOC or LB medium was added and the cultures were incubated for 30-60 min at 37°C to allow the bacteria to recover and to express the antibiotic resistance marker encoded by the plasmid. 100 µl of the culture were plated onto LB agar medium containing ampicillin and incubated for 16-18 hours at 37°C.
4.7.3.6 Colony PCR
To test for the presence of recombinant plasmid, colonies of transfected E. coli were analyzed by PCR using appropriate primers. A PCR master mix was prepared of which each PCR tube received 15µl.
For each reaction the following reagents were used:
1. H2O 12.2 µl
3. dNTPs (10mM) 0.3 µl 4. forward primer (10 µM) 0.45 µl 5. reverse primer (10 µM) 0.45 µl 6. Taq DNA polymerase 5 units/µl 0.1 µl
A single E. coli was picked with a sterile pipette tip and dispersed first into the reaction mix and then into a 1.5 ml tube containing 250 Ml of LB-medium. The PCR reaction was performed under the following conditions:
1 cycle 95°C 2 min denaturation
95°C 15 sec denaturation 20 cycles 56°C (-0.2) 30 sec annealing
72°C 60 sec polymerization
1 cycle 72°C 5 min polymerization
The PCR products were run on an agarose gel. The cultures of two positive clones were used to inoculate 50 ml of LB medium.
4.7.3.7 Plasmid DNA preparation
The propagated bacteria were harvested by centrifugation for 15 min x 4500g at 4°C and plasmid DNA isolation was performed using QIAfilter Plasmid Midi Maxi Kits (Qiagen).
4.7.3.8 Sequencing
All plasmid DNA constructs were sequenced by MWG Biotech AG, in the
„Value read“ mode. The BCM Search launcher program was used for multiple sequence alignments.
4.7.4 Construction of plasmids containing modified BRSV genomes
The region spanning the complete G gene was deleted from the BRSV genome and replaced by the green fluorescence protein (GFP) open reading frame (BRSV-∆G/GFP). The replacement was accomplished by PCR amplifications using the pEGFP-N1 plasmid encoding the GFP gene and the pBRSV plasmid encoding the complete BRSV genome as templates. Figure 4 summarizes the different PCR reactions and primers used.
Figure 4. Scheme of the construction of the plasmid encoding modified BRSV GFP
G
PflMI BstEI
GFP
GFP 27
12
13
31 10
11
pBRSV plasmid encoding the complete BRSV genome was used as template for two PCR reaction using two primer pairs (12/27 and 13/31) (see table 2). Primers 12 and 13 contained 15 bp corresponding to the first and the last 15 bp of the GFP gene, respectively. pEGFP-N1 plasmid encoding the GFP gene was used as a template for PCR reaction wit primer pair 10/11. Both primers contained few bp from gene-start and gene-end sequence of G gene. The resulting three PCR products were denatured and hybridized in a common reaction (primers 27/31). The resulting PCR product contained GFP gene instead of G gene. Final amplification product as well as pBRSV plasmid were cleaved with PflMI and BstEI restriction endonucleases and ligated, resulting in pBRSV plasmid containing BRSV-∆G/GFP genome.
4.8 Methods for protein analysis
4.8.1 SDS-polyacrylamide gel electrophoresis
In this work, a standard SDS-polyacrylamide gel electrophoresis protocol was used (Laemmli, 1970). Gels were prepared in a small (50mm X 80mm X 0.75 mm) gel format. An acrylamide concentration of 10% was used for the separating gel. The protein samples were mixed with 2X sample SDS buffer, boiled for 3 minutes at 94
°C and loaded onto the slots.
4.8.2 Western Blotting (semi-dry blotting technique)
After electrophoresis, the stacking gel was cut off and the proteins in the separating gel were transferred to a nitrocellulose membrane using the semi-dry-blot method (Kyhse-Andersen, 1984). On the graphite anode plate of the electroblotter apparatus were placed in the following order:
1. 6 pieces of filter paper soaked in anode I buffer 2. 3 pieces of filter paper soaked in anode II buffer 3. nitrocellulose membrane
4. polyacrylamide gel
5. 9 pieces of filter paper soaked in cathode buffer.
The electroblotter was closed and the transfer was performed for 1 hour at 0.8 mA/cm2. Non-specific binding was blocked by soaking the membrane overnight at 4°C in blocking reagent. The nitrocellulose membrane was incubated for 1 hour at room temperature with primary antibody, and subsequently washed three times for 10 minutes each time with PBSM containing 0.1% Tween 20. A biotin-conjugated secondary antibody (diluted 1:1000) was added and incubated with the membrane for 1 hour followed by three washing steps with PBSM containing 0.1% Tween. The membrane was incubated with streptavidin-biotinylated horseradish peroxidase
with PBSM containing 0.1% Tween and one with PBSM the blot was incubated for 5 min with West Dura Substrate Solution and the proteins were visualized by chemiluminescence.
4.8.3 Immunofluorescence
Transfected or infected cells on 12 mm cover slips were washed two times with cold PBS and fixed for 20 min with 3 % paraformaldehyde. The cells were washed and incubated for 5 minutes with 0.1 M glycine. For detection of intracellular antigen the cells were permeabilized with 0.2% Triton X-100. The cells were incubated for one hour at room temperature with primary antibody. Following three washing steps, the cover-slips were incubated with FITC-conjugated secondary antibody at room temperature in the dark for 1 hour. After three washing steps with PBS and one with dH2O, the cover slips were analyzed with a Zeiss Axioplan 2 microscope.
4.8.4 Cell surface biotinylation and immunoprecipitation
Transient expression of the F protein was performed in BSR-T7/5 cells.
Twenty hours post transfection, the cells were rinsed with ice-cold PBS buffer. Cell surface proteins were labeled by incubating the cells with sulfo-NHS-biotin (Pierce) (0.5 mg/ml in PBS, 250µl per well) for 30 min at 4°C with agitation. The monolayers were washed with ice-cold PBS containing 0.1M glycine and incubated with the same buffer for 20 min at 4°C. The cells were lysed in 1 ml of NP-40 lysis buffer and insoluble material was removed by centrifugation (16,000 g for 30 min at 4°C). To 500 µl of each supernatant were added 50 µl of a 50% slurry of protein A-Sepharose and 2.5 µl of the RSV3216 monoclonal antibody, which is directed against the HRSV F protein. After agitation for 90 min at 4°C, the immunoprecipitates were collected by centrifugation (16,000 g for 3 min), washed three times with NP-40 lysis buffer, and eluted by boiling the beads in twofold-concentrated sodium dodecyl sulfate (SDS) sample buffer. The immunoprecipitates were separated on an SDS–10%
polyacrylamide gel under reducing conditions and transferred to nitrocellulose by the
semidry blotting technique. The membrane was incubated with blocking reagent overnight at 4°C, washed three times with PBS containing 0.1% Tween 20, and incubated with streptavidin-peroxidase (1:1000) for 1 h at room temperature. The nitrocellulose was washed as described above and incubated for 1 min with a chemiluminescent peroxidase substrate. The resulting light emission was detected with a super-cooled CCD camera (Chemi-Doc system, BioRad).
5 Results
5.1 Generation of recombinant BRSV
In 1994, Schnell and colleagues generated recombinant rabies virus (RV) and demonstrated for the first time that a negative-sense RNA virus can be produced from cloned cDNA. This approach has become a powerful tool for studying the function of individual viral proteins in the context of a virus infection. Recently, BRSV and RSV deletion mutants lacking individual genes have been generated using this system (Collins et al., 1995; Buchholz et al., 1999; Karger et al., 2001;
Techaarpornkul et al., 2001, 2002).
In this work BRSV mutants were generated by reverse genetics and used to analyze a cluster of basic amino acids in the F2 subunit of the fusion protein for interaction with cell-surface glycosaminoglycans.
5.1.1 Modification of BRSV using reverse genetics
In contrast to the RSV G protein for which a domain has been suggested to be responsible for the interaction with cell surface glycosaminoglycans (Feldman et al., 1999; Shields et al., 2003), data for the heparin-binding domain in the F protein are not available. In the present work the role of basic amino acids of a putative heparin- binding domain in the F protein was analyzed independently of the heparin-binding activity of the G protein. Therefore, a deletion mutant lacking the G gene was generated. The region spanning the complete G gene was deleted from the BRSV genome and replaced by the green fluorescence protein (GFP) open reading frame (BRSV-∆G/GFP) (Fig. 5). Furthermore, to assess the role of the G protein, several mutants were generated from BRSV retaining the G gene. Here, the GFP open reading frame was inserted as an additional transcription unit located upstream of the NS1 gene (Fig. 5). This virus which was designated BRSV-GFP, was provided by Wiebke Koehl. Both modified BRSV genomes were used as backbone genomes in
which point mutations were introduced into the putative heparin-binding domain in F2.
Figure 5. Scheme of the BRSV-∆G/GFP (A) and BRSV-GFP (B) genomes. Enlargements show the GFP gene insertion with the transcription-start signals shown as ovals and transcription–end signals represented by bars
NS1 NS2 N P M SH GFP F M2 L
3´
M SH F
GFP
BRSV-∆G/GFP
PflMI NheII
3´ GFP
NS1
BRSV-GFP GFP NS1 NS2 N P M SH G F M2 L
3´ 5´
5´
