• Keine Ergebnisse gefunden

Nostoc sp. PCC 7120 (J01540)Halorhodospira halophilaDSM 244

N/A
N/A
Info
Herunterladen
Protected

Academic year: 2022

Aktie "Nostoc sp. PCC 7120 (J01540)Halorhodospira halophilaDSM 244"

Copied!
2
0
0

Wird geladen.... (Jetzt Volltext ansehen)

Jetzt herunterladen ( 2 Seite )

Volltext

(1)

Nostoc sp. PCC 7120 (J01540)

Halorhodospira halophilaDSM 244T(EF199945) Ectothiorhodospira marismortuiDSM 4180T(EF199942)

Ectothiorhodospira shaposhnikoviiDSM 243T(AY450587) Ectothiorhodospira haloalkaliphilaBN 9903T(EF199941) Ectothiorhodospira variabilis WN22T(EU503123)

Ectothiorhodospira mobilis DSM 237T(EF199939)

Ectothiorhodospira vacuolataDSM 2111T(EF199940) Allochromatium vinosum ATCC 17899TrbcA(M26396) Ectothiorhodosinus mongolicusM9T(EF199947)

Halorhodospira halochlorisDSM 1059T(EF199944) Halorhodospira abdelmalekii DSM 2110T(EF199943) Allochromatium vinosumATCC 17899TrbcL(D90204) Thiorhodospira sibiricaA12T(EF199948) 0.05

100

93 92

92

79

79

100

Supplementary Fig. S1. Phylogenetic position of strain WN22T among members of the Ectothiorhodospiraceaebased on conceptual translations of cbbL. The tree was generated by the maximum-likelihood method. Bar, 5 amino acid substitutions per 100 positions. Numbers indicate percentages of bootstrap sampling, derived from 1000 replications. Unrooted phylogenetic trees were constructed using algorithms implemented in the TREECONWsoftware package (http://bioc- www.uia.ac.be/u/yvdp/treeconw.html)

Gorlenko, V. M., Bryantseva, I. A., Rabold, S., Tourova, T. P., Rubtsova, D., Smirnova, E., Thiel, V. & Imhoff, J. F. (2009).Ectothiorhodospira variabilissp. nov., an alkaliphilic and halophilic purple sulfur bacterium from soda lakes. Int J Syst Evol Microbiol 59, 658–664.

(2)

Nostocsp. PCC 7120 (AF012326)

Halorhodospira halophilaDSM 244T(EF199951)

Marichromatium purpuratum 95Car100a (AF059648) Thiorhodospira sibiricaA12T(EF202525)

Ectothiorhodospira vacuolataDSM 2111T(EF199955) Ectothiorhodospira mobilisDSM 237T(EF199954)

Ectothiorhodospira shaposhnikoviiDSM 243T(EF199953)

Ectothiorhodospira haloalkaliphilaBN 9903T(EF199956) Ectothiorhodospira variabilis WN22T(EU503124)

Halorhodospira abdelmalekii DSM 2110T(EF199952) Halorhodospira halochloris DSM 1059T(EF199950) 0.05

100

94 71

92 90

100

78

Supplementary Fig. S2. Phylogenetic position of strain WN22T among members of the Ectothiorhodospiraceae based on deduced amino acid sequences of nifH genes. The tree was constructed by the neighbour-joining algorithm with Nostocsp. PCC 7120 as the outgroup. Bar, 5 amino acid substitutions per 100 positions. Numbers indicate percentages of bootstrap sampling, derived from 1000 replications.

Gorlenko, V. M., Bryantseva, I. A., Rabold, S., Tourova, T. P., Rubtsova, D., Smirnova, E., Thiel, V. & Imhoff, J. F. (2009).Ectothiorhodospira variabilissp. nov., an alkaliphilic and halophilic purple sulfur bacterium from soda lakes. Int J Syst Evol Microbiol 59, 658–664.

Referenzen

Jetzt herunterladen ( PDF - 2 Seite - 20.32 KB )

ÄHNLICHE DOKUMENTE

Members of the Preprotein and Amino Acid Transporter Family Constitute Components of Novel Protein Import Pathways into Chloroplasts

Moreover, numerous noncanonical import pathways such as the import via the secretory pathway and the substrate-dependent import of the NADPH:protochlorophyllide oxidoreductase

Dataset 2.4 The whole sequences of the five candidate genes in Part 2.

ACGCGGGGACACTTCGAATTAGAACTCTAATAATGTATTTCGTAACTCCCGGTCTCATTTTTACGGTAATAGCACTTTGGTTGTTGTGGT

Members of the Examination Board

To test if a proper re-initiation of segmentation via a restored segmentation clock had occurred, I further analyzed the germband expression of the segment

Shaping the Phylogenetic Tree of Influenza by Cross-Immunity

For more realistic durations of cross-protection and larger values of ρ, cross-immunity alone cannot prevent branching events and suppression of the second mutant occurs only if

Phylogenetic Status of the Turkish Red Fox (Vulpes vulpes), based on Partial Sequences of the Mitochondrial Cytochrome b Gene

Based on three different data sets of the mitochon- drial Cyt b sequences (250 bp, 354 bp and 375 bp), net- work analyses suggested that the majority of Turkish red fox, including

The influence of Cytochrome C on the polycondensation of silicic acid

The interval between two measurements of the freezing point can be calculated as the time period be- tween passing 0 ◦ C and the end of the programmed reaction temperature: the

Based on the example of the city of Tartu

In conclusion, PB have been mushroomed around the world quite a lot as a social innovation which comes to serve for different purposes, for example, for local authorities, to gain

Regulation of Pseudomonas putida genes involved in the metabolism of acidic amino acids

The transporters consist of two integral membrane proteins (permeases), two peripheral membrane proteins that bind and hydrolyze ATP, and a periplasmic substrate-binding