Cloning and functional analysis of a novel aquaporin from Xenopus laevis oocytes

Vegetative Physiologie

der Medizinischen Hochschule Hannover

Cloning and Functional Analysis of a Novel Aquaporin from Xenopus laevis Oocytes

Dissertation

zur Erlangung des Doktorgrades der Medizin in der Medizinischen Hochschule Hannover

vorgelegt von Christina Franke aus Hannover

Hannover 2003

Angenommen vom Senat der Medizinischen Hochschule Hannover am 22.09.2003

Gedruckt mit Genehmigung der Medizinischen Hochschule Hannover

Rektor: Prof. Dr. Horst v. der Hardt Betreuer: Prof. Dr. Gerolf Gros

Referent: Prof. Dr. Ernst Ungewickell

Korreferent: Prof. ’ in Ursula Seidler

Tag der mündlichen Prüfung: 22.09.2003

Promotionsausschussmitglieder: Prof. Dr. Ing. Klaus Dieter Jürgens Prof. Dr. Thomas Brinker

Prof. Dr. Sigurd Lenzen

Tim

und meiner Familie

Table of contents

Table of contents 1

List of abbreviation 3

Abstract 4 1 Introduction 5

1.1 The Aquaporin family 5 1.1.1 Aquaporin structure 5

1.1.2 Functional characterization 8

1.1.3 Orthodox aquaporins 9

1.1.4 Aquaglyceroporins 10

1.2 The Xenopus laevis oocyte expression system 12

1.3 Aim of the study 14

2 Materials and methods 15

2.1 Materials 15

2.2 The animal 15

2.3 Surgery 16

2.4 Oocyte preparation 16

2.5 Cloning 17

2.6 Hydropathy analysis 19

2.7 Phosphorylation and glycosylation site scan 19

2.8 Northern-blotting 19

2.9 In vitro synthesis of RNA 20

2.10 Injecting Xenopus laevis oocytes with cRNA 20

2.11 Measurement of water permeability 21

2.12 Two-electrode voltage clamp 23

2.13 Urea and glycerol uptake 24

2.14 Antisense 25

2.15 Statistical analysis 25

3 Results 26

3.1 Sequence analysis 26

3.2 Northern-blot analysis 30

3.3 Water permeability 31

3.3.1 The effect of mercury on Pf 32

3.3.2 Time-course for mercury action 33

3.3.3 The effect of external pH on Pf 34

3.3.4 The combined effect of pH and mercury 35

3.3.5 Calcium and magnesium dependence 36

3.4 Two-electrode voltage clamp 37

3.5 Urea and glycerol uptake 40

3.6 Antisense 41

4 Discussion 42

4.1 The sequence 42

4.2 Urea and glycerol uptake 43

4.3 Mercury response 43

4.3.1 Water permeability 43

4.3.2 Two-electrode voltage clamp 45

4.4 pH-response 46

4.5 Calcium dependence 47

4.6 Antisense 48

4.7 Conclusion 49

5 Zusammenfassung 50

6 References 51

Lebenslauf 58

Erklärung nach § 2 Abs. 2 Nr. 5 und 6 PromO 60

Acknowledgments 61

List of abbreviations

AQP aquaporin

CA carbonic anhydrase

bp base pairs

CFTR cystic fibrosis transmembrane conductance regulator cAMP cyclic adenosine monophosphate

cGMP cyclic guanosine monophosphate CHES 2-N-hexylaminoethanesulfonic acid cpm counts per minute

cRNA complementary ribonucleic acid DG 1,2-diacyglycerol

EST expressed sequence tag

HEPES N-[2-hydroxyethyl]piperazine-N’-[2-ethanesulfonic] acid IP₃ inositol-1,4,5-triphosphate

IPTG isopropyl bD-thiogalactoside kb kilo base pair

MES 2-[N-morpholino]ethanesulfonic acid MIP major intrinsic protein (now called AQP0) MOPS 3-[N-morpholino]propanosulfonic acid mRNA messenger ribonucleic acid

ORF open reading frame

PCR polymerase chain reaction PIP₂ phosphoinositide

PKC protein kinase C RNA ribonucleic acid SDS sodium dodecyl sulfate SEM standard error of the mean SSC NaCl-Na citrate solution

TBE tris-(hydroxymethyl)-aminomethane, borate, ethylenediamino- N,N,N´,N´-tetraacetic acid

TS transmembrane segments UTR untranslated region (of a gene)

One and three letter abbreviations of amino acids follow the one and three letter symbols of the VOET, biochemistry (Voet, 1995).

Abstract

A partial clone with homology to known AQPs was found in a Xenopus laevis oocyte EST database (GenBank accession numbers AW200125 and AW199121) .

The full-length sequence was obtained from both a Xenopus laevis oocyte library and from total tissue RNA by PCR. Both sequences contain an 894-bp open reading frame encoding 297 amino acids. The clone, called AQPxl, showed 49% identity to mammalian and amphibian AQP3, 41% identity to human AQP7, 45% identity to human AQP9, and 19%

identity to human AQP1.

Northern-blot analysis revealed a ~1.4 kb transcript in Xenopus laevis fatbody, oocytes and kidney. This expression pattern has the highest degree of similarity to that of mammalian AQP7.

We injected in vitro transcribed cRNA from the clone obtained from the Xenopus laevis oocyte library into Xenopus laevis oocytes for functional analysis.

AQPxl-expressing oocytes showed a 6-fold increase in water permeability (P_f) and a 4-fold increase in urea and glycerol permeability compared to controls at pH 7.5.

P_f of AQPxl showed a biphasic response to external pH with minimal water permeability at pH 5-7.5 and maximal water permeability at pH 9.5.

The effect of HgCl2 on Pf was complex: Low mercury concentrations (1 µM) markedly reduced Pf of AQPxl-expressing oocytes, whereas high concentrations (300 to 1000 µM) increased Pf. At alkaline pH, the fractional inhibition by 1 µM HgCl2 was halved.

The channel exhibited a mercury (0.1 mM) induced ion conductance with a reversal potential of –30 mV. Ion substitution experiments suggested that the mercury-induced current was mainly carried by chloride ions.

Injecting oocytes with antisense oligonucleotides for AQPxl reduced endogenous urea permeability, indicating that AQPxl is expressed in the plasma membrane of the native oocyte.

AQPxl is the first endogenous aquaporin to be cloned from Xenopus laevis oocytes. Sequence similarities strongly suggest AQPxl to be a member of the aquaglyceroporins. However, it is not clear, whether AQPxl represents an anuran AQP3, 7 or 9 orthologue, or whether it is a novel aquaglyceroporin.

1 I

1 Introduction

1.1 The Aquaporin family

Water is a major component of all living cells. The ability to regulate water uptake and release is an important property of cell membranes. For many years, it had been known that water pores must exist (Solomon, 1968) before water channel function for AQP1 was first demonstrated in 1992 (Preston et al., 1992). A part of the basis for this hypothesis was that water diffusion through pure lipid bilayers has a high activation energy (Ea>10 kcal/mol), which could not explain the rapid water flow through the membrane of red blood cells with the low activation energy of E_a<5 kcal/mol (Solomon, 1968).

Many aquaporins have subsequently been identified (Borgnia et al., 1999). With the recent discovery of AQP10 (Hatakeyama et al., 2001), the number of known aquaporins in mammals has been extended to eleven. More than 23 different aquaporins have been identified in plants (Borgnia et al., 1999). AQPz and GlpF represent two distinct subgroups of the aquaporin family in bacteria. An AQP1 homologue is known in fungi (Borgnia et al., 1999, Unger, 2000, Bonhivers et al., 1998).

1.1.1 Aquaporin structure

Based on hydropathy analysis, aquaporins have been suggested to consist of six transmembrane spanning domains and five connecting loops as shown in figure 1 (Wistow et al., 1991). Biochemical studies and immunoelectron microscopy demonstrated that both the N and C termini are located in the cytoplasm (Nielsen et al., 1993, Smith and Agre, 1991, Zeidel et al., 1994). Studies of human AQP1 (hAQP1) purified in Triton X-100 indicated that AQP1 monomers assemble as tetramers in bilayers. Several studies have shown that each monomer is a functional channel (Preston and Agre, 1991, Zhang et al., 1993).

1 I

NH_{2 COOH}

A

B C

D E

intracellular extracellular

cell membrane

1 2 3 4 5 6

NPA

NPA

NH_{2 COOH}

A

B C

D E

intracellular extracellular

cell membrane

1 2 3 4 5 6

NPA NPA

NPA NPA

a.

NH₂ COOH

intracellular extracellular

cell membrane

NPA NPA

1

2 3

4

6 5

A

B

C

D E

2

NH₂ COOH

intracellular extracellular

cell membrane

NPA NPA NPA NPA

1

2 3

4

6 5

A

B

C

D E

2

b.

Figure 1. Aquaporin structure.

a. Membrane topology model of an aquaporin water channel. Long C and E loops are specific for aquaglyceroporins. The conserved NPA-motif is indicated in loops B and E.

b. Hourglass model of human aquaporin-1 (hAQP1). Each hAQP1 subunit consists of two symmetrical structures, transmembrane segments (TS) 1-3 and TS 4-6. The NPA motifs of loop B and E participate in forming the aqueous channel (Borgnia et al., 1999).

1 I

This hypothesis has been supported by other groups using crystallography (Ren et al., 2000), (Walz et al., 1997). The six transmembrane spanning helices (TM) are divided into two three- helix bundles (TS1-3 and TS4-6). Each of these bundles contains the highly conserved tripeptide, Asn-Pro-Ala (NPA), in loops B and E, respectively (see fig.1).

It is well known that the aquaporin family consists of different subgroups with respect to structure and function. The aquaporins are closely related to the glycerol facilitator GlpF of Escherichia coli (Engel et al., 2000). Comparison of GlpF to hAQP1 revealed important differences in the pore-lining loops B and E, which might explain why AQP1 is a restricted water transporter while GlpF is permeated by glycerol (Unger, 2000).

It is easy to imagine that larger solutes are excluded simply by the small size of the pore. But why AQP1 is selectively permeable to water and excludes proton exchange (Murata et al., 2000), which usually takes place freely along water columns, is difficult to explain. Murata et al. propose that water molecules form a single file column due to the narrowness of the pore.

They are aligned perpendicular to the channel axis, which is induced by the helix dipoles.

Thereby, hydrogen bonds to the neighboring water molecules are broken and replaced by new hydrogen bonds formed with amide groups (possibly Asn in the NPA-motifs). This interaction does not allow protons to pass the pore.

In GlpF, the initial discrimination of a single glycerol molecule from other solutes is due to the binding of two aromatic side chains (Trp 48 and Phe 200) to the carbon backbone of the glycerol molecule, and the formation of hydrogen bonds between Arg 206 with glycerol hydroxyl groups. Because the channel walls are hydrophobic, water would have to pass as bulk water. But this is energetically prohibitive as the small channel diameter does not conduct bulk water (Unger, 2000).

1 I

1.1.2 Functional characterization

Mercury is a known inhibitor of several aquaporins, with the notable exceptions of AQP0 and AQP4 (Chandy et al., 1997, Kuwahara et al., 1997), whereas the water permeability of AQP6 is increased by mercury (Yasui et al., 1999). Because cysteines can react with Hg²⁺ (Preston et al., 1993), the differences in sensitivity to mercurials can be explained by the variations of the position of cysteine residues in the proteins. Ion conductance has been reported for AQP0 (MIP), AQP1, AQP6 and the plant AQP nodulin 26 (NOD26) (Rivers et al., 1997). Yool et al.

first described stimulation of water and cation permeability in hAQP1 by forskolin (Yool et al., 1996), which has later also been referred to as cGMP-gating (Anthony et al., 2000).

Others disagree (Agre et al., 1997). Lately, Yasui et al. described chloride conductance in rAQP6-expressing oocytes induced by HgCl₂ (Yasui et al., 1999). NOD26, reconstituted into proteoliposomes, exhibits low single channel ion-conductance (Dean et al., 1999).

pH-dependence has been shown for three mammalian AQPs to date (Nemeth-Cahalan and Hall, 2000, Yasui et al., 1999, Zeuthen and Klaerke, 1999). Water permeability of AQP0 is activated by a factor of 3.4 at pH 6.5, as compared to pH 7.5. P_f of hAQP3 is abolished at pH<6.2 (Zeuthen and Klaerke, 1999), whereas the channel is still permeable to glycerol in the pH range of 5.8-6.2. In rAQP6, the permeability to water and Cl^- is increased at pH<5.5 (Yasui et al., 1999).

The effect of calcium on AQP0 has been investigated by Nemeth-Cahalan et al. (2000).

Lowering the concentration of calcium increased the water permeability of AQP0. This effect is abolished when the histidine residue at position 40 is mutated.

Glycosylation with a polylactosaminyl oligosaccharide has been reported for hAQP1 (van Hoek et al., 1995). However, the functional significance of this glycosylation is unclear.

Subsequent studies showed that glycosylation does not play an important role for aquaporin function and membrane targeting (van Hoek et al., 1995, Baumgarten et al., 1998).

The effect of AQP phosphorylation has been studied in AQP0, AQP2 and AQP4 (Han et al., 1998, Nakahama et al., 1999). All AQPs except AQP7 have protein kinase C consensus sites, and AQP2, 5 and 6 have PKA/PKG (protein kinase A/G) consensus sites.

It is known that cAMP dependent phosphorylation increases the water permeability of the

1 I

tretramer is required for AQP2 steady state localization in the apical membrane of renal principal cells (Kamsteeg et al., 2000).

In AQP4, PKC activators such as phorbol 12,13 dibutyrate and phorbol 12-myristate 13- acetate increase protein phosphorylation and reduce the rate of swelling of AQP4-expressing oocytes in a dose-dependent manner (Han et al., 1998). In cultured rat astrocytes, 12-O- tetradecanoylphorbol 13-acetate (TPA), an activator of PKC, caused a time- and dose- dependent decrease in AQP4 mRNA (Nakahama et al., 1999). The same effect of TPA was observed in AQP9-expressing cultured rat astrocytes (Yamamoto et al., 2001).

1.1.3 Orthodox aquaporins

The aquaporin family can be divided into two major subgroups, based on function and sequence similarity (Borgnia et al., 1999). The first set contains AQPs that are predominantly permeable to water and includes AQP0 (MIP), 1, 2, 4, 5, 6 and probably 8. It is called the orthodox set (Borgnia et al., 1999).

AQP0 is exclusively expressed in lens fiber cells (Chandy et al., 1997). Compared to AQP1, the water permeability of AQP0 is 40-fold lower(Chandy et al., 1997). AQP0 is expressed to very high levels, but its role in lens physiology remains unclear. AQP0 is essential for the normal functioning of the lens, since mutations in AQP0 are associated with congenital cataracts (Shiels and Bassnett, 1996).

AQP1 is abundantly expressed in red blood cells, proximal convoluted tubuli and the descending thin limbs of kidney (both in apical and basolateral membranes; Denker et al., 1988), capillary endothelia (King et al., 2000), peribronchiolar capillary endothelia (King et al., 2000), the choroids plexus (site of fluid secretion), multiple tissues of the eye (Hasegawa et al., 1994) and hepatobiliary endothelium (Borgnia et al., 1999).

AQP2 is the vasopressin-regulated water channel of apical membranes of the renal collecting duct (Fushimi et al., 1993). Vasopressin mediates short-term exocytosis of the channel to the plasma membrane. In response to vasopressin, vesicles containing AQP2 are moved to the apical membranes of the collecting duct. When levels of vasopressin are inadequate, AQP2 remains in the intracellular vesicles, which leads to Diabetes insipidus (Borgnia et al., 1999).

Nephrogenic Diabetes insipidus is caused by mutations either in the gene coding for the vasopressin receptor or in AQP2 itself (Mulders et al., 1998).

1 I

AQP4 has been shown to be expressed in brain. It is located at the perivascular margin of astroglial and in ependymal cells (Hasegawa et al., 1994, Jung et al., 1994), where hypoxia decreases its expression (Yamamoto et al., 2001). AQP4 is also expressed in the retina, the optical nerve and the inner ear (Li and Verkman, 2001). Lately, expression of AQP4 has also been demonstrated in rat skeletal muscle (Frigeri et al., 1998).

Expression of AQP5 has been shown in apical membranes of salivary and lachrymal glands and type 1 alveolar pneumocytes (Nielsen et al., 1997). It participates in the regulation of the humidification of the airway and saliva and tear release. In the central nervous system, a transcript of AQP5 has been detected in neurons, where it has been implicated in the formation of intracranial edema after ischemia injury (Yamamoto et al., 2001).

AQP6 has a low water permeability at neutral pH, but it is markedly increased at very acidic pH. It is thought that AQP6 participates in acid secretion, as it is localized in intracellular vesicles of acid-secreting α-intercalated cells of the renal collecting duct (Yasui et al., 1999).

AQP8 is expressed in several tissues, namely testis, pancreas liver, colon and salivary glands.

The discrepancy that some groups found the channel to be permeable to water only (Koyama et al., 1998, Ishibashi et al., 1997), whereas other groups report also urea permeability, has not been solved yet. Lately, transcripts of AQP8 have been detected in neurons and oligodendrocytes (Yamamoto et al., 2001).

1.1.4 Aquaglyceroporins

The second set of aquaporins comprises AQP3, 7, 9 and 10. These AQPs are characterized by being not only permeable to water, but also to small uncharged solutes, e.g. glycerol and urea.

Therefore, these channels are also called aquaglyceroporins or the cocktail-set (Borgnia et al., 1999).

AQP3 is located in kidney (basolateral membranes of the collecting duct), in the airways, nasopharyngeal epithelium, red blood cells, salivary glands and neurons (Gresz et al., 2001, Borgnia et al., 1999, Roudier et al., 1998, Yamamoto et al., 2001). It has been reported to be permeable to water, urea and glycerol (Borgnia et al., 1999). AQP3 participates in water uptake (kidney) and mucosal secretion (airways, salivary glands). Also, a role in allergic

1 I

The function of AQP7 has not been studied in great detail yet. Rat AQP7 (rAQP7) is expressed in testis, spermatids and seminiferous tubules and the apical membranes of the proximal convoluted and straight tubules in kidney (Ishibashi et al., 1997, Nejsum et al., 2000). Another AQP, referred to as AQPap (adipose) and first called AQP8 and AQP9 (Kuriyama et al., 1997), was cloned from adipose tissue. It is thought to represent the human homologue of AQP7 or an alternatively spliced variant of AQP7 (Borgnia et al., 1999). It is also expressed in kidney and skeletal muscle. AQP7 is permeable to water, urea and glycerol.

In fat tissue, it is thought to facilitate glycerol release. In a study by Kishida et al. (2000), fasted mice showed a higher level of AQPap mRNA in adipocytes (in accordance with higher glycerol blood levels) than refeeded animals.

AQP9 is permeable to a large variety of neutral solutes, such as water, urea, glycerol, polyols, carbamides, purins and pyrimidines (Elkjaer et al., 2000, Tsukaguchi, Hiroyasu et al., 1998).

It is expressed in liver, peripheral leucocytes and tissues that accumulate leucocytes (lung, spleen, bone marrow) and astrocytes (Yamamoto et al., 2001).

Recently, a novel AQP named AQP10 has been cloned, which shows high sequence similarity to aquaglyceroporins (Hatakeyama et al., 2001). However, when expressed in Xenopus laevis oocytes, it increases osmotic water permeability in a mercurial-sensitive manner, but it does not appear to let urea or glycerol pass. AQP10 is predominantly expressed in small intestine.

1 I

1.2 The Xenopus laevis oocyte expression system

The Xenopus laevis oocyte expression system has been introduced as a means to study various aspects of gene expression as well as functional and structural analysis of numerous exogenous channels and receptors (Gurdon et al., 1971). Injecting mRNA into the cytoplasm leads more often than not to functional protein expression by the oocyte. The first proteins expressed were globin, interferon and viral proteins, which were followed later by nicotinic acetylcholine receptors (Barnard et al., 1982).

Xenopus laevis oocytes are egg precursors, which are arrested in the first meiotic cell cycle between the last part of the interphasis (G2) and the start of the meiosis (Smith, 1991). They contain all components required for protein synthesis during early embryogenesis, maternal mRNAs, ribosomes and tRNAs (Smith, 1991). A mature animal contains 10-20,000 oocytes at all stages of growth. The oocytes are stored in the ovaries of the animal and occupy a large part of the abdominal cavity, from where they can be surgically removed (Smith, 1991).

Dumond has classified the different stages of oocyte maturation into stages I-VI, mainly based on their different sizes (Dumont, 1972). Stage VI represents the largest and most mature stage with a diameter of about 1-1.2 mm. Stage V and VI oocytes are most frequently used in electrophysiological experiments.

The oocyte is divided into two halves, a light-colored vegetal pole and a dark-colored animal pole. The nucleus is located in the animal pole. The oocyte is surrounded by a vitelline membrane consisting of glycoproteins, which helps the oocytes to maintain a spherical shape.

As devitellinized oocytes become very fragile, the vitelline membrane need not be removed for oocyte RNA injection, water permeability measurements and two-electrode voltage clamp (Smith, 1991). Another layer consisting of follicle cells surrounds the vitelline membrane. It is usually removed by collagenase treatment or manually before experimentation.

1 I

Xenopus laevis oocytes are hardy cells and are very suitable for studies of exogenous proteins (Weber, 1999, Goldin, 1991). Usually, exogenous proteins are translated with ease in the oocyte. The level of cRNA expression can often be increased if the exogenous cRNA insertion site is flanked by Xenopus β-globin 5’ and 3’ untranslated mRNA regions, which enhances stability and translatability in the oocyte.

Nevertheless, working with the oocyte expression system is not without problems. For example, the oocyte expresses several endogenous channels and transporters, and the expression of exogenous proteins can increase the expression of native protein in the cell membrane. Another considerable problem is the batch-to-batch variation of oocytes in the level of native expression. This can explain why groups in different labs fail to repeat, what others succeed to show, e.g. cGMP-dependent cation conductance in hAQP1 (Agre et al., 1997).

1 I

1.3 Aim of the study

Searching the Genbank for Xenopus laevis oocyte aquaporins revealed a sequence in an EST database (accession number BE506343) with homology to known AQPs. Several attempts to buy this clone were not successful. This raised the following questions:

1. Can the sequence be cloned from a Xenopus laevis oocyte library or total RNA from Xenopus laevis tissue?

2. Which are the functional properties of the channel?

3. How can the channel be classified compared to known aquaporins? Does it represent a new aquaporin paralogue, or is it an orthologue of a known mammalian AQP?

2 M

M

2 Materials and methods

2.1 Materials

Chemicals were bought from Sigma (USA) unless stated otherwise.

2.2 The animal

Xenopus (meaning “strange foot”) laevis is one species among 14 in the Xenopus genus. They are clawed aquatic frogs, which are found in veldt (grassland) ponds and lakes in arid and semi-arid regions across southern Africa. Although never leaving the water under normal circumstances, they have well developed lungs. They are robust animals and very resistant to diseases (Information available from the Internet from http://www.sonic.net/

~melissk/xenopus/html). Xenopus laevis were purchased from Xenopus Express (USA) or Nasco (USA).

The frogs were housed in the veterinarian animal facility of the Yale University school of Medicine (USA) in tanks containing 200 mosm/kg salt solution.

2 M

M

2.3 Surgery

The animal was anesthetized with a 1% tricane solution. The surgery was performed on ice under semi-sterile conditions. First, the animal’s skin was rinsed with pencillin/streptomycin.

A celiotomy, 0.5 to 1 cm long and approximately 2 cm above to and parallel with the crease formed by the hind limb of the frog, gave access to the pleuroperitonial cavity. The oocytes were carefully pulled out of the abdomen and placed into calcium-free ND96 (NaCl 99.6 mM, KCl 2 mM, MgCl₂ 1 mM, HEPES 5 mM, pH 7.5, osmolality 200 mosm/kg). Sutures of the abdominal wall and skin were performed using gut (5/0) and silk (6/0), respectively. The frog was monitored in a recovery bath (200 mosm/kg NaCl) for 2 to 4 hours, before it was taken back to the animal facility.

2.4 Oocyte preparation

The oocyte sacks were opened and all lobules cut into pieces of approximately 0.5 cm³ for better separation. Several stages of washing were carried out in a 50 ml Corning tube, which was placed on a vertical rotator. After rotating for 15 min, the calcium-free ND96 solution was poured off and replaced by 30 ml fresh calcium-free ND96. This procedure is repeated five times.

In order to defolliculate oocytes, the oocytes were twice subjected to rotation for 15 to 20 min in calcium-free ND96 containing 2 mg/ml collagenase type Ia. Between these treatments the oocytes were rotated with calcium-free solution for 15 min. Afterwards, the oocytes were rinsed with several changes (3-4) of calcium-free ND96 and rotated for 15 min. As a final step, the oocytes were washed with normal (Ca-containig) ND96 solution and placed on the rotator for 15 min.

The oocytes were transferred to a petri dish containing OR3 (GIBCO L15 Leibovitz’s Medium, GIBCO BRL, Life Technologies Inc, USA) and selected for size, stage and damage.

The oocytes were stored in six-well dishes in OR3 media at a temperature of 15-20°C.

2 M

M

2.5 Cloning

An initial partial clone of Xenopus laevis oocytes was obtained from EST database (accession numbers AW200125 and AW199121). Total RNA from Xenopus oocytes was prepared using RNeasy kit (Quiagen, USA) according to the manufacturer's instructions. We then performed reverse-transcription (Superscript II, GIBCO BRL, Life Technologies Inc, USA). Using this cDNA as a template primers complementary to the EST sequence were designed. All primers were synthesized at Keck Biotechnology Resource Laboratory, Boyer Center for Molecular Medicine, Yale University, USA. The PCR was carried out at a denaturating temperature of 94 °C, annealing t of 56°C and extension t at 68°C. Diagnostic cuts with EcoR1 (New England Biolabs, USA) showed bands of the right size in a 1% agarose gel (1g agarose per 100ml TBE buffer) stained with ethidium bromide. The gel was run at 100V and inspected under UV-light.

The initial fragment was subcloned into a PCR 2.1 TOPO-vector (Invitrogen, Carlsbad, CA, USA) and the construct was amplified in chemically competent TOP 10 F´ bacteria (Invitrogen, USA). The vector encodes for both ampicillin and kanamycin resistance, and contains the lac operon which enables blue/white screening for inserts. TOP 10F´ cells overexpress the lac repressor and require IPTG as an inductor.

80µl of bacteria solution were plated on an LB agar plate containing ampicillin (100µg/ml), and onto which 25 µl of the substrate X-gal (40mg/ml) and 25µl IPTG (0.5M) were spread.

White bacteria colonies were picked the following day and grown at 37°C over night in 1.5ml LB media containing ampicillin (100µg/ml). Plasmid DNA was isolated from the bacteria using a QIAprep Spin Miniprep kit. A diagnostic digest was done with the restriction enzyme EcoR1 (New England Biolabs, USA). Plasmids containing the right size insert were sent for sequencing. All sequencing was performed by the Keck Biotechnology Resource Laboratory (Boyer Center for Molecular Medicine, Yale University, USA).

The homology of the clone to parts of the EST database sequence was confirmed by sequence analysis using the following programs of the Lasergene program suite (DNASTAR, USA):

EditSequence, SequenceManager and Megalign.

At this point, we started working on two different approaches in order to obtain the full-length sequence: For the first one, the initial fragment was extended in 5’and 3’direction using a Xenopus laevis oocyte library (Clontech, USA) as a template. For extension in 3’ direction, an antisense primer 5'- AGTGAATTGTAATACGACTCACTATAGGG -3' complimentary to

2 M

M

the vector next to the 3’ end of the insert and the gene-specific sense primer 5'- TTACCCAATAACCTCCAGTCTC-3' were used. For extension in the 5' direction the gene- specific antisense primer 5'-AAGGTCACGAGTCCATTTGA -3' and the sense primer 5'- ACGCCAAGCTCCGAGATCTGGACGAGC-3' complimentary to the vector next to the 5’

UTR of the insert were used . The PCR was carried out at a denaturating temperature of 95

°C, annealing t of 55°C and extension t at 72°C. Nested reactions for the 3' and 5' extensions were carried out using the same vector primers as above. For extension in the 3' direction, we used the gene-specific primer 5'-GGCTGCGGTTCTGTGGC-3', which is complementary to a region just 3' of the annealing site of the primer used in the first reaction. For extension in the 5' direction, we used the gene-specific primer 5'-CTGCCGTGGCAATCACC-3', which is complementary to a region just 5' of the annealing site of the primer used in the first reaction.

The PCR was carried out as above, except annealing temperature was 58 °C.

For the second approach 3’ RACE (GIBCO BRL, USA) was used. Nested PCRs as described above for the 3' extension were performed, except that an oligo-dT primer complimentary to the poly-A tail of native mRNA was used as an antisense primer. As a template we used reverse-transcribed cDNA from oocytes.

Both approaches were successful, and we obtained cDNA sequence that reached into the 5' and 3' UTRs. Using the novel sequence data, PCR primers to obtain the full-length sequence were designed .

Using the library as a template, we performed PCR using sense primer 5'- CACTCGAGAAATATCCCTCTTCATTACAGGC-3' and antisense primer 5'- TACTAGTGCCAATCAAGAAGCAGATTCCC-3'. The underlined sequence corresponds to the engineered Xho1 and Spe1 restriction enzyme sites. These primers are complimentary to the 3´- and 5´- UTR. The PCR (annealing temperature 59 °C) products were subcloned as before. 5 independent clones were sequenced in both directions, from which a consensus sequence was obtained. Using BLAST search on nucleotide and protein databases in the GenBank, we confirmed that the sequence was novel and showed homology to AQPs. We have provisionally named the novel clone AQPxl.

Using the same primers as above the full-length sequence from cDNA that was derived from the total oocyte RNA was also obtained. The sequence was similar to the one obtained from the library, with the exception of three nucleotide changes.

2 M

M

2.6 Phosphorylation and glycosylation site scan

The AQPxl sequence was scanned against the WWW-server of the Bioinformatics Group of the ISREC (Swiss Institute for Experimental Cancer Research) in order to identify possible glycosylation and phosphorylation sites.

2.7 Hydropathy analysis

The hydropathy analysis of AQPxl was performed after the Kyte-Doolittle approach (Kyte and Doolittle, 1982) using the WinPep program (Hennig, 1999; available from the Internet from http://www.biologie.uni-freiburg.de/data/schaefer/lhennig/winpep.html).

2.8 Northern-blotting

Total RNA from fatbody, oocyte, lung, skin, muscle, kidney, stomach, urinary bladder, intestine, heart and gall bladder were extracted from an adult Xenopus laevis using Trizol reagent (GIBCO-BRL, USA). After phenol-chloroform extraction all samples were dissolved in 100µl water and treated with 3µl RNAse free DNAse. The RNA was further purified using an RNeasy kit. Total RNA from brain and liver were extracted and treated with the RNeasy kit only. The total RNA (10 µg, less in case of brain, heart and gall bladder) was resolved by formaldehyde agarose (1%) denaturing gels (0.45g agarose, 28ml H2O, 9.3ml MOPS buffer, 37% formaldehyde) and blotted to a positively charged nylon membrane (Hybond XL, USA) by capillary elution. The blots were prehybridized by incubation in an ExpressHyb hybridization solution (Clontech Laboratories, Inc., USA) containing fish sperm DNA (100µg/ml) at 65 °C for 30 min. The blots were hybridized in fresh ExpressHyb with an [α-

32P]-labeled probe (Random Primer labeling kit, GIBCO-BRL, USA). As a probe, we used a gel purified PCR product (25ng DNA) corresponding to the full length AQPxl sequence. Two washes with 2x SSC and 0.1% SDS for 15min. at room temperature and two washes with 0.1x SSC and 0.1% SDS for 30min. at 55°C followed.

In order to keep the blots moist, we wrapped them with saran wrap and exposed them to X- ray film (Kodak) at –70°C for 2 hours.

2 M

M

2.9 In vitro synthesis of RNA

The AQPxl fragment was excised from the PCR 2.1 TOPO-vector using the restriction enzymes XhoI and SpeI (New England Biolabs, USA), and subcloned into a KSM oocyte expression vector. The vector is a derivative of pBluescript, in which the insertion site is flanked by the 5’ and 3’ UTRs of Xenopus β globin. The expression vector was a kind gift of Dr. William Joiner (Yale University, New Haven, USA). The plasmid was linearized using Xba1 (New England Biolabs, USA) and purified using phenol-chloroform extraction. Capped complementary RNA (cRNA) was transcribed in vitro using the T3 Message Machine kit (Ambion, USA). The resulting cRNA was purified by phenol chloroform extraction and quantitated. We verified the integrity of the cRNA by an agarose gel electrophoresis and visualization under UV light.

2.10 Injecting Xenopus laevis oocytes with cRNA

Oocytes were injected either with 50nl of 0.25 µg/µl cRNA encoding AQPxl or the same volume of sterile water one day after the isolation from the frog. In order to express positive controls, oocytes were injected with 50nl of 0.05 µg/µl cRNA for human AQP1 (hAQP1) or 0.20 µg/µl cRNA for rat AQP3 (rAQP3). The cDNA of hAQP1 (in the Xenopus expression vector pXβG) was a kind gift from Dr. Peter Agre (Johns Hopkins University, Baltimore, MD) and rAQP3 (in pSPORT) was a gift from Dr. Lawrence Palmer (Cornell University, New York, NY, USA). A simple and efficient test of whether oocytes were functionally expressing AQPs was conducted as follows: An oocyte was placed in deionized water. We monitored the time elapsing until rupture. The rupture time of oocytes expressing hAQP1 was typically less than one minute, whereas uninjected oocytes usually take more than an hour to rupture.The rupture time of oocytes functionally expressing other AQPs was to lay in between these two extremes.

.

2 M

M

2.11 Measurement of water permeability

The osmotic water permeability (Pf ) of oocytes injected with different cRNAs or water was measured with a volumetric assay.

A single oocyte is placed in a perfusion chamber, which is initially perfused with isotonic ND96 solution (NaCl 96 mM, KCl 2 mM, MgCl₂ 1 mM, CaCl₂ 1.8 mM, HEPES 5 mM, pH 7.5, osmolality 200 mosm/kg) at a solution flow of 4 ml min^-1. We induced cell swelling by switching to a hypotonic solution of 100mosm/kg (NaCl 40 mM, KCl 2 mM, MgCl₂ 1 mM, CaCl₂ 1.8 mM, HEPES 5 mM, pH 7.5). Osmolalities were measured using a vapor pressure osmometer (Wescor, Inc. Logan, USA).

Images as seen in fig.2 were acquired every two seconds using a video camera attached to a Stemi SV 6 stereomicroscope (Zeiss, Germany). The perfusion chamber was illuminated from below. A region of interest (ROI) was drawn around the cell. We used computer software (Optimas, USA) to differentiate between the area, which represented the oocyte, from the area around the oocyte within the ROI. Pixels below a certain intensity threshold were set to represent the oocyte and were used to calculate the cross-sectional area. In order to calculate oocyte volume from the area measurement, the cell was assumed to be a perfect sphere. A brass ball of known volume was placed near the oocyte and another ROI drawn around it. The brass ball served as a volume standard.

Figure 2. Brass ball (top) and Xenopus laevis oocytes (bottom) as seen through the microscope.

A picture like this is taken every two seconds.

2 M

M

We calculated the water permeability using the equation (Chandy et al., 1997):

Pf = [d(V/V0)/dt][V0/S]/[∆osmVw]

(d(V/V0)/dt) = initial rate of volume increase of oocyte V0 = initial oocyte volume

∆osm = osmotic gradient

Vw = molar volume of water

S = actual surface area of the oocyte

The actual surface area S is 8 times the geometrical area A due to cell membrane infoldings and microvilli of the oocyte plasmalemma (Chandy et al., 1997). A was calculated from the oocyte volume V₀ according to the formula:

A = [(V₀*3)/(4*π)]^2/3

In order to test the effect of mercuric chloride, we prepared isotonic and hypotonic ND96 solutions containing different concentrations of HgCl2 (0.1µM, 1µM, 10µM, 0.3mM, 1mM).

After preincubating the oocytes for 5min. in the isotonic mercuric chloride solution, we switched to hypotonic ND96 containing the same mercuric chloride concentration as the isotonic solution.

To obtain a preincubation time course of mercuric chloride, we preincubated oocytes for 1, 5 or 20 min. in isotonic ND96 solution containing either 1µM or 0.3mM mercuric chloride.

Afterwards we switched the solution as described previously.

Solutions at different pH were prepared by replacing the buffer HEPES by either MES at acidic pH or CHES at alkaline pH and adjusting pH. For solutions at pH 11.5 we had to replace MgCl2 and CaCl2 by NaCl in order to avoid precipitation and maintain osmolality.

The preincubation time for all experiments at different pH was 1.5min. We followed the same protocol as described before.

To test the effect of mercuric chloride on oocytes at different pH, we prepared isotonic and hypotonic ND96 solutions at pH 7.5 and 9.5 (HgCl 1µM).

2 M

M

2.12 Two-electrode voltage clamp

In order to measure whole-cell ionic currents in AQPxl expressing oocytes or water-injected controls, we used a two-electrode voltage clamp set-up as shown in fig. 3. We collected data using a Warner Instruments (USA) oocyte clamp, which was controlled by the Clampex module of the pCLAMP software (Version 8, Axon Instruments, USA). The data were analyzed with the program Clampfit of pCLAMP.

The electrodes were fashioned from borosilicate glass using a model P-97 puller (Sutter, USA). They were filled with 3 M KCl. Both current and voltage electrode had resistances of 0.5-1 MΩ.

One oocyte was placed into the perfusion chamber and superfused with isotonic ND96 solution at a flow rate of 4ml min^-1. The membrane potential was clamped at –50mV. In order to measure the conductance of the oocyte cell membrane, we changed the membrane voltage in steps of 10mV from –110 to 30mV. Several of these current-voltage relationships were acquired over time within one experiment. We plotted current against voltage and derived the whole cell conductance from the slope of the line connecting the points. Inward conductance was acquired from the linear portion of the negative (inward) current.

bath

voltage electrode current electrode

reference electrode

amplifier

bath

voltage electrode current electrode

reference electrode

amplifier

Figure 3. The two-electrode voltage clamp set-up.

The Xenopus laevis oocyte is impaled with two electrodes. One electrode measures the voltage and the other injects currents.

2 M

M

To measure the effect of mercuric chloride on oocytes expressing AQPxl the superfusate was switched from normal ND96 to ND96 containing 0.1mM HgCl2.

In order to reverse the effect of mercuric chloride the oocyte was superfused with β- mercaptoethanol (5mM) in normal ND96 solution.

2.13 Urea and glycerol uptake

14C-labeled urea ([¹⁴C]-urea) and glycerol ([¹⁴C(U)]-glycerol; Moravek Biochemicals, USA) were used for measuring the unidirectional influx of urea and glycerol in oocytes.

Four oocytes were placed in a 1.5-ml microcentrifuge tube containing normal ND96 solution.

This solution was aspirated and replaced with 700 µl of ND96 containing 1 mM of the unlabeled analyte and 1 µCi/ml (37 kBq/ml) of the radioisotopically labeled analyte. The oocytes were incubated on a horizontal shaker for 5 min at room temperature. In order to confirm a linear uptake during the first 5 min ¹⁴C uptake of oocytes had been measured in control experiments in advance. Uptake of radioisotope was stopped by washing the oocytes in ice-cold ND96 containing 10 mM of the unlabeled analyte. Individual oocytes were placed into scintillation vials and lysed in 400 µl of 10% SDS with continuous shaking. The samples were counted for ¹⁴C activity using liquid scintillation counting (LKB-Wallac Rackbeta, Finland).

We calculated an apparent rate constant k for unidirectional glycerol and urea influx as follows:

t A k A

m ooc

= ×

where Aooc and Am is the activity (in cpm) of an oocyte (volume ~1 µl) and 1 µl medium, respectively, and t is time of incubation (s).

2 M

M

2.14 Antisense

Oligonucleotides were designed to the AQPxl sequence. We injected oocytes with 50ng/50nl oligonucleotides. Water permeability was acquired using the volumetric assay and urea uptake was measured as described previously.

2.15 Statistical analysis

For statistical analysis unpaired t-tests or One-way ANOVA with Tukey's post test were performed using GraphPad Prism version 3.00 for Windows, GraphPad Software, USA.

3 R

3 Results

3.1 Sequence analysis

AQPxl hAQP0

hAQP1 hAQP2 hAQP3 hAQP4 rAQP6 hAQP7 hAQP9

AQPxl hAQP0 hAQP1 hAQP2 hAQP3 hAQP4 rAQP6 hAQP7 hAQP9

AQPxl hAQP0 hAQP1 hAQP2 hAQP3 hAQP4 rAQP6 hAQP7 hAQP9

AQPxl hAQP0 hAQP1 hAQP2 hAQP3 hAQP4 rAQP6 hAQP7 hAQP9

AQPxl hAQP0 hAQP1 hAQP2 hAQP3 hAQP4 rAQP6 hAQP7 hAQP9

AQPxl hAQP0 hAQP1 hAQP2 hAQP3 hAQP4 rAQP6 hAQP7 hAQP9

Figure 4. Sequence analysis of AQPxl from Xenopus laevis library.AQPxl in comparison to hAQP0,

3 R

The AQPxl sequences, both from the Xenopus laevis library and from oocyte total RNA, contain an 894-bp open reading frame encoding 297 amino acids as shown in figure 4. The two sequences differ in the length of their 3’ UTRs, with 342 bp for the library sequence and 294 bp for the sequence from oocyte RNA.

Figure 5 shows a dendrogram with the AQPxl sequence and rodent AQPs, xAQP3 from Xenopus laevis kidney (Schreiber et al., 2000) and the bacterial glycerol facilitator GlpF.

AQPxl has the highest sequence homology to the AQPs of the cocktail-set and GlpF, especially to mAQP3 (49.7%) and xAQP3 (48.8%) (see also figure 6).

AQPxl

Orthodox set AQP2

AQP5

AQP1 AQP4

AQP7 AQP9

GlpF AQP8

59.3

50 40 30 20 10 0

AQP0 AQP6

AQP3 xAQP3

Cocktail set AQPxl

Orthodox set AQP2

AQP5

AQP1 AQP4

AQP7 AQP9

GlpF AQP8

59.3 59.3

50 40 30 20 10 0

AQP0 AQP6

AQP3 xAQP3

Cocktail set

Figure 5. A phylogenetic tree of the AQP family.

The clone AQPxl in comparison to other AQPs. All clones are rodent AQPs except xAQP3 (Xenopus laevis). The length of each pair of branches represents the distance between sequence pairs. The units at the bottom of the tree indicate the number of amino acid substitution events.

3 R

Figure 6. Sequence distances of the clone AQPxl in comparison to other AQPs of the cocktail set and rAQP1.

The percent divergence is a measure of how far a sequence has diverged from other sequences in the set. It is derived by taking its distance from the ancestral node over the total length of a phylogenetic tree of all sequences. The percent similarity compares sequences directly, without accounting for phylogenetic relationships. It assesses the matches and mismatches and gaps of the amino acid sequences empirically.

rAQP1 xAQP3 hAQP3 mAQP3 rAQP3 rAQP7 rAQP9 AQPxl

rAQP1 xAQP3 hAQP3 mAQP3 rAQP3 rAQP7 rAQP9 AQPxl percent similarity

percent divergence

3 R

The results of the hydropathy analysis (fig. 7) of the deduced amino acid sequence show six transmembrane segments and five connecting loops (A-E). The specific motif of the aquaporin-family, the amino acid sequence NPA, is located in both loops B and E. NH2 and COOH termini are cytoplasmic. Loops C and E of AQPxl and hAQP3 are longer than in the other AQPs of figure 4. Long C and E loops are characteristic for all aquaglyceroporins.

Another characteristic of the aquaglyceroporins is the presence of an aspartate residue following the second NPA-motif (NPARD) (Borgnia et al., 1999). This aspartate is also found in AQPxl. AQPxl also shows a motif at the beginning of loop C (SLYY) , which is similar to other motifs of the aquaporin cocktail-set (GLYY in hAQP3, SLFY in hAQP7 and GIYY in hAQP9 (see fig. 4). The AQPxl sequence contains a PKC-phosphorylation consensus motif at residues 97-99 in the intracellular B loop and a consensus motif for N-glycosylation site at residues 134-137 in the C loop (see fig. 4).

-3 -2 -1 0 1 2 3

0 50 100 150 200 250 300

residue number of amino acid

hydropathy

1 2 3 4 5 6

A B C D E

5' end 3' end

Figure 7. A Kyte-Doolittle hydropathy plot of the deduced amino acid sequence of AQPxl using a 17-residue window.

The average local hydrophobicity at each residue was plotted against the residue number of the amino acid. Positive values on the ordinate indicate hydrophobic regions. The transmembrane spanning segments are numbered (1-6). The connecting loops are labeled as A-E.

3 R

3.2 Northern-blot analysis

Figure 8 shows a Northern-blot analysis of total RNA extracted from Xenopus laevis tissue.

We obtained the strongest signal in fatbody and weaker signals in oocytes and kidney. The size of the transcripts was ~1.4 kb. No signals were detected in lung, skin, urinary bladder, stomach, intestine, liver, heart, brain and gall bladder. It has to be mentioned again that less RNA was loaded in the heart, brain and gall bladder lanes.

Skin U. bladder

Fatbody Oocyte Lung Muscle Kidney

2.4 4.4

1.4

0.2 kb

Intestine

Stomach Liver Brain

Heart Gall bladder

Skin U. bladder

Fatbody Oocyte Lung Muscle Kidney

2.4 4.4

1.4

0.2 kb

Intestine

Stomach Liver Brain

Heart Gall bladder

Figure 8. Multi-tissue Northern-blot of total RNA probed with AQPxl.

The calculated size of the transcript is 1.4 kb.

3 R

3.3 Water permeability

The water permeability of oocytes expressing AQPxl was 6.4-fold increased compared to controls (fig.9). P_f of AQPxl-expressing oocytes was 4.5 times lower than in hAQP1- expressing oocytes, and 2.2 times lower than in rAQP3-expressing oocytes. However, it is important to note that we do not know the amount of protein in the membrane. Therefore, variations in Pf between different AQPs is influenced by the amount of expressed functional protein. All Pf values are significantly different from control (p<0.05).

H2O hAQP1 rAQP3 AQPxl

0 0.001 0.002 0.003 0.004 0.005 0.006 0.007 0.008 0.009

Pf(cm/s)

H2O hAQP1 rAQP3 AQPxl

0 0.001 0.002 0.003 0.004 0.005 0.006 0.007 0.008 0.009

Pf(cm/s)

0 0.001 0.002 0.003 0.004 0.005 0.006 0.007 0.008 0.009

Pf(cm/s)

Figure 9. P_f of AQPxl-expressing oocytes in comparison to P_f of oocytes expressing other AQPs.

Water injected oocytes served as controls. Means ± SEM, n=5-7.

3 R

3.3.1 The effect of mercury on Pf

The dose response to HgCl₂ of oocytes encoding AQPxl or hAQP1 is shown in fig. 10. No change in P_f of AQPxl-expressing oocyteswas seen at 0.1 µM HgCl₂ compared to untreated controls (P>0.05). At 1µM HgCl₂ P_f is 10-fold decreased compared to 0.1 µM HgCl₂ (P<0.05), whereas at high HgCl2concentrations (300 to 1000 µM), Pf was increased.

This biphasic response of AQPxl-expressing oocytes to mercury is quite different from the behavior of hAQP1-expressing oocytes. In these oocytes, the water permeability remains rather unchanged at lower HgCl2 concentrations compared to controls, whereas Pf was 5-fold decreased at higher HgCl2 concentrations. Block of AQP1 by mercurials was first described by Agre and Preston (Agre et al., 1993), (Preston et al., 1993).

0%

20%

40%

60%

80%

100%

120%

140%

160%

180%

0.1 1 10 100 1000

H g C l₂ (µM ) Pf/control

AQ Pxl hAQ P1 c ontrol

*

**

**

Figure 10. Dose-response of HgCl₂ in oocytes expressing hAQP1 or AQPxl.

Oocytes were preincubated for 5min in 200 mosm/kg ND96 (pH 7.5) containing different HgCl2 concentrations. Pf of water-injected oocytes treated with the appropriate mercuric chloride concentration was subtracted from individual experiments. Experiments were normalized by dividing averaged data of each mercury treatment group by averaged data from non-treated oocytes. P_f of normalized water injected oocytes served as controls.

nAQPxl=6-13, nhAQP1=2-3, ncontrol=2. * indicates statistically significant difference (P<0.05), ** indicate statistically very significant difference (P<0.001) compared to P_f at 1µM HgCl₂.

3 R

3.3.2 Time-course for mercury action

Figure 11 shows the effect of different preincubation times on oocytes injected with RNA encoding AQPxl. Water permeabilities of oocytes treated with 1 µM HgCl2 were generally 2- 4 times lower than oocytes preincubated in 300 µM solutions. Different preincubation times did not significantly change Pf within the same mercury treatment group.

0 0.0002 0.0004 0.0006 0.0008 0.001 0.0012 0.0014 0.0016 0.0018

0 5 10 15 20

time (min) Pf(cm/s)

control 1µM HgCl2 300µM HgCl2

**

**

***

Figure 11. The mercury preincubation time course. AQPxl-expressing oocytes were preincubated with 1 µM or 300 µM HgCl₂ for 1, 5 or 20 min (pH 7.5).

Untreated AQPxl-expressing oocytes served as controls (dashed line). Means ± SEM, n_controls=30, n_{1 µM Hg}=5-24, n_{300 µM Hg}=5-11. Two (P<0.001) and three asterisks (P<0.0001) denote very significant difference between different mercury treatment groups with the same preincubation time.

3 R

3.3.3 The effect of external pH on P_f

The effect of changes in external pH (pHo) on Pf of AQPxl-expressing oocytes is shown in fig.

12. At low pHo the water permeability was not significantly different compared to controls at pH 7.5, whereas the water permeability was increased at alkaline pHo and resulted in a maximum at pHo ≥9.2 and ≤10.5 (4-fold increase). Water-injected controls show significantly lower water permeability than AQPxl-encoding oocytes with no effect of pH_o. The variations within the control group are statistically insignificant.

0 0.0005 0.001 0.0015 0.002 0.0025 0.003 0.0035

4 5 6 7 8 9 10 11 12

pH

Pf (cm/s)

AQPxl controls

**

**

Figure 12. pHO-dependence of AQPxl-expressing oocytes and water-injected controls.

Individual oocytes were preincubated in the appropriate pH solution (isoosmotic) for 1.5 min. Solutions at pH 11.5 were prepared without calcium and magnesium. Means ± SEM, nAQPxl=8-27, ncontrols=5-10. ** indicate highly significant difference to previous data point (P<0.001).

3 R

3.3.4 The combined effect of pH and mercury

AQPxl-expressing oocytes treated with 1 µM HgCl2 showed a 3-fold decrease in water permeability at pHo 7.5 (fig. 13). To test whether the interaction of mercury with the channel was irreversible, we preincubated oocytes in ND96 with HgCl2 (1 µM) at pH 7.5. Afterwards, we switched to a hypotonic solution either containing HgCl₂ (1 µM) or not (fig. 13 a, light grey and white bar). The same results were obtained. At pHo 9.5, the water permeability was reduced by mercuric chloride to half as compared to controls (b).

0 0.0005 0.001 0.0015 0.002 0.0025 0.003

a b

Pf (mm/s)

controls HgCl2 0 HgCl2

*** ***

*

Figure 13. The effect of HgCl2 at different pHo on AQPxl-expressing oocytes.

The oocytes were preincubated in 200 mosm/kg ND96 with HgCl2 (1 µM) at pH 7.5 (a, b) for 5 min. Then the oocytes were subjected to cell swelling in:

a. hypotonic solution: 100 mosm/kg ND96 with HgCl₂ 1 µM (light grey bar) and without HgCl2 (white bar), pH 7.5

b. hypotonic solution: 100 mosm/kg ND96 and HgCl₂ 1 µM (light grey bar), pH 9.5

Ooocytes not treated with HgCl2 encoding for AQPxl served as controls (a. pH 7.5, b. pH 9.5 and preincubation of 1.5 min.). Means ± SEM, n=5.

* indicates statistically significant difference between controls and mercury treated cells (P<0.05), whereas *** indicate statistically very significant difference (P<0.0001).

3 R

3.3.5 Calcium and magnesium dependence

Oocytes incubated in normal ND96 solutions or Ca²⁺ and Mg²⁺ free ND96 showed similar Pf

values at pH 7.5 (fig. 14). Also at pH 9.5, there is no statistically significant difference between oocytes incubated in ND96 solutions with or without Ca²⁺ and Mg²⁺. All oocytes were preincubated for 1.5 min.

0 0.0005 0.001 0.0015 0.002 0.0025 0.003 0.0035

pH=7.5 pH=9.5

Pf (cm/s)

controls Ca/Mg free

Figure 14. The effect of Ca²⁺ and Mg²⁺ free ND96 solutions on Pf

of AQPxl-expressing oocytes.

Normal ND96 at pH 7.5 and 9.5 served as control solutions. Means

± SEM, ncontrols=17-27, n_Ca/Mg-free=5