• Keine Ergebnisse gefunden

Supplementary note S1.

N/A
N/A
Protected

Academic year: 2022

Aktie "Supplementary note S1."

Copied!
2
0
0

Wird geladen.... (Jetzt Volltext ansehen)

Volltext

(1)

Supplementary note S1. Zostera marina cultivation from seeds

Flowering shoots were sampled from Zostera marina meadows close to Kiel, Germany (Table 1) in July 2014 by snorkeling transects parallel to the coast line (depth 1.5 – 4 m, minimal distance between shoots >4m). Flowering shoots were cleaned from epiphytes and bivalves and transported within the same day to GEOMAR culturing facilities.

Reproductive eelgrass shoots were maintained floating in a 600 L tank filled with filtered seawater (filter size: 5 µm, 15 PSU) equipped with continuous aeration and pumps to ensure water movement (600L/hr) until ripening. Ripe seeds were

harvested between September and October. A seed was considered mature when the seed coat had darkened and it would easily detach from the inflorescence. Half of the water volume was exchanged biweekly throughout the entire cultivation process.

Natural salinity in Kiel Fjord fluctuates between 12 and 20 PSU. If necessary salinity was adjusted to 15 PSU. Z. marina shoots were kept light saturated (~200 µmol photons s-1 m-2 at plant height) by vapor metal high pressure lamps (Philips, Master Green Power 400W) during daytime (light period 16:8h).

Seeds were sown 1 cm deep in plastic containers (15 x 25 x 15 cm, each 40 seeds/) filled with a ~2 cm layer of ambient sediment. Water temperature was regulated by Aqua Medic coolers and electric heating elements to follow the yearly variation observed in Kiel Fjord and ranged from 14°C to 20°C during the ripening period.

Sediment (silicate sand, 0.5-1% organic material) was collected from a shallow sand bank adjacent to a sea grass meadow at Falckenstein (N 54.391, E 10.192), sieved (to extract animals living in the sediment) dried and heated for 2-4 hours at 80°C, to eliminate potential Labyrinthula zosterae contamination.

Sediment containers with sown seeds were then submersed in large 600L tanks (described above). Water temperature was reduced from 17°C to 10°C within a week. Subsequently containers were stored at 6°C under darkness for 75 days to break seed dormancy. Within the following 6 weeks, we raised the water temperature gradually to 10°C and increased the light period light from 8 h to 12 h d-1. The

germination rate was approximately 20%, in line with other findings on Baltic Sea seed germination rates. At a maximal leaf length of 3-6 cm, each seedling received fertilizer to promote growth. Three Plantacote © Mix 4M pellets (Manna,

Ammerbruch-Pfäffingen, Germany) were placed 1cm deep into the sediment in 2 cm distance from the seedling (approximately 0.02g N/seedling + approx. 0.009g

P/seedling). One pellet contained fertilizer immediately available (release within weeks), the other two slow release fertilizer (months to complete release).

At a size of 10 – 20 cm leaf length, plants were transplanted at a density of 6 plants per aquarium in 10cm sediment sterilized sediment. Every 8 weeks plants received new fertilizer (as described above). In July 2015 plants reached a size of

approximately 20 cm and were ready for experimentation. Since all plants arose from

(2)

a recombination event through sexual reproduction we assume that they all represent different genotypes. No L. zosterae was detectable in a subsample using the

quantitative real-time PCR approach developed (Bergmann et al. 2011).

Tab. 1 Characterization of location for collection of flowering shoots for eelgrass seeds.

Location Strande (N54.434, E10.170) Eckernförde (N54.449, E9.871)

Date 15.07.14 21.07.14

No. shoots sampled ~ 50 ~ 50

Depth 1.5 – 6 m 1.5 – 3 m

Temperature 20°C 17°C

References

Bergmann N, Fricke B, Schmidt MC, Tams V, Beining K, Schwitte H, Boettcher AA, Martin DL, Bockelmann A-C, Reusch TBH, Rauch G (2011) A quantitative real-time PCR assay for the seagrass pathogen Labyrinthula zosterae. Mol Ecol Resources 11:1076–1081

Referenzen

ÄHNLICHE DOKUMENTE

Supplementary

[r]

False positive category of symptoms that did not correlate with enzyme elevation includes cases where there was no temporal association as well as cases that were confounded by

SCLC, small cell lung cancer; LND, lymph node dissected; LNM, lymph node metastasis; NO*, no lymph node dissected.. Supplementary

(((((((((((((((((((((rheumatoid) AND pannus)) OR (((rheumatoid) AND fibroblast) AND synovial)) OR ((rheumatoid) AND purpura)) OR ((rheumatoid) AND vasculitis)) OR ((rheumatoid)

bDMARD, biologic disease-modifying antirheumatic drug; COVID-19, the 2019 novel coronavirus

Kaplan-Meier plot demonstrating 6-month all-cause mortality by timing of cryptococcal antigen (CrAg) testing and outpatient/inpatient status at the time of HIV diagnosis among people

FTO CCAGAACCTGAGGAGAGAATGG CGATGTCTGTGAGGTCAAACGG ALKBH5 CCAGCTATGCTTCAGATCGCCT GGTTCTCTTCCTTGTCCATCTCC ALPL GCTGTAAGGACATCGCCTACCA CCTGGCTTTCTCGTCACTCTCA RUNX2