Vegetation mapping, pollen analyses and sedimentary DNA metabarcoding
Bastian Niemeyer
Assessing arctic flora composition
in the Siberian treeline ecotone
Study site
27.7.2015 INQUA 2015 – Session H22 Bastian Niemeyer
Coring campaigns since 2011:
> 20 lakes (2011)
> 30 lakes (2013)
> 20 lakes (2014)
Transect study:
Spanning approximately - 360 km (north/south) - 300 km (west/east)
Fig.2: Impressions of vegetation cover, lake and fieldwork at the coring site
Fig.1: Location overview about the arctic treeline (grey), Taiga-Tundra transgression zone
(green) and the coring site (red)
Aims/Objectives
27.7.2015
1. Better understanding of siberian ecotone
– Status quo of treeline vegetation
– Fast changing Arctic (S ERREZE et al. 2009)
2. Comparison of different vegetation assessment methods
– Pollen records
– Vegetation surveys
– Genetics (metabarcoding)
INQUA 2015 – Session H22 Bastian Niemeyer
Research questions
27.03.2015 AWI - Geotreff
• DNA as contributing method for vegetation analysis at the treeline?
• Does DNA provide higher or lower resolution of vegetation composition than other methods?
• Are geografic patterns of plant abundance
traceable via DNA sequence frequencies?
Methods
27.7.2015
• Pollen counting
• Vegetation surveys
• Metabarcoding
INQUA 2015 – Session H22 Bastian Niemeyer
Comparison of methods
27.7.2015 INQUA 2015 – Session H22 Bastian Niemeyer
Pollen records
Vegetation survey
DNA analyses
Taxonomic level
Family, genus, species level
Species/genus (dependant from
vegetation period)
Subspecies to family
Information provided
General floral composition
Floral
composition
Cryptic vegetation, (quantity) Temporal
signal
present and past
Actual/recent status
Present and past
Spatial signal Local and regional
Local Local and regional Resolution High to raw High to
medium
High to
medium
Advantages
27.7.2015
Pollen
• recent and past changes
• local and regional vegetation
• Long research tradition
Vegetation surveys
• reliable impression on coverage
• Directly comparable
• Well established
DNA metabarcoding
• Over-underestimations visible
• Assessability becomes „easier“
INQUA 2015 – Session H22 Bastian Niemeyer
8
Disadvantages
27.7.2015 INQUA 2015 – Session H22 Bastian Niemeyer
Pollen
• Influenced by strength of pollen rain
• Pollen conservational grade
• Under-overerstimation are common
Vegetation surveys
• Biased by flowering season
• Level of identification
• Time consuming/difficult to maintain
DNA metabarcoding
• False positive: contamination, base shifts
• Mistakes in the databases
• Origin of DNA sometimes vague
• Metabarcoding: molecular approach that can identify specific sequences of DNA (barcode)
– provides information about:
• quality and quantity
• very high resolution
• cryptic vegetation
– over-/underestimation visible – assessability becomes easier
27.03.2015 AWI - Geotreff
How to trace vegetation by DNA?
27.03.2015 AWI - Geotreff AWI - Geotreff Camp site
Additional sites
Transition zone
Preliminary DNA results
• 50 GB of data
– 5026 unique sequences
• 1902 = 95 % similarity to arctoboreal database database
• 619 = 98 %
• 243 = 100 %
Classification Taxa sequences Total sequences
Terrestrial 135 ~ 5.9 Million
Aquatic 18 ~ 1.2 Million
Bryophytes 19 ~ 4200
Equisetaceae 6 ~ 544,000
27.03.2015 AWI - Geotreff
0.0 0.0 25.0 25.0 15.0 0.0 0.0 0.0 10.0 0.0 0.0 20.0 90.0 40.0 0.0 0.0 0.0 5.0 80.0 10.0 0.0 0.0 0.0 0.0 80.0 80.0 80.0 80.0 0.0 0.0 0.0 80.0 80.0 0.0 0.0 10.0 60.0 0.0 0.0 0.0 0.0 5.0 10.0 0.0 0.0 0.0 0.0 0.0 20.0 20.0 25.0 0.0 0.0 0.0 0.0 20.0 0.0 0.0 5.0 0.0 0.0 5.0 2.0 0.0 0.0 60.0 80.0 80.0 0.0 25.0 70.0 20.0 0.0 0.0 0.0 0.0 0.0 0.0 20.0 90.0 10.0 20.0 70.0 40.0 0.0 0.0 20.0 70.0 20.0 0.0 5.0 20.0 0.0 20.0 50.0 0.0 0.0 0.0 15.0 0.0 15.0 0.0 20.0 5.0 0.0 25.0 30.0 10.0 0.0 0.0 0.0 80.0 50.0 0.0 0.0 0.0 0.0 80.0 15.0 25.0 5.0 1.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 2.0 0.0 0.0 80.0 60.0 30.0 0.0 0.0 0.0 10.0 15.0 0.0 0.0 0.0 0.0 1.0 0.0 0.0 0.0 0.0 5.0 25.0 70.0 30.0 60.0 0.0 0.0 40.0 50.0 80.0 15.0 8.0 20.0 10.0 0.0 20.0 0.0 0.0 0.0 25.0 0.0 20.0 0.0 20.0 0.0 95.0 90.0 90.0 80.0 10.0 0.0 0.0 5.0 10.0 5.0 5.0 60.0 30.0 0.0 5.0 0.0 0.0 10.0 30.0 3.0 20.0 1.0 20.0 20.0 95.0 95.0 95.0 40.0 0.0 0.0 15.0 80.0 5.0 0.0 0.0 10.0 10.0 0.0 0.0 1.0 0.0 1.0 0.0 3.0 20.0 3.0 20.0 95.0 10.0 80.0 95.0 50.0 0.0 0.0 0.0 5.0 0.0 0.0 0.0 40.0 50.0 10.0 10.0 5.0 5.0 0.0 0.0 0.0 2.0 0.0 20.0 10.0 10.0 40.0 70.0 25.0 0.0 0.0 0.0 0.0 15.0 0.0 5.0 90.0 15.0 0.0 30.0 40.0 40.0 10.0 0.0 0.0 0.0 2.0 0.0 0.0 0.0 0.0 80.0 10.0 0.0 0.0 3.0 70.0 60.0 40.0 0.0 45.0 60.0 15.0 10.0 80.0 80.0 60.0 0.0 0.0 10.0 10.0 0.0 0.0 0.0 0.0 95.0 25.0 0.0 10.0 20.0 70.0 20.0 0.0 0.0 10.0 20.0 0.0 70.0 50.0 80.0 80.0 25.0 60.0 95.0 80.0 0.0 0.0 0.0 20.0 70.0 25.0 0.0 10.0 5.0 20.0 20.0 0.0 10.0 10.0 0.0 10.0 80.0 0.0 1.0 25.0 5.0 95.0 75.0 25.0 0.0 0.0 0.0 0.0 0.0 10.0 0.0 0.0 20.0 20.0 0.0 0.0 2.0 10.0 10.0 0.0 10.0 0.0 5.0 0.0 0.0 20.0 20.0 20.0 0.0 0.0 5.0 5.0 0.0 70.0 0.0 50.0 50.0 50.0 0.0 5.0 5.0 30.0 0.0 0.0 0.0 0.0 0.0 0.0 3.0 0.0 0.0 0.0 0.0 0.0 15.0 70.0 70.0 70.0 30.0 0.0 5.0 90.0 0.0 20.0 3.0 5.0 0.0 0.0 0.0 60.0 80.0 50.0 0.0 1.0 1.0 1.0 1.0 25.0 70.0 90.0 60.0 30.0 2.0 0.0 2.0 10.0 0.0 2.0 0.0 0.0 0.0 80.0 0.0 90.0 80.0 1.0 50.0 80.0 15.0 5.0 1.0 5.0 70.0 90.0 70.0 20.0 5.0 10.0 80.0 15.0 0.0 20.0 5.0 0.0 50.0 40.0 0.0 40.0 60.0 70.0 30.0 62.0 0.0 0.0 0.0 0.0 60.0 80.0 50.0 10.0 20.0 40.0 90.0 10.0 0.0 5.0 2.0 0.0 15.0 10.0 0.0 25.0 5.0 25.0 70.0 90.0 0.0 0.0 0.0 0.0 0.0 10.0 5.0 5.0 20.0 90.0 90.0 90.0 0.0 20.0 0.0 5.0 10.0 20.0 0.0 5.0 1.0 15.0 10.0 15.0 0.0 0.0 0.0 10.0 1.0 0.0 0.0 80.0 40.0 90.0 90.0 40.0 2.0 30.0 10.0 2.0 10.0 0.0 0.0 10.0 10.0 0.0 0.0 0.0 15.0 35.0 35.0 0.0 0.0 0.0 0.0 0.0 25.0 50.0 10.0 0.0 10.0 20.0 80.0 10.0 0.0 0.0 0.0 10.0 20.0 15.0 0.0 0.0 30.0 25.0 35.0 0.0 0.0 0.0 0.0 0.0 8.0 25.0 5.0 0.0 15.0 15.0 60.0 10.0 0.0 0.0 0.0
atcctggtttacgcgaacaaaccggagtttacaaagcgcgaaaaaagg atcctgctttcagaaaacaaaaagggggattcagaaagaaaaaaaaaaagg atcctgttttatgaaaataaacaagggtttcataaaccgaaaataaaaaag atcttcttttttttttcaaaacaagggttcagaaaacgaaaaaag ctccttaaatcgtctcctaaaaaaaaacggattcaaaaagcaagaataaaaaag atcccgttttatgaaaacaaacaagggtttcagaaagcgagaataaataagg attttatctcaaaaatga
atcccgtcttctaaaaacaaaggttcagaaagcgaaagg atcctctttttttttcaaaacaaaggttcagaaaacgaaaaaag atcctgttttatgaaaacaaacaagggtttcagaaagcgcgaataaaaagg
