• Keine Ergebnisse gefunden

Identification and Cloning of a Gene Locus Encoding Peptide Synthetase of Pseudomonas fluorescens by Two Sets of PCR Primers

N/A
N/A
Info
Herunterladen
Protected

Academic year: 2022

Aktie "Identification and Cloning of a Gene Locus Encoding Peptide Synthetase of Pseudomonas fluorescens by Two Sets of PCR Primers"

Copied!
1
0
0

Wird geladen.... (Jetzt Volltext ansehen)

Jetzt herunterladen ( 1 Seite )

Volltext

(1)

Identification and Cloning of a Gene Locus Encoding Peptide Synthetase of Pseudomonas fluorescens by Two Sets of PCR Primers

Narayanan Rajendran

Fachbereich Chemie/Biochemie, Philipps-Universität Marburg, Hans-Meerwein-Strasse, 35032 Marburg, Germany

Z. Naturforsch.54 c,105Ð109 (1999); received August 26/September 21, 1998 Oligonucleotide Primers,Pseudomonas fluorescens, Peptide Synthetase, Identification

A chromosomal locus encodingbiosynthetic genes for a putative peptide synthetase of Pseudomonas fluorescenswas identified and cloned. To achieve this, two sets of degenerated oligonucleotide primers KAGGA:SGTTG and TGD:LGG were used in PCR. These primers were selected based on highly conserved units of known peptide synthetases involved in adenylation and thiolation regions ofBacillus subtilis. The discrete amplified bands from PCR ca. 300 bp for KAGGA:SGTTG and ca. 500 bp for TGD:LGG proved to be integral part of the genomic DNA ofP. fluorescenswere cloned and sequenced. Sequence alignments of both fragments confirmed the putative peptide synthetase genes in P. fluorescens. The present study describes the identification and cloningof peptide synthetase genes ofP. fluo- rescens,which can be used to identify a genetic locus encoding peptide synthetase in other microbial species.

Reprint requests to Dr. Rajendran. Fax: (517)355-0250, e-mail: rajendra@scully.egr.msu.edu

Referenzen

Jetzt herunterladen ( PDF - 1 Seite - 24.67 KB )

ÄHNLICHE DOKUMENTE

Identification, heterologous production and bioactivity of lentinulin A and dendrothelin A, two natural variants of backbone N‑methylated peptide macrocycle omphalotin A

We produced all three homologous peptide natural products by coexpression of OphMA hybrid proteins and OphP in the yeast Pichia pastoris.. The recombinant peptides differ in

Table S3. Description of the primers of multiplex long-distance PCR and long distance inverse PCR.MethodPrimersSequence (5’ - 3’)

7p14.3.F1 AATCCTATCAATTCCTCCCCATGTGTCAAG 7p14.3.F2 CTATCAATGGCCCTTCCAAGCTATCAGGTA 7p14.3.F3 GATTGCAGATTTCTGGGAGAATAAGGACGA 7p14.3.F4 CAGGCAAATTGGAAGATGAGTAGGAAGGAG

Molecular Cloning and Characterization of a Bombyx mori Gene Encoding the Transcription Factor Atonal

Sequence analysis showed that the BmAtonal protein shares exten- sive homology with other invertebrate Atonal proteins with the bHLH motif.. Reverse transcription- polymerase

The Structure of Two Fengycins from Bacillus subtilis S499

The structuresof the two fengycins, lipopeptidesfrom Bacillus subtilis, were elucidated by spectroscopic methods and chemical degradation. They show a close structural relationship

Cloning and phenotypic expression in Escherichia coli of a Bacillus subtilis gene fragment coding for sucrose hydrolysis

A DNA fragment from Bacillus subtilis strain Marburg coding for the synthesis of an enzyme catalyzing sucrose hydrolysis was cloned in Escherichia coli and

Use of group-specific PCR primers foridentification of chrysophytes by denaturinggradient gel electrophoresis

Amplifications of the 18S rDNA gene fragments in cultures and field samples were per- formed using the forward primers EukC1-F or EukC2- F and the reverse Chryso-R primer (see

Identification of a locus involved in the utilization of iron by Actinobacillus pleuropneumoniae

DNA sequence analysis of the fragment showed that there are three genes designated afuA, afuB and afuC (Actinobacillus ferric uptake) that encode products

Nonribosomal peptide synthetases : quaternary structure and chemoenzymatic synthesis of macrocyclic peptides

Incubation of tyrocidine substrate mimic and excised tyrocidine peptide cyclase revealed activity with an observed cyclization to hydrolysis ratio of 6:1 (surfactin cyclization will