Studies on the mechanism of action of an anti-edema peptide
D ISSERTATION
zur Erlangung des akademischen Grades eines Doktors der Naturwissenschaften (Dr. rer. nat.)
an der Universität Konstanz
Mathematisch-naturwissenschaftliche Sektion Fachbereich Biologie
vorgelegt von
Dominik Wolfram Geiger
Konstanz, September 2006
Tag der mündlichen Prüfung: 27.11.2006 1. Referent: Prof. Dr. Klaus P. Schäfer 2. Referent: Prof. Dr. Albrecht Wendel
Konstanzer Online-Publikations-System (KOPS) URL: http://www.ub.uni-konstanz.de/kops/volltexte/2008/5656/
URN: http://nbn-resolving.de/urn:nbn:de:bsz:352-opus-56564
Die vorliegende Dissertation wurde in der Abteilung Biotechnologie (RPR/BT) der ALTANA Pharma AG in Konstanz angefertigt.
An dieser Stelle möchte ich Herrn Prof. Dr. Klaus P. Schäfer recht herzlich für die Bereitstellung des interessanten Themas und des Arbeitsplatzes in seiner Abteilung bedanken. Sein Engagement und Enthusiasmus ermöglichten spannendes Forschen.
Herrn Prof. Dr. Albrecht Wendel danke ich für die freundliche Erstellung des Zweitgutachtens.
Frau Dr. Inge Mühldorfer möchte ich hiermit meinen ganz besonderen Dank aussprechen:
Vielen Dank für die ausgezeichnete Betreuung, für die Unterstützung in allen Belangen, die ich während der letzten Jahre stets von Dir erhalten habe, und für die Durchsicht des Manuskriptes dieser Arbeit.
Weiterhin danke ich allen Mitarbeitern der Abteilungen RPR/BT, RPR/PX und RPR/FG für ihre stete Hilfsbereitschaft und die tolle Stimmung und Arbeitsatmosphäre. Besonders möchte ich mich bei der ehemaligen „Mibi-Crew“, - Waltraud Burckhardt-Boer, Anja Buttkewitz, Fatma Kabaoglu, Karsten Keldermann, Thomas Reinberg und Katja Schürer -, für die freundschaftliche Zusammenarbeit bedanken, sowie bei meinem „Dome Brother“
Aswin Mangerich für die hervorragende Teamarbeit.
Die Mitgliedschaft im Graduiertenkolleg „Biomedizinische Wirkstoffforschung“ ermöglichte mir die Teilnahme an exzellenten Fortbildungskursen und Seminaren, die mir auch Einblicke in andere Forschungsgebiete eröffneten. Die Kontakte und Freundschaften im Graduiertenkolleg haben die Zeit der Promotion sehr bereichert. Deshalb gilt mein besonderer Dank den Leitern des Graduiertenkollegs Prof. Dr. Albrecht Wendel und Prof.
Dr. Klaus P. Schäfer, sowie PD Dr. Jutta Schlepper-Schäfer für die hervorragende Koordination innerhalb des Kollegs.
Dr. Jochen Strassner ermöglichte die Biacore-Messungen, Dr. Georg Rast stand immer mit Rat und Tat bei elektrophysiologischen Fragen zur Verfügung, Dr. Jürgen Paal war bei den bioinformatischen Analysen behilflich, Silke Müller führte mich in die Mysterien der Affinitätschromatographie ein und Klaus Hägele trug durch seine Unterstützung bei der Massenspektrometrie sehr zum Gelingen dieser Arbeit bei. Ein herzliches Dankeschön an sie alle.
Meinen Mitbewohnern, - das sind Carolina Otero, Jens Lutz und Konrad Bergen -, und all meinen Freunden danke ich, dass sie immer für mich da waren und für angenehme Abwechslung während meiner Promotionszeit sorgten.
Mein größter Dank gilt meiner Familie für alle Unterstützung auf meinem bisherigen Weg.
Abbreviations
aa amino acid(s)
ARDS acute respiratory distress syndrome
bp base pair(s)
BSA bovine serum albumin
CFTR cystic fibrosis transmembrane conductance regulator
CV column volume
EDTA Ethylenediaminetetraacetic acid
ENaC epithelial sodium channel
HBSS Hank’s balanced salt solution
kb kilo base pairs
LLC lung liquid clearance
LY lucifer yellow
Nedd neural precursor cell expressed developmentally down- regulated
NMDG N-methyl-D-glucamin
PCR polymerase chain reaction
SD standard deviation
SDS-PAGE sodium dodecyl sulfate polyacrylamide gel electrophoresis
SEM standard error of the mean
TEER transepithelial electrical resistance
Tip Tip peptide
TNF-α tumor necrosis factor α
TEMED N,N,N’,N’-Tetramethylethylenediamine
Tris Tris(hydroxymethyl)aminomethane
Units SI prefix
A Ampere K Kilo (103)
°C Degree Celsius D Deci (10-1)
Da Dalton C Centi (10-2)
g Gram M Milli (10-3)
h Hour Μ Micro (10-6)
l Liter N Nano (10-9)
M Molar P Pico (10-12)
min Minute
s Second
V Volt
Nucleotides Amino acids (aa)
A Adenine A Ala Alanine M Met Methionine
C Cytosine C Cys Cysteine N Asn Asparagine G Guanine D Asp Aspartate P Pro Proline T Thiamine E Glu Glutamate Q Gln Glutamine
F Phe Phenylalanine R Arg Arginine G Gly Glycine S Ser Serine H His Histidine T Thr Threonine I Ile Isoleucine V Val Valine K Lys Lysine W Trp Tryptophane L Leu Leucine Y Tyr Tyrosine
Table of Contents
1 Introduction... 1
1.1Structure and Function of the Human Lung ... 1
1.2Pulmonary Edema ... 3
1.3Lung Liquid Clearance and the Resolution of Pulmonary Edema ... 5
1.3.1 Ion Channels and Transporters Involved in Lung Liquid Clearance ... 5
1.4Tumor Necrosis Factor α and the Tip Peptide... 7
1.4.1 The Lectin-like Domain of TNF-α and the Tip Peptide ... 8
1.4.2 Role of the Lectin-like Domain of TNF-α and the Tip Peptide in Lung Liquid Clearance ... 9
1.5Aims of the Study ... 11
2 Materials and Methods... 12
2.1Materials... 12
2.1.1 Chemicals and Reagents ... 12
2.1.2 Laboratory Equipment and Technical Devices... 13
2.1.3 Kits... 13
2.1.4 Peptides... 14
2.1.5 Antibodies... 14
2.1.6 Oligonucleotides ... 15
2.1.7 Solutions ... 16
2.1.8 Cell Culture... 16
2.1.9 Computer Software... 18
2.2Methods ... 19
2.2.1 Cell Culture... 19
2.2.2 TNF-α Cytotoxicity Activity Assay... 19
2.2.3 Molecular Biological Methods... 19
2.2.4 Biochemical Methods ... 21
2.2.5 Immunofluorescence Staining ... 28
2.2.6 Microscopy ... 29
2.2.7 Transepithelial Electrical Resistance (TEER) Assay... 29
2.2.8 Lucifer Yellow Rejection Assay ... 30
2.2.9 Dome Assay ... 31
2.2.10 Statistical Analysis... 32
3 Results ... 33
3.1Characterization of Human Lung Epithelial Cell Lines ... 33
3.1.1 Analysis of A549, H441 and Calu-3 Cells in Regard to Their Expression of Ion Transporters Involved in Lung Liquid Clearance (LLC)... 33
3.1.2 Analysis of A549, H441 and Calu-3 Cells in Regard to Their Expression of the Water Channel Aquaporin-5 Involved in LLC... 36
3.2Establishment And Validation of In Vitro Test Systems for Pulmonary
Edema Resorption ... 37
3.2.1 Establishment of the Transepithelial Electrical Resistance (TEER) Assay... 37
3.2.2 Establishment of the Dome Assay ... 39
3.2.3 Validation of TEER and Dome Assays... 40
3.3In Vitro Studies on the Mechanism of Action of the Tip Peptide... 45
3.3.1 Influence of the Tip Peptide on Dome Formation and TEER in Calu-3 Cell Monolayers ... 45
3.3.2 Influence of TNF-α on TEER and Dome Formation in Calu-3 Cell Monolayers . 48 3.3.3 Influence of pH on the Activity of rhTNF-α and the Tip Peptide in the TEER Assay ... 50
3.3.4 Investigation of Ions Involved in the Activity of the Tip Peptide ... 51
3.3.5 Influence of the Tip Peptide on β-Adrenergic Receptor Activation and Intracellular cAMP Level... 52
3.3.6 Influence of Oligosaccharides on the Activity of the Tip Peptide ... 54
3.3.7 Effect of Acetate on TEER and Dome Formation of Calu-3 Cell Monolayers... 56
3.3.8 Identification of Potential Interaction Partners of the Tip Peptide ... 58
3.4Screening of Alternative Anti-Pulmonary Edema Peptide Drug Candidates.. 61
3.4.1 Bioinformatic Analysis of the Tip Peptide ... 61
3.4.2 In Vitro Activity Screening of Potential Anti-Edema Peptides ... 61
4 Discussion ... 68
4.1Lung Epithelial Cells for In Vitro Study on Lung Liquid Clearance... 69
4.2In Vitro Test Systems for Pulmonary Edema Resorption ... 72
4.3Mechanism of Action of the Tip Peptide ... 75
4.4Identification of Prospective Anti-Pulmonary Edema Peptides ... 80
5 Summary ... 81
6 Zusammenfassung... 83
7 References ... 85
1 Introduction
1.1 Structure and Function of the Human Lung
The main function of the lung is gas exchange, i.e. oxygen uptake and carbon dioxide excretion. This is accomplished by a well-coordinated interaction of the lung with the central nervous system as well as circulatory system, diaphragm and chest wall musculature. The functional structure of the lung can be divided into i) the conducting airways, comprising the cartilaginous trachea, bronchia, and the membranous bronchioles, and ii) the gas exchange portion, consisting of respiratory bronchioles, alveolar ducts, alveolar sacs, and alveoli (Figures 1.1 and 1.2).
Figure 1.1: Schematic diagram of the human respiratory system. Adapted from 1.
The acinus is the functional respiratory unit of the lung and includes all structures from the respiratory bronchiole to the alveolus (Figure 1.2). An acinus is about 0.75 mm in diameter. Each person has about 20,000 acini containing 300 million alveoli surrounded by the pulmonary capillaries 2.
Figure 1.2: Schematic representations of an acinus and the distal pulmonary epithelium.
(A) The acinus is the functional respiratory unit of the lung and includes all structures from the respiratory bronchiole to the alveolus. Alveolar ducts are small ducts leading from the respiratory bronchioles to the alveolar sacs. Adapted from 1.
(B) The respiratory bronchiole epithelium consists of ciliated cuboidal cells and Clara cells;
the alveolar epithelium consists of type I and type II pneumocytes. All of these polarized epithelial cells have the capacity to transport sodium and chloride. Adapted from 3.
The airways and alveoli in the adult human lung constitute the interface between lung parenchyma and the external environment and are lined by a continuous epithelium.
The distal airway epithelium is composed of terminal respiratory and bronchiolar units with polarized epithelial cells, including ciliated Clara cells and nonciliated cuboidal cells 4-6. These cells synthesize, secrete, and recycle surfactant components.
In the healthy lung, there are three mechanisms responsible for keeping the interstitial tissue and alveoli dry, thus allowing a proper functioning of gas exchange 7:
(1) The difference between the inwardly directed plasma oncotic pressure (~ 25 mmHg) and the outwardly directed hydrostatic pressure (7 – 12 mmHg) within the pulmonary capillaries 8.
(2) The impermeability of connective tissue and cellular barriers to plasma proteins.
(3) Extensive removal of excess fluid from the lung tissue by the lymphatic system.
Pulmonary edema may develop as a result of either malfunction of these three mechanisms or of overwhelming excess fluid.
1.2 Pulmonary Edema
Pulmonary edema is defined as the excess accumulation of extravascular fluid in the lung tissue 9. Pulmonary edema is a common medical emergency, which can be life- threatening. Fluid accumulation in the interstitial tissue and distal airspaces of the lung results in an impaired gas exchange leading to an unacceptably low oxygen level in the blood 10. Patients with pulmonary edema show typical symptoms including shortness of breath, lung-crackling sounds, pink-stained sputum cough, and anxiety. During edema formation the excessive fluid first accumulates in the interstitial spaces of the lung (interstitial pulmonary edema), producing only a few clinical symptoms. At a later stage, flooding of the alveoli results in an alveolar pulmonary edema (Figure 1.3).
Figure 1.3: Formation of pulmonary edema.
(A) The formation of pulmonary edema begins with an increased filtration through the loose junctions of the pulmonary capillaries into the interstitial space of the lungs (= interstitial pulmonary edema).
(B) As the intracapillary pressure increases, the normally impermeable tight junctions between alveolar epithelial cells open, permitting alveolar flooding to occur (= alveolar pulmonary edema).
Adapted from 11.
Three main causes have been described for the development of pulmonary edema 8,12,13:
(1) In patients with a left-sided insufficiency of the heart, an increased hydrostatic capillary pressure and subsequent congestion in the lung blood vessels can lead to cardiogenic pulmonary edema.
(2) In patients with nephritic syndrome or fluid overload of the body (e.g. by infusions), reduced plasma protein levels (hypo-albuminemia) can cause renal pulmonary edema.
(3) In patients with lung inflammation (pneumonia) or blood infection (sepsis), and in patients aspirating gastric contents, direct or indirect lung injuries can damage the epithelium and increase vascular permeability; the accompanying inflammatory processes enhance capillary permeability. The clinical manifestations of the resulting toxic pulmonary edema is in most cases acute respiratory distress syndrome (ARDS) 14.
Pulmonary edema requires immediate emergency treatment. The goal of treatment is to reduce the amount of fluid in the lungs, improve gas exchange, and to correct the underlying disease. Treatment includes 15:
•••• Placing the patient in a sitting position.
•••• Administration of oxygen.
•••• Assisted or mechanical ventilation (in severe cases).
•••• Drug therapy, including morphine, nitroglycerin, diuretics, angiotensin-converting enzyme (ACE) inhibitors, and vasodilators.
Morphine is very effective in reducing the patient's anxiety, easing breathing, and improving blood flow. Nitroglycerin reduces pulmonary blood flow and decreases the volume of fluid entering the overloaded blood vessels. Diuretics, like furosemide (Lasix®), promote the elimination of fluids through urination, helping to reduce pressure and fluids in the blood vessels. ACE inhibitors reduce the pressure against which the left ventricle must expel blood. In patients who have severe hypertension, a vasodilator may be used.
It is noteworthy that none of the currently employed drug therapies specifically induces the resolution of pulmonary edema in the target organ lung. The limiting capacity
of existing substances to induce pulmonary edema resorption at the side of action, namely the lung epithelium, makes it indispensable to identify new effective compounds that stimulate active transepithelial fluid transport in the lung.
1.3 Lung Liquid Clearance and the Resolution of Pulmonary Edema
Several studies indicate that active salt transport by pulmonary epithelial cells drives osmotic water transport in the distal airspaces of the lung, a process known as lung liquid clearance (LLC, reviewed in 16). This transport accounts for the ability of the lung to remove water at the time of birth as well as in the mature lung when pathological conditions lead to the development of pulmonary edema. Active fluid resorption can occur in all segments of the pulmonary epithelium. However, since alveolar epithelial cells comprise 99% of the total airway surface, it is likely that the alveolar epithelium plays a predominant role, although the distal bronchiolar epithelium may contribute 17.
Most experimental studies have attributed a primary role for a vectorial sodium transport in LLC. Sodium ions enter pulmonary epithelial cells on the apical side through the amiloride-sensitive sodium channel ENaC and are subsequently transported across the basolateral membrane by the ouabain-inhibitable Na,K-ATPase 3,18-21. Water follows passively the generated osmotic force. This vectorial salt and water transport accounts for the ability of the human lung to remove water at the time of birth as well as in the mature lung when pathological conditions lead to the development of pulmonary edema (Figure 1.4).
1.3.1 Ion Channels and Transporters Involved in Lung Liquid Clearance
The epithelial sodium channel ENaC plays an essential role in the regulation of transepithelial sodium and fluid balance in various tissues and organs including the lung.
Furthermore, ENaC is a key player of the process of LLC and consequently of pulmonary edema resorption 3,18,19. In the lung, ENaC is a heterotetrameric complex of three homologous subunits (2α:1β:1γ). Each subunit comprises two transmembrane domains, a large extracellular loop with numerous N-linked glycosylation sites, and two short intracellular N- and C-termini 22-26. Expression and function of ENaC are assumed to be regulated, in part, by gluco- and mineralcorticoids (e.g. dexamethasone and aldosterone, respectively) 27-29, transmembrane serine proteases 30-33, Nedd4-2 mediated
ubiquitination 34-36 and association with the cystic fibrosis transmembrane conductance regulator (CFTR) 37-41. Mutations in ENaC subunits are a cause of severe arterial hypertension (Liddel’s syndrome) 42-45 and the salt wasting disease pseudohypoaldosteronism type 1 46,47.
Figure 1.4: Schematic diagram of the process of lung liquid clearance (LLC).
Alveolar type I and type II cells are responsible for an active vectorial transport of sodium ions from the apical to the basolateral surface of the alveolar epithelium. This active transport of sodium appears to provide a major driving force for removal of fluid from the alveolar air space into the lung interstitium, where it leaves into blood vessels or is cleared by lymph drainage. Three ion transporters are critical for LLC: The amiloride-sensitive sodium channel ENaC and the glibenclamide-inhibitable chloride channel CFTR on the apical surface, as well as the ouabain-inhibitable Na,K-ATPase on the basolateral side. Adapted from 18.
Several investigations support the hypothesis that also the glibenclamide- inhibitable chloride channel CFTR may contribute to LLC 3,48-50. CFTR is a dimeric ATP- binding cassette (ABC) transporter glycoprotein that functions in transporting chloride ions across apical membranes of epithelial cells found in the lung, liver, pancreas, digestive tract, reproductive tract, and skin 51,52. Mutations in the gene that codes for the CFTR protein can cause two genetic disorders, cystic fibrosis and congenital bilateral absence of vas deferens (CBAVD) 52,53.
Na,K-ATPases are basolaterally localized transmembrane proteins consisting of α and β subunits. The α-subunit binds and cleaves the high-energy phosphate bond of ATP, whereas the β-subunit is responsible for the assembly and normal function of the enzyme complex in the plasma membrane 54,55. In LLC, the active transport of sodium and potassium by Na,K-ATPases in coordination with the apical sodium uptake through ENaC generates an ionic gradient that drives passive water movements from the airspace to the lung interstitium 3,18-21.
The second messenger cyclic adenosine monophosphate (cAMP) activates LLC by influencing the expression and/or activity of all ion channels and transporters mentioned above. More precisely, cAMP augments the open channel probability of ENaC 56-58, enhances the activity of CFTR 57,59,60, increases the delivery of ENaC and Na,K-ATPase subunits to the apical and basolateral membranes, respectively 36,61-63, and induces the phosphorylation of Na,K-ATPase α-subunits 63,64. Therefore, cell-permeable cAMP analogues and synthetic β2-adrenergic agonists (e.g. terbutaline, salmeterol or isoproterenol) that increase the intracellular cAMP level, are used as gold standards for studies of vectorial transepithelial ion and fluid transport in vitro and in vivo.
1.4 Tumor Necrosis Factor α and the Tip Peptide
The cytokine tumor necrosis factor α (TNF-α) is mainly produced by activated macrophages and other immune cells such as mast cells, B- and T-lymphocytes.
However, endothelial cells, fibroblasts and epithelial cells also produce it. Soluble TNF-α is a 185 amino acid glycoprotein hormone cleaved from a 212 amino acid-long transmembrane precursor. Both, transmembrane and soluble TNF-α are biologically active as homotrimers containing two receptor binding sites (Figure 1.5) 65. TNF-α is mainly known for its receptor-mediated proinflammatory functions in the systemic inflammatory response and apoptosis induction 66,67. In these processes TNF-α exerts its activities by interacting with two distinct TNF receptors with molecular masses of 55 kDa (TNFR1) and 75 kDa (TNFR2), respectively, which are expressed on cell surfaces of various cell types in many different tissues 68,69.
TNF-α is an important mediator of innate immunity. Produced at sites of bacterial, fungal, parasitic or viral invasion, it efficiently recruits and activates defense mechanisms, e.g. by promoting the production of a wide range of other cytokines, such as IL-1, IL-6, IL- 8 and granulocyte-monocyte colony stimulating factor 70-72. However, high systemic levels of TNF-α can result in pathologic conditions like sepsis, cerebral malaria, and autoimmune diseases such as rheumatoid arthritis 73. In addition, the sustained generation of TNF-α is
associated with multiple organ failure 74, multiple sclerosis 75,76, cardiac dysfunction 77, arteriosclerosis 78, and inflammatory bowel disease 79.
1.4.1 The Lectin-like Domain of TNF-α and the Tip Peptide
Although cytokines exert their activity by interacting with specific receptors, the discovery that some cytokines have carbohydrate-binding (lectin) properties makes these molecules bi-functional and opens new concepts in the understanding of their mechanism of action 80-82. In particular, TNF-α has been shown to contain a lectin-like domain that is located at the tip of the TNF-α trimer (tip domain), spatially distinct from the receptor binding sites (Figure 1.5) 83. This carbohydrate-recognition domain is responsible for the dula property of TNF-α, participating in innate immune functions by receptor binding and oligosaccharide binding.
Figure 1.5: Amino acid sequence and structure of human TNF-α and the TNF-α derived Tip peptide.
Human TNF-α possesses three functional domains: two TNF receptor binding-sites and one lectin-like domain. The lectin-like domain extends from Ser100 to Glu116 of the soluble form of human TNF-α (bold letters). Derived from this domain a peptide was synthesized consisting of 17 amino acids (underlined letters). As the lectin-like domain is spatially distinct from the receptor binding domains and is located at the tip of the TNF-α molecule the synthesized peptide is designated Tip peptide. A disulfide bond (orange letters) circularizes the Tip peptide to mimic the loop-like structure of the lectin-like tip domain (yellow circle). Substitution of several amino acids within the lectin-like domain of human TNF-α led to the identification of three amino acids that are critical for the lectin-like activity: Thr105, Glu107, and Glu110 (blue underlined letters). Adapted from 73,83.
The lectin-like tip domain extends from Ser100 to Glu116 of the soluble form of human TNF-α and is responsible for the specific binding of oligosaccharides such as N,N’-diacetylchitobiose and branched tri-mannoses 83-85. In addition, soluble TNF-α has been shown to bind conserved chitobioseoligomannose (GlcNAc(2)-Man(5-9)) moieties of the variant surface glycoprotein (VSG) antigen of African trypanosomes by means of its lectin-like tip domain, resulting in the lysis of these parasites 86,87. Further investigations revealed that the amino acids Thr105, Glu107, and Glu110 within the tip domain are critical for the trypanolytic activity of TNF-α (Figure 1.5) 83.
A synthesized 17-amino acid peptide imitating the lectin-like domain of TNF-α has been shown to be trypanolytic by itself 83. This peptide is called Tip peptide since it is a derivative of the tip region of TNF-α (Figure 1.5). The Tip peptide is circularized via a disulfide bond between its terminal cysteine residues in order to mimic its loop structure within TNF-α.
1.4.2 Role of the Lectin-like Domain of TNF-α and the Tip Peptide in Lung Liquid Clearance
Another interesting effect of the lectin-like domain of TNF-α and also of the Tip peptide is the influence on ion channels in several cell types. Patch clamp studies using either the human lung epithelial cell line A549, murine microvascular endothelial cells, or murine peritoneal macrophages showed that TNF-α and the Tip peptide induce an amiloride- sensitive current, indicating the activation of sodium specific ion channels 88,89. Since several studies specify that active salt transport drives resorption of edema fluid from the distal airspaces of the lung (see chapter 1.3), it may be inferred that the sodium channel activating effect of TNF-α and the Tip peptide in lung epithelial cells induces fluid clearance from the lung. This hypothesis is supported by the fact that intratracheally administered Tip peptide has been shown to stimulate LLC in isolated perfused rat lungs as well as in in situ and in vivo rodent models 73,90-92. This effect could be blocked with the oligosaccharide N,N’-diacetylchitobiose, which specifically binds to the lectin-like domain of TNF-α and blocks its activity 91,92. Moreover, a peptide mutated in the three amino acids essential for the lectin-like activity showed no effect on lung liquid clearance. Furthermore, instillation of TNF-α into the lungs of ventilated rats resulted in an increase of neutrophil infiltration into the alveolar space, whereas instillation of the Tip peptide did not have any inflammatory consequences 91,92. Therefore, the Tip peptide was suggested as a new therapeutic agent for the resolution of pulmonary edema 73.
Taken together, these findings support the following hypothetic mechanism of action of the Tip peptide in LLC (Figure 1.6):
Since the Tip peptide consists of only 17 amino acids it is unlikely that Tip forms a sodium channel by itself as it has previously been described for TNF-α 93,94. Furthermore, the inhibition of the LLC-stimulating activity with amiloride and specific oligosaccharides such as N,N’-diacetylchitobiose implies that the Tip peptide activates an endogenous sodium channel in a direct or indirect manner via a potentially glycosylated receptor at the surface of lung epithelial cells. The activation of sodium channels such as ENaC may result in an active ion transport from the alveolar to the interstitial space of the lung with water following passively to the blood and lymph vessels, finally enhancing the rate of LLC and contributing to the resolution of pulmonary edema.
Figure 1.6: Schematic diagram of a hypothetic mechanism of action of TNF-α and the Tip peptide in LLC.
Intratracheal administration of TNF-α and the Tip peptide up-regulates LLC 90-92. This activity can be blocked by the sodium specific ion channel inhibitor amiloride and specific oligosaccharides such as N,N’-diacetylchitobiose 91,92. These findings imply that TNF-α and the Tip peptide potentially activate an endogenous sodium channel such as ENaC in a direct or indirect manner via a probably glycosylated receptor at the surface of lung epithelial cells resulting in the induction of a vectorial transepithelial sodium transport that drives LLC.
Adapted from 18.
1.5 Aims of the Study
The aims of this study can be summarized as follows:
(1) The establishment and evaluation of a cell-based in vitro test system that mimics the human lung epithelium and allows the investigation of anti-pulmonary edema drug compounds.
(2) The use of this test system for better characterization of the mechanism by which the Tip peptide stimulates transepithelial ion and fluid transport.
(3) The use of this test system for screening and identification of new effective anti- edema drug candidates alternative to the Tip peptide.
2 Materials and Methods
2.1 Materials
2.1.1 Chemicals and Reagents
All chemicals and reagents were of p.a. quality or of highest available purity.
Table 2.1: Chemicals and reagents.
Chemical/Reagent Manufacturer
4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI) Sigma-Aldrich, Deisenhofen, Germany
Acetate, sodium salt Sigma-Aldrich, Deisenhofen, Germany
Acrylamide/Bisacrylamide Roth, Karslsruhe, Germany
Alamar Blue BioSource International, Camarillo, USA
Amiloride Sigma-Aldrich, Deisenhofen, Germany
Ammoniumpersulfate (APS) Biorad, Munich, Germany
Bovine serum albumine (BSA) Sigma-Aldrich, Deisenhofen, Germany
Butyrate, sodium salt Sigma-Aldrich, Deisenhofen, Germany
Cellobiose Sigma-Aldrich, Deisenhofen, Germany
N,N’-diacetylchitobiose Sigma-Aldrich, Deisenhofen, Germany
Dibuturyl (db) cAMP Sigma-Aldrich, Deisenhofen, Germany
Forskolin Sigma-Aldrich, Deisenhofen, Germany
Glibenclamide Sigma-Aldrich, Deisenhofen, Germany
Tumor necrosis factor α, recombinant, human (rhTNF-α) ALTANA Pharma, Konstanz, Germany N-Methyl-D-glucamin (NMDG) Sigma-Aldrich, Deisenhofen, Germany β-Mercaptoethanol Merck, Darmstadt, Germany
Ouabain Sigma-Aldrich, Deisenhofen, Germany
Paraformaldehyde Merck, Darmstadt, Germany
Propranolol Sigma-Aldrich, Deisenhofen, Germany
Sodiumdodecylsulfate (SDS) Roth, Karlsruhe, Germany
Terbutaline Sigma-Aldrich, Deisenhofen, Germany
Tetramethylethylenediamine (TEMED) Merck, Darmstadt, Germany
Triton X-100 Merck, Darmstadt, Germany
TWEEN 20 Merck, Darmstadt, Germany
2.1.2 Laboratory Equipment and Technical Devices
Table 2.2: Laboratory equipment and technical devices
Equipment/Technical device Manufacturer
Branson sonifier 150 Heinemann, Schwäbisch Gmünd,
Germany
Cell counter Cedex AS20 Innovatis, Bielefeld, Germany
Cell culture incubator Thermo Electron Corp., Waltham, USA
Cell culture material Greiner Bio-One, Frickenhausen,
Germany
Nunc GmbH, Wiesbaden, Germany
Clean bench HERASafe Thermo Electron Corp., Waltham, USA
Eppendorf research pipets Eppendorf, Hamburg, Germany Eppendorf Thermomixer 5436 Eppendorf, Hamburg, Germany
inoLab pH meter VWR International, Darmstadt, Germany
Magnetic stirrer Dunn Labortechnik, Asbach, Germany
Rotary Shaker IKA Werke, Staufen, Germany
Table top centrifuges 5415 D/5417R Eppendorf, Hamburg, Germany
Further laboratory equipment and technical devices are listed in paragraphs of the corresponding methods.
2.1.3 Kits
Table 2.3: Kits.
Kit Manufacturer
DNA-free Kit Ambion, Austin, USA
Expand Long Template PCR System Roche, Penzberg, Germany Expand Reverese Transcriptase Kit Roche, Penzberg, Germany Lumi.LightPLUS Western Blotting Substrate Roche, Penzberg, Germany Micro BCA Protein Assay Kit Pierce, Rockford, USA ProteoExtract, Subcellular Proteome Extraction Kit Merck, Darmstadt, Germany
RNeasy Mini Kit Qiagen, Hilden, Germany
TaqMan Gene Expression Assay Applied Biosystems, Foster City, USA
2.1.4 Peptides
Peptides were prepared as acetate salts by fully automated solid-phase peptide synthesis using the Fmoc/tBu-strategy and a Fmoc-amino acid-TCP-polystyrene resin. Suppliers were Bachem, Bubendorf, Switzerland and EMC, Tübingen, Germany.
Table 2.4: Peptides
Peptide Manufacturer
Human circular Tip peptide (Tip), mutant Tip peptide (mTip), scrambled Tip peptide (scTip)
Bachem, Bubendorf, Switzerland
Human circular scrambled-2 Tip peptide (sc2Tip) EMC, Tübingen, Germany Biotinylated Tip peptide (bTip), mutant Tip peptide
(bmTip), scrambled Tip (bscTip)
EMC, Tübingen, Germany
Other peptides, circular or linear EMC, Tübingen, Germany
2.1.5 Antibodies
Table 2.5: Antibodies.
Primary antibody Manufacturer
Polyclonal rabbit-anti-human α-ENaC Sigma-Aldrich, Deisenhofen, Germany Monoclonal mouse-anti-human β-ENaC Santa Cruz Biotechnology, Santa Cruz, USA Polyclonal rabbit-anti-human γ-ENaC Sigma-Aldrich, Deisenhofen, Germany Monoclonal mouse-anti-human CFTR Santa Cruz Biotechnology, Santa Cruz, USA Monoclonal mouse-anti-human α-Na,K-ATPase Sigma-Aldrich, Deisenhofen, Germany Monoclonal mouse-anti-human β1-Na,K-ATPase Sigma-Aldrich, Deisenhofen, Germany Polyclonal rabbit-anti-human occluding Santa Cruz Biotechnology, Santa Cruz, USA Polyclonal rabbit-anti-human ZO-1 Santa Cruz Biotechnology, Santa Cruz, USA Polyclonal goat-anti-human AQP5 Santa Cruz Biotechnology, Santa Cruz, USA
Secondary antibody Manufacturer
Goat-anti-mouse IgG, peroxidase conjugated Dianova, Hamburg, Germany Goat-anti-rabbit IgG, peroxidase conjugated Dianova, Hamburg, Germany Donkey-anti-goat IgG, peroxidase conjugated Dianova, Hamburg, Germany Goat-anti-mouse IgG, Cy2 or Cy3 conjugated Dianova, Hamburg, Germany Goat-anti-rabbit IgG, Cy2 or Cy3 conjugated Dianova, Hamburg, Germany
2.1.6 Oligonucleotides
Oligonucleotides used for RT-PCR were purchased from Invitrogen, Carlsbad, USA.
Table 2.6: Oligonucleotides.
Primer Name Gene Sequence 5’-3’ Orientation
Mibi 906 α-ENaC GCTAATGAGATTCCTGTCGCTTCCATCCC Forward
Mibi 907 α-ENaC CTCTGCCCCCTTCCTTTGGTCTTCTTCC Reverse
Mibi 908 β-ENaC AGACTACGTCCCCTTCCTTGCGTCCAC Forward
Mibi 909 β-ENaC ATATTGGTGCTTTGGTCCCGCTCCTG Reverse
Mibi 910 γ-ENaC CAGTGCGCCCTCCTCGTCTTCTCCTTC Forward
Mibi 911 γ-ENaC CCCATGCATCGGGTGGTGAAAAAGCGT Reverse
Mibi 912 CFTR CGACAGGGTGAAGCTCTTTC Forward
Mibi 913 CFTR TCTGGCTTGCAAAACACAAG Reverse
Mibi 914 HPRT AATTATGGACAGGACTGAACGTC Forward
Mibi 915 HPRT GTGGGGTCCTTTTCACCAGCAAG Reverse
Mibi 1192 PEPT1 GTTTGTGGCTCTGTGCTACCTGACG Forward
Mibi 1193 PEPT1 TTTGGGAGATGAGCCGCTCAT Reverse
Mibi 1194 PEPT2 CCTTTCCAGAAAAATGAGTCCAAGGA Forward
Mibi 1195 PEPT2 TTGTCCTCCCAGTATTGGTAAGGC Reverse
Mibi 1211 AQP5 CTTCCTCAAGGCCGTGTTC Forward
Mibi 1212 AQP5 GCTGGAAGGTCAGAATCAGC Reverse
Probe sets for quantitative TaqMan gene expression analyses were purchased from Applied Biosystems, Foster City, USA.
Table 2.7: Probe sets for TaqMan gene expression assays.
Gene Probe Set
α-ENaC Hs00168906_m1
β-ENaC Hs00165722_m1
γ-ENaC Hs00168918_m1
CFTR Hs00357011_m1
α1-Na+/K+ ATPase Hs00167556_m1
β1-Na+/K+ ATPase Hs00426868_g1
As an endogenous control 18S rRNA was amplified using the following primer set:
Table 2.8: Primer set for amplification of 18S rRNA (Applied Biosystems, Foster City, USA).
Primer Name Sequence 5’-3’ Orientation
TQ 18SRNA S CGGCTACCACATCCAAGGAA Forward
TQ 18SRNA A GCTGGAATTACCGCGGCT Reverse
TQ 18SRNA PR (VIC)-TGCTGGCACCAGACTTGCCCTC-(TAMRA) Probe
2.1.7 Solutions
Hank’s balanced salt solution (HBSS; Invitrogen, Carlsbad, USA):
2 mM CaCl2, 5.4 mM KCl, 0.4 mM KH2PO4, 0.5 mM MgCl2, 0.4 mM MgSO4, 137 mM NaCl, 1.3 mM Na2HPO4, 4 mM NaHCO3 5 mM Glucose, pH 7.4
Dulbecco’s phosphate buffered saline (D-PBS; PAA Laboratories, Pasching, Austria):
137 mM NaCl, 8.1 mM Na2HPO4, 2.7 mM KCl, 1.5 mM KH2PO4, pH 7.4
The composition of further solutions is listed in paragraphs of the corresponding methods.
2.1.8 Cell Culture
2.1.8.1 Cell Lines
Different human lung epithelial cell lines were supplied by American Type Culture Collection (ATCC), Rockville, USA:
Table 2.9: Characteristics of human lung epithelial cell lines used in this study.
Cell line A549 H441 Calu-3
Organism Homo sapiens Homo sapiens Homo sapiens Origin Lung carcinoma Lung adenocarcinoma Lung adenocarcinoma Growth properties Adherent Adherent Adherent
Morphology Epithelial Epithelial Epithelial
Properties of Alveolar type II cells Bronchiolar Clara cells Bronchial ciliated cells Passages used in
experiments
84-92 81-89 21-29
Furthermore, the mouse fibroblast cell line WEHI-13VAR (ATCC, Rockville, USA) was used as a bioassay system to measure the activity of recombinant human tumor necrosis factor α.
2.1.8.2 Cell Culture Reagents
2.1.8.2.1 Complete Growth Media
Table 2.10: Complete growth media for cell cultivation.
Medium Kaighn’s F-12K RPMI 1640 Earle’s MEM Manufacturer Invitrogen, Carlsbad, USA Invitrogen, Carlsbad, USA PAA Laboratories,
Pasching, Austria
Supplements 2 mM L-glutamine 1.5 g/l sodium bicarbonate 10% fetal bovine serum 1% penicillin-streptomycin
2 mM L-glutamine 10 mM Hepes, pH 7.4 1 mM sodium pyruvate 4.5 g/l glucose
1.5 g/l sodium bicarbonate 10% fetal bovine serum 1% penicillin-streptomycin
2 mM L-glutamine 1 mM sodium pyruvate 1 mM nonessential amino acids
1.5 g/l sodium bicarbonate 10% fetal bovine serum 1% penicillin-streptomycin
Cell line A549 H441, WEHI-13VAR Calu-3
Stock solutions of Hepes buffer (1 M), L-glutamine (200 mM), MEM sodium pyruvate (100 mM), sodium bicarbonate (7.5%), MEM nonessential amino acids (100x), and penicillin-streptomycin (10,000 units/ml and 10,000 µg/ml, respectively) were purchased from Invitrogen, Carlsbad, USA. D-(+)-glucose (45%) and fetal bovine serum were purchased from Sigma-Aldrich, Taufkirchen, Germany.
2.1.8.2.2 Additional Cell Culture Reagents
Table 2.11: Additional cell culture reagents.
Reagent Manufacturer
Accutase PAA Laboratories, Pasching, Austria
Dimethyl sulfoxide (DMSO) Merck, Darmstadt, Germany
Trypan blue solution (0.4%) Sigma-Aldrich, Taufkirchen, Germany Trypsin-EDTA (0.05% Trypsin, 0.53 mM EDTA) Invitrogen, Carlsbad, USA
2.1.9 Computer Software
The following software was used for analysis and presentation of data:
Table 2.12: Computer Software
Software Manufacturer
Office 2000 Microsoft Corporation ,Redmond USA
Graph Pad Prism 4.02 GraphPad Software Inc., San Diego, USA
Image Reader LAS 1000 Pro V2.1 Fujifilm, Düsseldorf, Germany
Gene Genius Bio Imaging Syngene, Rockville, USA
Agilent 2100 Bio Sizing Agilent Technologies, Karlsruhe, Germany
AxioVision LE Rel. 4.1 Zeiss, Göttingen, Germany
Advanced Image Data Analyzer 3.12 Raytest GmbH, Straubenhardt, Germany
2.2 Methods
2.2.1 Cell Culture
A549, H441, Calu-3 and WEHI-13VAR cells were grown in different complete growth media (see chapter 2.1.8.2) with 21% O2, 5% CO2 and balanced N2 at 37°C and 95%
humidity. Medium was replaced every other day. Cultures were passaged once to three times a week in a subcultivation ratio of 1:3 to 1:10, using Trypsin/EDTA or Accutase.
For cryoconservation trypsinized cells were adjusted to a cell density of 2-4 x 106 cells per ml in complete growth medium supplemented with 5% (v/v) DMSO. One-ml aliquots were cooled to –80°C in a Nalgene Cryo 1°C freezing container (Nalge Nunc International, Rochester, USA) and stored in the gas phase of liquid nitrogen at –142°C.
2.2.2 TNF-α Cytotoxicity Activity Assay
The cytotoxic effect of TNF-α on the murine fibrosarcoma cell line WEHI-13VAR was measured by the reduction of the tetrazolium dye Alamar Blue (BioScource International, Camarillo, USA) by viable cells. Herefore, WEHI-13VAR cells were plated into a 96-well cell culture plate at a density of 2 x 104 cells/well and grown overnight. Consecutively, serial dilutions of recombinant human TNF-α in RPMI 1640 medium (without phenole red) + 25 mM Hepes pH 7.4 + 3% (v/v) FBS were added in the presence of 0.5 µg/ml actinomycin D (Sigma-Aldrich, Taufkirchen, Germany). Mock treated cells were used to set the basal level of cytotoxicity (i.e. 0% cytotoxicity), cells lysed with 0.1% Triton X-100 were used to set its maximum level (i.e. 100% cytotoxicity). After incubation of the plate for 20 h in a cell culture incubator, 1/10 volume of Alamar Blue dye was added to each well. After a 4 h-incubation at 37°C, Alamar Blue fluorescence was measured with a Wallac Victor2 Multilabel Counter spectrophotometer (Perkin Elmer, Wellesley, USA) with an excitation wavelength of 544 nm and an emission filter of 590 nm.
2.2.3 Molecular Biological Methods
2.2.3.1 RNA Isolation
Total RNA was isolated from A549, H441 and Calu-3 cells using the RNeasy kit (Qiagen, Hilden, Germany). Traces of DNA in RNA samples were removed by on-column DNase digestion using the RNase-free DNase Set (Qiagen, Hilden Germany). RNA concentration
and purity was determined by measuring optical densities (OD) of RNA samples at 260 nm and 280 nm using an Eppendorf Biophotometer (Eppendorf, Hamburg, Germany).
An OD260 of 1 corresponds with 33 µg/ml of total RNA. Purities of RNA samples were estimated by calculating the OD260/OD280 ratios. Additionally, RNA sample quality was assessed using the RNA 6000 Kit with an Agilent 2100 Bioanalyzer (Agilent Technologies, Karlsruhe, Germany).
2.2.3.2 Reverse Transcription of mRNA
First-strand cDNA was synthesized using 1 µg of total RNA in a 21 µl reverse transcription (RT) reaction mixture with the Expand Reverse Transcriptase System (Roche Diagnostics, Penzberg, Germany) with oligo (dT)15 primers according to the manufacturer’s protocol.
2.2.3.3 RT-PCR
Four µl of the reverse transcription mixture were used for polymerase chain reaction (PCR). The Expand Long Template PCR System (Roche Diagnostics, Penzberg, Germany) was used for the amplification of specific DNA fragments with 20 pmol of forward and reverse primers in a 50 µl reaction mixture containing 1 µl dNTP mix (10 mM each), 5 µl of 10x PCR buffer, 0.75 µl MgCl2 (50 mM) and 0.75 µl Expand Long Template enzyme mix. PCR reactions were carried out using a Mastercycler Gradient PCR Machine (Eppendorf, Hamburg, Germany) with the following cycle programs:
Table 2.13: Parameters of RT-PCRs.
Temperature Step Number of
cycles ENaC
α/β/γ CFTR PEPT-1 PEPT-2 AQP5 HPRT
Duration
Denaturing 1 95°C 95°C 95°C 95°C 95°C 95°C 1 min
Denaturing 95°C 95°C 95°C 95°C 95°C 95°C 30 s
Annealing 62°C 54°C 62°C 62°C 63°C 62°C 30 s
Elongation
35
72°C 72°c 72°C 72°C 72°C 72°C 1 min Final
elongation 1 72°C 72°C 72°C 72°C 72°C 72°C 5 min
REU = 2∆Ct x10-7; ∆Ct = Ct(mRNA) – Ct(18S rRNA)
The size of amplified DNA fragments was determined using the Agilent 2100 Bioanalyzer using the DNA 12000 assay kit according to the manufacturer’s protocol (Agilent Technologies, Karlsruhe, Germany).
2.2.3.4 Real-Time RT-PCR
Quantitative real-time RT-PCR was performed with 10 ng of cDNA using TaqMan Gene Expression Assays (Applied Biosystems, Foster City, USA) for human ENaC-α, ENaC-β, ENaC-γ, CFTR, Na,K-ATPase-α1 and Na,K-ATPase-β1 according to the manufacturer’s instructions in a total volume of 25 µl. As an internal control 18S rRNA was amplified.
Forty cycles of amplification, data acquisition and data analysis were performed in an ABI Prism 7900 HT Sequence Detection System (Applied Biosystems, Foster City, USA) with the following parameters:
Table 2.14: Parameters of TaqMan real-time PCRs.
Step Number of cycles Temperature Duration
Enzyme activation 1 95°C 10 min
Denaturing 95°C 20 s
Annealing/elongation 40
60°C 1 min
The mRNA level of each gene of interest was related to that of the 18S rRNA within each sample and calculated as relative expression units (REU):
with Ct being the value of that PCR cycle at which the fluorescence signal had reached a specific threshold value indicating the presence of the mRNA of interest.
2.2.4 Biochemical Methods
2.2.4.1 Crude Membrane Preparation
Cells were grown in 94-mm dishes to confluence. Medium was removed and cells were washed with phosphate-buffered saline (PBS). Cells were scraped and homogenized by sonication in 1.5 ml of homogenization buffer (10 mM Tris-HCl, pH 7.4, 1 mM EDTA,
250 mM sucrose, “Complete Protease Inhibitor Cocktail” (Roche Diagnostics, Penzberg, Germany). The nuclei and cell debris were removed from the homogenate by centrifugation at 4000 × g for 15 min at 4°C. The resulting supernatant was centrifuged at 100,000 × g for 1 h at 4°C. The membrane pellet was solubilized in buffer (10 mM Tris-HCl, pH 7.4, 1 mM EDTA, 1% Triton X-100, Complete Protease Inhibitor Cocktail) by vortexing for a minimum of 1 h at 4°C.
2.2.4.2 Determination of Protein Content
Protein concentration was determined using the BioRad Protein Assay (Biorad, Munich, Germany) or the Micro BCA Protein Assay Kit (Pierce, Rockford, USA) according to the manufacturer’s instructions. Bovine serum albumine (Pierce, Rockford, USA) was used as a standard. Each measurement of protein concentration was performed in duplicates.
2.2.4.3 Quantitative Determination of Cyclic AMP (cAMP)
Intracellular cAMP content of Calu-3 cells was quantitatively assessed with a “Direct cAMP Enzyme Immunoassay Kit” (Sigma-Aldrich, Taufkirchen, Germany). Cells were grown in 6-well plates until the reached full confluence and treated with different compounds (HBSS, 10 µM foskolin, 10 µM terbutaline and 1 mg/ml Tip peptide) for 15 minutes at 37°C. After this incubation lysis of cells was achieved by treatment of cells with 0.1 M HCl + 0.5% Triton X-100 for 20 minutes at room temperature. Samples from forskolin and terbutaline treated cells were diluted 1:10 with lysis buffer before measurement of cAMP content. Assessment of cAMP levels was performed according to the manufacturer’s instructions and normalized to protein contents of the samples.
2.2.4.4 Streptavidin Affinity Chromatography
Calu-3 cells (8 x 107 cells per experiment) were recovered from the cell culture dish by scraping with 10 ml HBSS + 10 mM Hepes pH 7.4 + “Complete Protease Inhibitor Cocktail” (Sigma-Aldrich, Taufkirchen, Germany) and lysed by sonication. Cell debris was removed by centrifugation with 3500 x g at 4°C for 20 min and supernatant was passed through a 0.45 µm-filter (Millipore, Bedford, USA). Biotinylated human circular Tip peptide (bTip) was added to a final concentration of 250 µg/ml. After overnight incubation at 4°C on an overhead shaker, bTip and interacting proteins were purified using a ÄKTAFPLC
liquid chromatography system (Amersham Biosciences, Uppsala, Sweden) with a HiTrap
Streptavidin HP column (1 ml column volume (CV); GE Healthcare, Uppsala, Sweden).
The column was equilibrated with 10 CV running buffer before the bTip-containing cell lysate was injected. After washing the column with 10 CV running buffer, elution of interacting proteins was started by subsequent injection of 2 CV elution buffer 1, 2 CV elution buffer 2 and 5 CV elution buffer 3. The flow rate was 1 ml/min during equilibration and washing steps whereas sample injection and elution occurred with 0.3 ml/min. Eluted proteins were collected in 1 ml fractions and subjected to 4 – 20% gradient Tris-Glycine SDS-polyacrylamide gels (Invitrogen, Carlsbad,USA).
In addition, control experiments with Calu-3 cell lysate alone, with Calu-3 lysate + D-Biotin (Sigma-Aldrich, Taufkirchen, Germany), with Calu-3 lysate + biotinylated mutant Tip peptide and with Calu-3 lysate + biotinylated scrambled Tip peptide were performed.
Running buffer:
HBSS + 10 mM Hepes pH 7.4
Elution buffer 1:
500 µM N,N’-diacetylchitobiose in running buffer
Elution buffer 2:
5 mg/ml Tip peptide in running buffer
Elution buffer 3:
50 mM ammonium acetate, 0.5 M NaCl, pH 4.0
2.2.4.5 Surface Plasmon Resonance Analyses
Sugar binding studies were carried out using a Biacore 3000 surface plasmon resonance (SPR) sensor (Biacore, Uppsala, Sweden) with control software version 4.0 and Sensor Chip CM5 (carboxymethylated dextran surface). All assays were carried out at 25°C.
Human recombinant TNF-α and Tip peptide were immobilized via amine groups in two flow cells, one flow cell served as matrix control. The chip surface was first activated following a standard EDC/NHS protocol95 with HBS-P buffer + 1 mM CaCl2 used as the running buffer. TNF-α at a concentration of 50 µg/ml and peptides at a concentration of 1 mg/ml in HBS-P buffer were injected followed by the injection of 1 M ethanolamine
(pH 8.5) to inactivate the residual active groups. N,N’-diacetylchitobiose and cellobiose (100 µM in HBS-P + 1 mM CaCl2) were injected and capture of the analytes was documented.
In another series of experiments HBS-EP was used as the running buffer to evaluate the influence of Ca2+ ions on the lectin-like activity of TNF-α and the Tip peptide.
HBS-P buffer (Biacore, Uppsala, Sweden) + 1 mM CaCl2:
10 mM Hepes pH 7.4, 150 mM NaCl, 0.005% v/v Surfactant P20, 1 mM CaCl2
HBS-EP buffer (Biacore, Uppsala, Sweden):
10 mM Hepes pH 7.4, 150 mM NaCl, 3 mM EDTA, 0.005% v/v Surfactant P20
2.2.4.6 SDS-Polyacrylamide Gel Electrophoresis (SDS-PAGE)
Proteins were separated according to their molecular weight by discontinuous SDS-PAGE 96. Protein samples were mixed with 2x Laemmli reducing sample buffer (Biorad, Munich, Germany) and heated for 10 min at 95°C. Membrane protein preparations were heated at 40°C for 15 min. A 50-µg protein sample and 10 µl of SeeBlue Pre-stained Standard (Invitrogen, Carlsbad, USA) were separated in SDS-PAGE. Therefore, SDS-polyacrylamide mini gels of the size of 8.0 × 7.3 × 0.1 cm, which comprise a 4% stacking gel and a resolving gel of suitable percentage, were prepared using the Miniprotean 3 gel system (Biorad, Munich, Germany).
Table 2.15: Composition of polyacrylamide gels.
Reagent Stacking gel Resolving gel
4% 7.5% 10% 12.5% 15%
Acrylamide/Bisacrylamide (30:0.8) 0.67 ml 2.5 ml 3.33 ml 4.17 ml 5 ml
0.5 M Tris-HCl pH 6.8 1.25 ml - - - -
1.5 M Tris-HCl pH 8.8 - 2.5 ml 2.5 ml 2.5 ml 2.5 ml
10% (w/v) SDS 0.1 ml 0.1 ml 0.1 ml 0.1 ml 0.1 ml
80% (w/v) glycerin - 1.2 ml 1.2 ml 1.2 ml 1.2 ml
H2O 3 ml 3.7 ml 2.8 ml 2 ml 1.1 ml
TEMED 3.8 µl 7.5 µl 7.5 µl 7.5 µl 7.5 µl
10% (w/v) APS 100 µl 100 µl 75 µl 75 µl 75 µl
2x Laemmli sample buffer (Biorad, Munich, Germany):
62.5 mM Tris-HCl (pH 6.8), 25% (w/v) glycerin, 2% (w/v) SDS, 0.01% (w/v) bromophenol blue, 8% (v/v) β-mercaptoethanol
Electrophoresis buffer:
25 mM Tris, 192 mM glycine, 0.1% (w/v) SDS
2.2.4.7 Native PAGE
For native (non-denaturing) PAGE the Novex Gel System (Invitrogen, Carlsbad, USA) was used with 4-20% Tris-Glycine Gels, Tris-Glycine Native Running Buffer and Tris- Glycine Native Sample Buffer according to the manufacturer’s instructions. During native electrophoresis, proteins are separated based on their charge to mass ratios.
2.2.4.8 Coomassie Staining of Proteins
Protein bands on polyacrylamide gels were visualized with SimplyBlue SafeStain (Invitrogen, Carslbad, USA):
After electrophoresis, the gels were washed three times for 10 min in H2O, incubated in SimplyBule SafeStain reagent for one hour at room temperature and washed in H2O for one to two hours or overnight. For documentation, images were captured with a Gene Genius Bio Imaging System (Syngene, Cambridge, United Kingdom).
2.2.4.9 Silver Staining of Proteins
The silver staining procedure according to Heukeshoven and Dernick 97 was performed as follows:
Gels were fixed for 30 min in fixing buffer 1, for 30 min in fixing buffer 2 and washed four times for 15 min in H2O. Staining was performed for 30 min in staining solution. Afterwards, gels were rinsed in H2O and incubated in developer. The reaction was stopped with stop solution. After 10 min, gels were washed in H2O and stored at 4°C.
Fixing buffer 1:
10% (v/v) acetic acid, 30% (v/v) ethanol
Fixing buffer 2:
30% (v/v) ethanol, 0.5 M sodium acetate, 0.5% (v/v) glutaraldehyde, 0.2% (w/v) sodium- thiosulfate
Staining solution:
0.1% (w/v) silver nitrate, 0.02% (v/v) formaldehyde
Developer:
2.5% (w/v) sodium carbonate, 0.01% (v/v) formaldehyde
Stop solution:
1% (v/v) acetic acid
2.2.4.10 In Gel Digest of Protein Bands for Mass Spectroscopic Analysis
Gel pieces with protein bands were cut out from silver-stained polyacrylamide gels. In a silanized Eppendorf cup protein bands were bleached with 15 mM potassium hexacyanoferrat/50 mM sodium thiosulfate. After washing the gel pieces 3-times for 15 min with H2O, proteins were reduced with 10 mM dithiotreitol (DTT) and alkylated with 55 mM iodoacetamide. Dehydration of gel slices was started by two washing steps with 50% (v/v) acetonitrile (ACN)/50 mM NH4HCO3 for 15 min and one washing step with ACN for 5 min. After removal of supernatants and desiccation of gel pieces in a SpeedVac (Eppendorf, Hamburg, Germany) they were covered with 2.5 ng/µL porcine modified trypsin (Promega) in 50 mM NH4HCO3 and incubated overnight at 37°C. Supernatants containing tryptic digests were collected. Gel pieces were incubated twice with 50% (v/v) ACN/1% (v/v) trifluor acetic acid (TFA) and the extracts were pooled with the tryptic digest samples. Peptides were dried in a SpeedVac. The dried digest was dissolved in 1% TFA.
Two µL thereof were desalted with a C18 µZiptip (Millipore) and washed three times with 10 µL 0.1% TFA within the Ziptip. The sample was eluated from the Ziptip with 0.8 µL HCCA solution and directly spotted onto the 600/384 MALDI anchor target (Bruker Daltonics) according to the dried-droplet method. HCCA solution consisted of 0.5 µg HCCA per milliliter dissolved in a 2:1 mix of MeCN and 0.1% TFA.
2.2.4.11 Mass Spectroscopy
Matrix Assisted Laser Desorption/Ionization Time-of-Flight (MALDI-TOF) mass spectra were measured with an Ultraflex TOF/TOF mass spectrometer in reflector and positive ion mode (Bruker Daltonik GmbH, Bremen, Germany). Ions were accelerated in an electric field of 25 kV. With this method the exact and sensitive identification of tryptic fragments of proteins of interest was possible. The mass spectrometer was externally calibrated with the peptide standard Pepmix (Bruker Daltonik GmbH, Bremen, Germany). Additionally an internal calibration was performed using keratin peaks, which further increased the mass accuracy to 50 ppm. Obtained peptide mass fingerprints, were used for database searches in order to identify the sample protein. The Mascot search engine was used together with NCBI (non-redundant) and MSDB databases to identify proteins that fit to the measured peptide mass fingerprints. For even more precise identification, peptide ions of single mass peaks were fragmented and fragments were analyzed in MS/MS mode.
The resulting peptide fragment amino acid sequences were again used for Mascot database searches (Matrix Science Inc., Boston, USA) in order to identify the respective proteins.
2.2.4.12 Western Blotting
Proteins from SDS-PAGE gels were transferred to Protean BA85 nitrocellulose membranes (Schleicher & Schuell, Dassel, Germany) using a Hoefer TE 22 Mighty Small Transphor Tank transfer unit (Amersham Biosciences, Uppsala, Sweden) with Towbin transfer buffer 98 at a constant current of 950 mA for one hour. After blotting, membranes were blocked with 5% (w/v) fat-free milk in TBS by slight shaking for 1 h at room temperature. Afterwards blots were incubated with antibodies against proteins of interest diluted 1:1000 in TBS + 0.05% (w/v) fat-free milk for 2 h at room temperature or overnight at 4°C. After four consecutive washing steps with TBS-T for 10 min bound antibody was detected using a 1:25000 dilution of horseradish peroxidase-conjugated secondary antibody (Dianova, Hamburg, Germany) for 2 h at room temperature. After three further washing steps with TBS-T and one washing step with TBS, Western blots were developed with Lumi-LightPlus Western Blotting Substrate (Roche Diagnostics, Penzberg, Germany) and photographed with a LAS-1000 Luminescence Image Analyzer using the Image Reader LAS 1000 Pro V2.1 software (Fujifilm, Düsseldorf, Germany) and analyzed with the Advanced Image Data Analyzer V3.12 software (Raytest GmbH, Straubenhardt, Germany). The used antibodies are listed in table 2.3.
