Aus der Klinik für Zahnärztliche Prothetik und Biomedizinische Werkstoffkunde des Zentrums für Zahn-, Mund- und Kieferheilkunde
der Medizinischen Hochschule Hannover
Pyrosequencing of supra- and subgingival biofilms from inflamed peri-implant and
periodontal sites
Dissertation
zur Erlangung des Doktorgrades der Zahnheilkunde in der Medizinischen Hochschule Hannover
vorgelegt von Simone Schaumann aus Hannover
Hannover 2015
Angenommen vom Senat der Medizinischen Hochschule Hannover am 22.04.2015 Gedruckt mit Genehmigung der Medizinischen Hochschule Hannover
Präsident: Prof. Dr. med. Christopher Baum
Betreuerin: Prof. Dr. med. dent. Meike Stiesch
Referent: Prof. Dr. med. Franz Bange
Korreferent: Prof. Dr. med. dent. Hüsamettin Günay
Tag der mündlichen Prüfung: 22.04.2015
Prüfungsausschussmitglieder:
Prof. Dr. med. dent. Harald Tschernitschek Prof. Dr. med. Matthias Fink
PD Dr. med. Björn Jüttner
Für meine Eltern
Inhaltsverzeichnis
1. Zusammenfassung ... 4
1.1 Einführung ... 4
1.2 Material und Methode ... 6
1.3 Ergebnisse ... 7
1.4 Diskussion ... 7
1.5 Schlussfolgerung ... 10
2. Literaturverzeichnis... 11
3. Anhang ... 15
3.1 Curriculum vitae ... 15
3.2 Erklärung ... 16
3.3 Danksagung ... 17
3.4 Schaumann S, et al. Pyrosequencing of supra- and subgingival biofilm from inflamed peri-implant and periodontal sites, BMC Oral Health 2014, 14:157 doi:10.1186/1472-6831-14-157 ... 18
Pyrosequencing of supra- and subgingival biofilms from inflamed peri-implant and periodontal sites
Veröffentlicht am 17.12.2014 im Journal BMC Oral Health (doi: 10.1186/1472-6831-14-157)
1. Zusammenfassung
Zielsetzung der Studie war die Untersuchung des Mikrobioms von supra- und submukosalen respektive supra- und subgingivalen Biofilmproben von erkrankten Implantaten oder Zähnen. Die Identifikation der bakteriellen Zusammensetzung der Proben erfolgte mittels 16S rRNA-Gen-basierter Sequenzanalyse. Die statistischen Auswertungen zeigten keine signifikanten Unterschiede zwischen den bakteriellen Mikrobiomen der untersuchten Lokalisationen.
1.1 Einführung
Dentale Implantate sind heute eine bevorzugte Therapieoption zur prothetischen Versorgung teil- und unbezahnter Patienten. Implantate zeigen gute Langzeitüberlebensraten, obwohl 10% der Implantate und 20% der Patienten bereits nach 5-10 Jahren die Zeichen einer entzündlichen Veränderung aufweisen [3, 27].
Diese periimplantären Infektionen werden unterteilt in Infektionen des umgebenden Weichgewebes ohne Knochenbeteiligung - die sogenannte periimplantäre Mukositis, und in Infektion mit Beteiligung des umgebenden Knochens – die sogenannte Periimplantitis [42]. Ein ätiologischer Faktor für die Entwicklung einer periimplantären Infektion ist das Vorhandensein von Mikroorganismen [24], die mit Hilfe einer Glykoproteinschicht schon kurze Zeit nach der Implantation die Implantatoberfläche besiedeln [11, 37]. Hunderte verschiedene Bakterienspezies verbinden sich innerhalb kurzer Zeit zu komplexen bakteriellen Lebensgemeinschaften, dem oralen Biofilm. Dieser Biofilm besteht initial aus Streptococcen, Actinomyceten und Veillonellen, die als Erstbesiedler trotz Speichelfluss auf der Glykoproteinschicht oraler Oberflächen und an bereits adhärenten Bakterien binden. Durch die Anlagerung von Fusobacterium, welches als Brücke zwischen den Erst- und Spätbesiedlern fungiert, kommt es durch Verbindung mit Spätbesiedlern zum
Hinblick auf Ernährung, Wachstum und Lebensbedingungen bietet und die Pathogenität des Biofilms steigern kann [18, 33].
Viele Studien gehen davon aus, dass es Parallelen zwischen Periimplantitis und Parodontitis gibt, die nicht nur die Zusammensetzung der bakteriellen Biofilme betrifft, sondern auch die immunologische Gewebeantwort [15]. Trotz dieser Gemeinsamkeiten zwischen periimplantären und parodontalen Erkrankungen führen in der Parodontaltherapie bewährte Therapieprotokolle bei Periimplantitis nicht immer zum Heilungserfolg [30] und zeigen hohe Rezidivraten [9].
Unterschiede zwischen der periimplantären und parodontalen Erkrankung bestehen besonders hinsichtlich der Ausdehnung der entzündlichen Läsion in die Binde- und Knochengewebe. Ursächlich hierfür sind die Orientierung der Kollagenfasern am Implantat im Vergleich zum Zahn, die reduzierte Vaskularisierung der periimplantären Gewebe und die unterschiedliche Zusammensetzung der am Entzündungsgeschehen beteiligten Zellen. Bei einer periimplantären Läsion kommt es frühzeitig zur Beteiligung der knöchernen Strukturen, während das parodontale Ligament des Zahnes die apikale Ausbreitung der Entzündungsprozesse durch Fibrinosierung verzögert [5, 21]. Es liegt nahe, dass die Biofilmanlagerung durch die chemischen Eigenschaften der Implantatmaterialien oder der Zahnhartsubstanz ebenfalls maßgeblich beeinflusst wird und es wurde gezeigt, dass chemische und physikalische Eigenschaften wie Material, Oberflächenrauhigkeit, freie Oberflächenenergie, aber auch die Implantat-Abutment Konfiguration die Biofilmbildung wesentlich modulieren können [14, 20, 41].
Aufgrund dieser Zusammenhänge ist es sowohl für das Verständnis der pathologischen Mechanismen, als auch der präventiven und therapeutischen Maßnahmen von großer Bedeutung die Biofilmzusammensetzung auf verschiedenen Oberflächen und unterschiedlichen anatomischen Lokalisationen exakt zu erfassen.
Aus diesem Grund wurde die Biofilmzusammensetzung der Periimplantitis und der Parodontitis in den letzten Jahrzehnten in zahlreichen Publikationen beschrieben.
Abhängig von der Untersuchungsmethodik zeigten die selektiven Methoden zur Keimbestimmung, wie beispielsweise Kultivierungsmethoden [4, 6, 22, 26] und Hybridisierungsmethoden [25, 28, 29, 32] eine große Übereinstimmung der mikrobiellen Zusammensetzung an Implantaten und Zähnen sowohl in gesunden Kontrollen als auch in periimplantär und parodontal erkrankten Läsionen.
Limitierende Faktoren bei diesen Methoden sind die begrenzte Kultivierbarkeit einer Anzahl von Bakterien unter Laborbedingungen sowie der Nachweis vorselektierter Markerkeime bei der Hybridisierungsmethode. Auch die Licht-, Dunkelfeld- und Elektronenmikroskopie haben entscheidend zum Verständnis der Biofilmarchitektur beigetragen [10, 18]. Seit den frühen 2000’er Jahren werden Sequenziermethoden als nicht-selektive, kulturunabhängige Untersuchungsmethoden zur Bestimmung der bakteriellen Diversität genutzt, mit dem Ziel einen erweiterten Einblick in die Komposition und Diversität des oralen Mikrobioms zu gewinnen.
Das Ziel der vorliegenden Studie war die mikrobielle Zusammensetzung der supra- und submukosalen bzw. supra- und subgingivalen Biofilme durch ein modernes Sequenzierungsverfahren an erkrankten Implantaten und Zähnen zu charakterisieren.
1.2 Material und Methode
In die hier vorliegende Studie konnten 7 Patienten mit generalisierter, chronischer Parodontitis sowie mindestens einem periimplantär erkrankten Implantat einbezogen werden. Die Patienten wurden einer eingehenden medizinischen und zahnmedizinischen Anamnese und Untersuchung unterzogen. Nach der Befundung der umgebenden Gewebe auf Entzündungszeichen wie Rötung, Schwellung und Suppuration wurden bei allen Patienten die Sondierungstiefen und Blutungspunkte mittels einer druckkalibrierten Sonde an 4 Stellen pro Implantat und Zahn dokumentiert. Die Implantate und Zähne mit den größten Sondierungstiefen und schwersten Entzündungszeichen wurden für die Biofilmentnahme ausgewählt. Die Probenentnahmeregion wurde mit Watterollen trockengelegt und der supramukosale und -gingivale bzw. submukosale und -gingivale Biofilm mit jeweils 2 sterilen Papierspitzen entnommen. Die Papierspitzen wurden separat in Eppendorfgefäßen gelagert und umgehend bei -80 °C tiefgefroren.
Die bakterielle DNA wurde nach etablierten Protokollen extrahiert und für den Sequenziervorgang auf einem ROCHE GS FLX Sequencer vorbereitet. Die taxonomische Zuordnung der Sequenzen erfolgte mit dem Programm QIIME und der Referenzdatenbank „greengenes“. Nach Überführung der Daten in die Programmiersprache R (mittels Bioconductor package phyloseq) erfolgte die
statistische Auswertung der Daten und die grafischen Analysen mittels Heat Map, Principal Coordinate Analyses und Shannon-Diversity Index.
1.3 Ergebnisse
Im Rahmen der Untersuchung wurden (1) Bakterien der Gattung Rothia und der Familie Streptococcaceae an Implantaten und Zähnen zahlreich nachgewiesen, (2) keine signifikanten Unterschiede der Mikrobiome zwischen erkrankten Implantaten und Zähnen gefunden und (3) keine signifikanten Unterschiede der Mikrobiome zwischen supra- und submukosalem bzw. supra- und subgingivalem Biofilm nachgewiesen.
1.4 Diskussion
Nach aktueller Literaturlage wurde in dieser Studie erstmals das supra- und submukosale sowie das supra- und subgingivale Microbiom von periimplantär erkrankten Implantaten und parodontal erkrankten Zähnen aus demselben Patienten mittels 454 Pyrosequenzierung untersucht und gegenübergestellt.
Die in dieser Studie angewendete Sequenziermethode ist im Vergleich zu anderen in vergleichbaren Untersuchungen angewandten Methoden geeignet das gesamte mikrobielle Spektrum der entnommenen Proben nachzuweisen und liefert damit einen breiten Überblick über alle im Biofilm vorhandenen Bakterien.
Die Limitationen der Studie ergaben sich aus der begrenzten Anzahl der Studienteilnehmer und der Vielfalt der klinischen Erkrankungsbilder. Die Aufbereitung der Biofilmproben und die Auswahl der Primer zur Amplifikation sind weitere methodische Faktoren, die großen Einfluss auf das Ergebnis nehmen können. Eine weitere Einschränkung dieser Untersuchung war die Sequenzierungslänge von 550 Basenpaaren, damit war eine Zuordnung der Taxa auf Speziesebene nicht möglich.
Die in dieser Studie an Implantaten und Zähnen dominierende Bakteriengattung Rothia wurde in zahlreichen Publikationen als ein oraler Keim beschrieben [23, 31, 36]. Die Gattung Rothia wurde sowohl bei parodontal und periimplantär gesunden Probanden [7, 17], als auch bei parodontalen Infektionen nachgewiesen [16, 23]. Die Arbeitsgruppe Abusleme et al. [1] untersuchten das Mikrobiom gesunder und parodontal erkrankter Zähne und zeigten, dass die Häufigkeit der Gattung Rothia an parodontal erkrankten Zähnen im Vergleich zu gesunden Kontrollen deutlich
abnahm. In vorausgegangenen Studien, welche mittels Sequenziermethoden das Keimspektrum an erkrankten Zähnen und Implantaten untersuchten, fand diese Gattung keine besondere Erwähnung [8, 13, 19]. Die Ergebnisse der hier zusammengefassten Untersuchung legten nah, die Bedeutung der Gattung Rothia für periimplantäre und parodontale Erkrankungen neu zu bewerten und weiter zu untersuchen.
Die Familie Streptococcaceae, welche ebenfalls zu den dominierenden Bakterienarten dieser Studie zählte, enthält neben Gram-positiven Streptococcen, welche der gesunden oralen Flora zuzuordnen sind auch pathogene Gattungen.
Diese Bakterien sind als Erstbesiedler sowohl in supra- als auch in subgingivalen Biofilmen beschrieben worden [18]. Um den Einfluss dieser Pathogene auf periimplantäre Entzündungsprozesse näher beurteilen zu können, sollte in weiteren Studien die Differenzierung der Keime bis auf Spezies Ebene erfolgen. Die Gattung Actinomyceten wurde im Vergleich zu vorausgegangenen Studien in der vorliegenden Untersuchung nur in geringer Frequenz nachgewiesen, was ein Hinweis auf den entzündlichen Charakter der untersuchten Läsionen sein könnte [1, 32, 39, 40]. Allerdings ist ebenfalls bekannt, dass die Gattung Actinomyceten unter Verwendung von Universalprimern nicht sicher nachgewiesen werden kann [38].
Erkrankte Implantate waren in den supra- und submukosalen Arealen von überwiegend Gram-positiven Bakterien besiedelt, während der Anteil Gram-negativer Bakteriengattungen in den subgingivalen Arealen der Zähne gegenüber den supragingivalen Arealen deutlich erhöht war. Im Gegensatz zu diesen Ergebnissen fand die Arbeitsgruppe Kumar et al. [19] an periimplantär erkrankten Implantaten überwiegend Gram-negative Bakterien.
Die Zusammensetzung der Mikrobiome der untersuchten Biofilme zeigte große interindividuelle Unterschiede, aber keine signifikanten Unterschiede zwischen periimplantären und parodontalen Läsionen. Diese Beobachtung spricht für die Möglichkeit einer intraoralen Transmission von Bakterien zwischen Zähnen und Implantaten. Die Hypothese einer Transmission und Reservoir Funktion parodontal erkrankter Zähne als Ursache für die Infektion von Implantaten wurde bereits in vorausgegangenen Studien postuliert und klinisch verifiziert [2, 34, 35]. Entgegen den Ergebnissen dieser Studien, die für eine Transmission von Pathogenen zwischen verschiedenen intraoralen Strukturen sprechen, zeigten Dabdoub et al. [8]
Unterschiede der mikrobiellen Zusammensetzung an Implantaten und Zähnen innerhalb eines Patienten auf.
Der Vergleich der mikrobiellen Diversitäten zwischen Implantaten und Zähnen zeigte in unserer Studie keine signifikanten Unterschiede. Dieses Ergebnis steht im Kontrast zu Untersuchungen von Kumar et al. [19], die an erkrankten Implantaten eine signifikant geringere Diversität feststellte als an parodontal erkrankten Zähnen und daraus folgerte, das Periimplantitis im Vergleich zur Parodontitis eine einfache, wenig-komplexe Infektion ist.
Bisher liegen keine Untersuchungen vor, die die bakterielle Zusammensetzung von supra- und submukosalen respektive supra- und subgingivalen Biofilmen von periimplantär erkrankten Implantaten und parodontal erkrankten Zähnen mittels Sequenziertechniken untersucht und verglichen haben. In der vorliegenden Studie wurden keine Unterschiede der bakteriellen Zusammensetzung gefunden. Diese Beobachtung könnte ein Hinweis darauf sein, dass supramukosale und -gingivale Biofilme als ein bakterielles Reservoir für submukosale und -gingivale Biofilme fungieren [18, 32]. Im Rahmen anderer Untersuchungen, welche Hybridisierungstechniken für die Identifikation der Bakterien verwendeten, konnten ebenfalls große Übereinstimmungen der bakteriellen Zusammensetzung supra- und submukosaler sowie supra- und subgingivaler Biofilme gefunden werden [32, 40].
Galimanas et al. [12] untersuchte mittels Sequenziermethode supra- und subgingivale Biofilme von parodontal erkrankten Zähnen und fand ebenfalls keine deutlichen Unterschiede zwischen der bakteriellen Zusammensetzung der supra- und subgingivalen Region.
Die Ergebnisse unserer Untersuchungen zeigten eine größere Ähnlichkeit zwischen supra- und submukosalen Biofilmen an Implantaten als zwischen den supra- und subgingivalen Biofilmen von Zähnen. Dieses könnte durch den unterschiedlichen anatomischen Aufbau der umgebenden Gewebe an Implantaten und Zähnen begründet sein.
1.5 Schlussfolgerung
Die Ergebnisse dieser Studie zeigten keine signifikanten Unterschiede der mikrobiellen Zusammensetzung für die untersuchten Implantate oder Zähne. Diese Ähnlichkeiten weisen darauf hin, dass die Zusammensetzung der bakteriellen Biofilme nicht geeignet ist unterschiedliche pathologische Prozesse zwischen der Periimplantitis und der Parodontitis zu erklären und vielmehr der histologische Aufbau und die unterschiedliche Beschaffenheit der Oberflächen den Krankheitsprozess entscheidend beeinflusst. Weiter zeigen die Ergebnisse, dass die Transmission von Bakterien zwischen Zähnen und Implantaten ebenso klinisch von Relevanz sein kann, wie die Übertragung von Bakterien von supragingivalen und supramukosalen Arealen in die subgingivalen und submukosalen Areale. Die wiederholte Reinigung parodontal erkrankter Zähne und die Entfernung supramukosaler Biofilme kann damit eine effektive präventive Maßnahme zur Vermeidung periimplantärer Erkrankungen sein.
2. Literaturverzeichnis
1. Abusleme L, Dupuy AK, Dutzan N et al: The subgingival microbiome in health and periodontitis and its relationship with community biomass and inflammation. The ISME journal 2013, 7:1016-1025.
2. Aoki M, Takanashi K, Matsukubo T et al: Transmission of periodontopathic bacteria from natural teeth to implants. Clinical implant dentistry and related research 2012, 14:406-411.
3. Atieh MA, Alsabeeha NH, Faggion CM, Jr. et al: The frequency of peri-implant diseases: A systematic review and meta-analysis. Journal of periodontology 2013, 84:1586-1598.
4. Augthun M, Conrads G: Microbial findings of deep peri-implant bone defects.
The International journal of oral & maxillofacial implants 1997, 12:106-112.
5. Berglundh T, Zitzmann NU, Donati M: Are peri-implantitis lesions different from periodontitis lesions? Journal of clinical periodontology 2011, 38 Suppl 11:188- 202.
6. Botero JE, Gonzalez AM, Mercado RA et al: Subgingival microbiota in peri- implant mucosa lesions and adjacent teeth in partially edentulous patients.
Journal of periodontology 2005, 76:1490-1495.
7. da Silva ES, Feres M, Figueiredo LC et al: Microbiological diversity of peri- implantitis biofilm by sanger sequencing. Clinical oral implants research 2014, 25:1192-1199.
8. Dabdoub SM, Tsigarida AA, Kumar PS: Patient-specific analysis of periodontal and peri-implant microbiomes. Journal of dental research 2013, 92:168S- 175S.
9. Esposito M, Grusovin MG, Worthington HV: Treatment of peri-implantitis:
What interventions are effective? A cochrane systematic review. European journal of oral implantology 2012, 5 Suppl:S21-41.
10. Faveri M, Figueiredo LC, Shibli JA et al: Microbiological diversity of peri- implantitis biofilms. Advances in experimental medicine and biology 2015, 830:85-96.
11. Furst MM, Salvi GE, Lang NP et al: Bacterial colonization immediately after installation on oral titanium implants. Clinical oral implants research 2007, 18:501-508.
12. Galimanas V, Hall MW, Singh N et al: Bacterial community composition of chronic periodontitis and novel oral sampling sites for detecting disease indicators. Microbiome 2014, 2:32.
13. Griffen AL, Beall CJ, Campbell JH et al: Distinct and complex bacterial profiles in human periodontitis and health revealed by 16s pyrosequencing. The ISME journal 2012, 6:1176-1185.
14. Grossner-Schreiber B, Teichmann J, Hannig M et al: Modified implant surfaces show different biofilm compositions under in vivo conditions. Clinical oral implants research 2009, 20:817-826.
15. Heitz-Mayfield LJ, Lang NP: Comparative biology of chronic and aggressive periodontitis vs. Peri-implantitis. Periodontology 2000 2010, 53:167-181.
16. Kataoka H, Taniguchi M, Fukamachi H et al: Rothia dentocariosa induces tnf- alpha production in a tlr2-dependent manner. Pathogens and disease 2014, 71:65-68.
17. Kistler JO, Booth V, Bradshaw DJ et al: Bacterial community development in experimental gingivitis. PloS one 2013, 8:e71227.
18. Kolenbrander PE, Palmer RJJ: Human oral bacterial biofilms. In: Microbial biofilms. Hrsg. Ghannoum M, O'Toole G, Auflage edn. Washington D.C.: ASM Press; 2004: 85-117.
19. Kumar PS, Mason MR, Brooker MR et al: Pyrosequencing reveals unique microbial signatures associated with healthy and failing dental implants.
Journal of clinical periodontology 2012, 39:425-433.
20. Lang NP, Berglundh T, Working Group 4 of Seventh European Workshop on P: Periimplant diseases: Where are we now?--consensus of the seventh european workshop on periodontology. Journal of clinical periodontology 2011, 38 Suppl 11:178-181.
21. Lang NP, Bosshardt DD, Lulic M: Do mucositis lesions around implants differ from gingivitis lesions around teeth? Journal of clinical periodontology 2011, 38 Suppl 11:182-187.
22. Leonhardt A, Renvert S, Dahlen G: Microbial findings at failing implants.
Clinical oral implants research 1999, 10:339-345.
23. Lesher RJ, Gerencser VF, Morrison DJ: Presence of rothia dentocariosa strain 477 serotype 2 in gingiva of patients with inflammatory periodontal disease.
24. Lindhe J, Meyle J, Group DoEWoP: Peri-implant diseases: Consensus report of the sixth european workshop on periodontology. Journal of clinical periodontology 2008, 35:282-285.
25. Maximo MB, de Mendonca AC, Renata Santos V et al: Short-term clinical and microbiological evaluations of peri-implant diseases before and after mechanical anti-infective therapies. Clinical oral implants research 2009, 20:99-108.
26. Mombelli A, van Oosten MA, Schurch E, Jr. et al: The microbiota associated with successful or failing osseointegrated titanium implants. Oral microbiology and immunology 1987, 2:145-151.
27. Mombelli A, Muller N, Cionca N: The epidemiology of peri-implantitis. Clinical oral implants research 2012, 23 Suppl 6:67-76.
28. Persson GR, Salvi GE, Heitz-Mayfield LJ et al: Antimicrobial therapy using a local drug delivery system (arestin) in the treatment of peri-implantitis. I:
Microbiological outcomes. Clinical oral implants research 2006, 17:386-393.
29. Persson GR, Samuelsson E, Lindahl C et al: Mechanical non-surgical treatment of peri-implantitis: A single-blinded randomized longitudinal clinical study. Ii. Microbiological results. Journal of clinical periodontology 2010, 37:563-573.
30. Renvert S, Samuelsson E, Lindahl C et al: Mechanical non-surgical treatment of peri-implantitis: A double-blind randomized longitudinal clinical study. I:
Clinical results. Journal of clinical periodontology 2009, 36:604-609.
31. Segata N, Haake SK, Mannon P et al: Composition of the adult digestive tract bacterial microbiome based on seven mouth surfaces, tonsils, throat and stool samples. Genome biology 2012, 13:R42.
32. Shibli JA, Melo L, Ferrari DS et al: Composition of supra- and subgingival biofilm of subjects with healthy and diseased implants. Clinical oral implants research 2008, 19:975-982.
33. Socransky SS, Haffajee AD: Dental biofilms: Difficult therapeutic targets.
Periodontology 2000 2002, 28:12-55.
34. Sumida S, Ishihara K, Kishi M et al: Transmission of periodontal disease- associated bacteria from teeth to osseointegrated implant regions. The International journal of oral & maxillofacial implants 2002, 17:696-702.
35. Takanashi K, Kishi M, Okuda K et al: Colonization by porphyromonas gingivalis and prevotella intermedia from teeth to osseointegrated implant regions. The Bulletin of Tokyo Dental College 2004, 45:77-85.
36. Tanner AC, Haffer C, Bratthall GT et al: A study of the bacteria associated with advancing periodontitis in man. Journal of clinical periodontology 1979, 6:278- 307.
37. van Winkelhoff AJ, Goene RJ, Benschop C et al: Early colonization of dental implants by putative periodontal pathogens in partially edentulous patients.
Clinical oral implants research 2000, 11:511-520.
38. Wade WG: Has the use of molecular methods for the characterization of the human oral microbiome changed our understanding of the role of bacteria in the pathogenesis of periodontal disease? Journal of clinical periodontology 2011, 38 Suppl 11:7-16.
39. Ximenez-Fyvie LA, Haffajee AD, Socransky SS: Comparison of the microbiota of supra- and subgingival plaque in health and periodontitis. Journal of clinical periodontology 2000, 27:648-657.
40. Ximenez-Fyvie LA, Haffajee AD, Socransky SS: Microbial composition of supra- and subgingival plaque in subjects with adult periodontitis. Journal of clinical periodontology 2000, 27:722-732.
41. Yoshinari M, Oda Y, Kato T et al: Influence of surface modifications to titanium on oral bacterial adhesion in vitro. Journal of biomedical materials research 2000, 52:388-394.
42. Zitzmann NU, Berglundh T: Definition and prevalence of peri-implant diseases.
Journal of clinical periodontology 2008, 35:286-291.
3.2 Erklärung
(nach § 2 Abs. 2 Nrn. 6 und 7)
Ich erkläre, dass ich die der Medizinischen Hochschule Hannover zur Promotion eingereichte Dissertation mit dem Titel
Pyrosequencing of supra- and subgingival biofilms from inflamed peri-implant and periodontal sites
in der Klinik für Zahnärztliche Prothetik und Biomedizinische Werkstoffkunde des Zentrums für Zahn-, Mund- und Kieferheilkunde der Medizinischen Hochschule Hannover unter Betreuung von Frau Prof.
Dr. med. dent. Meike Stiesch ohne sonstige Hilfe durchgeführt und bei der Abfassung der Dissertation keine anderen als die dort aufgeführten Hilfsmittel benutzt habe. Die Sequenzierung erfolgte in Kooperation mit dem Institut für klinische Molekularbiologie (IKMB) der Christian-Albrechts-Universität zu Kiel. Die statistische Auswertung wurde in Zusammenarbeit mit dem Institut für Biometrie der Medizinischen Hochschule Hannover durchgeführt.
Die Gelegenheit zum vorliegenden Promotionsverfahren ist mir nicht kommerziell vermittelt worden.
Insbesondere habe ich keine Organisation eingeschaltet, die gegen Entgelt Betreuerinnen und Betreuer für die Anfertigung von Dissertationen sucht oder die mir obliegenden Pflichten hinsichtlich der Prüfungsleistungen für mich ganz oder teilweise erledigt.
Ich habe diese Dissertation bisher an keiner in- oder ausländischen Hochschule zur Promotion eingereicht. Weiterhin versichere ich, dass ich den beantragten Titel bisher noch nicht erworben habe.
Die Ergebnisse der Dissertation wurden im Journal BMC Oral Health unter oben genanntem Titel veröffentlicht.
Hannover, den 15.12.2014 Simone Schaumann
3.3 Danksagung
Ich danke Frau Prof. Dr. med. dent. Meike Stiesch für die freundliche Überlassung des Dissertationsthemas sowie die motivierende Unterstützung und Förderung bei der Durchführung dieser Arbeit.
Ganz besonders möchte ich mich bei Herrn Prof. Dr. med. dent. Jörg Eberhard bedanken, der mir in allen Phasen dieser Arbeit mit seinem wissenschaftlichen Rat zur Seite stand und durch seine unermüdliche Unterstützung entscheidend zum Gelingen beigetragen hat.
Von ganzem Herzen danke ich meinen Eltern, die mit ihrer großartigen und liebevollen Unterstützung meinen bisherigen Werdegang begleitet und gefördert haben.
Meinem Freund Giuseppe danke ich dafür, dass er mir während des gesamten Studiums und der Dissertation mit aufmunternden Worten und Hilfe zur Seite stand.
3.4 Schaumann S, et al. Pyrosequencing of supra- and subgingival biofilms from inflamed peri-implant and periodontal sites, BMC Oral Health 2014, 14:157 doi:10.1186/1472-6831-14-157
This Provisional PDF corresponds to the article as it appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon.
Pyrosequencing of supra- and subgingival biofilms from inflamed peri-implant and periodontal sites
BMC Oral Health2014,14:157 doi:10.1186/1472-6831-14-157 Simone Schaumann (schaumann.simone@mh-hannover.de)
Ingmar Staufenbiel (staufenbiel.ingmar@mh-hannover.de) Ralph Scherer (scherer.ralph@mh-hannover.de) Markus Schilhabel (m.schilhabel@ikmb.uni-kiel.de) Andreas Winkel (winkel.andreas@mh-hannover.de) Sascha Nico Stumpp (stumpp.nico@mh-hannover.de)
Jörg Eberhard (Eberhard.joerg@mh-hannover.de) Meike Stiesch (stiesch.meike@mh-hannover.de)
ISSN 1472-6831 Article type Research article Submission date 28 August 2014 Acceptance date 15 December 2014
Publication date 17 December 2014
Article URL http://www.biomedcentral.com/1472-6831/14/157
Like all articles in BMC journals, this peer-reviewed article can be downloaded, printed and distributed freely for any purposes (see copyright notice below).
Articles in BMC journals are listed in PubMed and archived at PubMed Central.
For information about publishing your research in BMC journals or any BioMed Central journal, go to http://www.biomedcentral.com/info/authors/
BMC Oral Health
© 2014 Schaumannet al.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which
Pyrosequencing of supra- and subgingival biofilms from inflamed peri-implant and periodontal sites
Simone Schaumann1
Email: schaumann.simone@mh-hannover.de Ingmar Staufenbiel2
Email: staufenbiel.ingmar@mh-hannover.de Ralph Scherer3
Email: scherer.ralph@mh-hannover.de Markus Schilhabel4
Email: m.schilhabel@ikmb.uni-kiel.de Andreas Winkel1
Email: winkel.andreas@mh-hannover.de Sascha Nico Stumpp1
Email: stumpp.nico@mh-hannover.de Jörg Eberhard5*,†
* Corresponding author
Email: Eberhard.joerg@mh-hannover.de Meike Stiesch1,†
Email: stiesch.meike@mh-hannover.de
1 Department of Prosthetic Dentistry and Biomedical Materials Science, Hannover Medical School, Hannover, Germany
2 Department of Conservative Dentistry, Periodontology and Preventive Dentistry, Hannover Medical School, Hannover, Germany
3 Institute for Biometry, Hannover Medical School, Hannover, Germany
4 Institute of Clinical Molecular Biology, Christian-Albrechts-University Kiel, Kiel, Germany
5 Peri-implant and Oral Infections, Department of Prosthetic Dentistry and Biomedical Materials Science, Hannover Medical School, Carl-Neuberg-Strasse 1, 30625 Hannover, Germany
† Equal contributors.
Abstract
Background
To investigate the microbial composition of biofilms at inflamed peri-implant and periodontal tissues in the same subject, using 16S rRNA sequencing.
Methods
Supra- and submucosal, and supra- and subgingival plaque samples were collected from 7 subjects suffering from diseased peri-implant and periodontal tissues. Bacterial DNA was isolated and 16S rRNA genes were amplified, sequenced and aligned for the identification of bacterial genera.
Results
43734 chimera-depleted, denoised sequences were identified, corresponding to 1 phylum, 8 classes, 10 orders, 44 families and 150 genera. The most abundant families or genera found in supramucosal or supragingival plaque were Streptoccocaceae, Rothia and Porphyromonas. In submucosal plaque, the most abundant family or genera found were Rothia, Streptococcaceae and Porphyromonas on implants. The most abundant subgingival bacteria on teeth were Prevotella, Streptococcaceae, and TG5. The number of sequences found for the genera Tannerella and Aggregatibacter on implants differed significantly between supra- and submucosal locations before multiple testing. The analyses demonstrated no significant differences between microbiomes on implants and teeth in supra- or submucosal and supra- or subgingival biofilms .
Conclusion
Diseased peri-implant and periodontal tissues in the same subject share similiar bacterial genera and based on the analysis of taxa on a genus level biofilm compositions may not account for the potentially distinct pathologies at implants or teeth.
Keywords
Deep-sequencing, 16S rRNA sequencing, Diseased peri-implant tissues, Diseased periodontal tissues, Supragingival plaque, Subgingival plaque, Biofilm, Microbiology
Background
Dental implants are commonly used to replace missing teeth in partially edentulous or edentulous patients. Inflammation of the peri-implant soft and hard tissue is the most frequent adverse event and may compromise the long-term stability of osseointegrated implants.
While peri-implant mucositis affectes only soft tissues, peri-implantitis also involves the supporting bone. The prevalence of peri-implantitis during 5–10 years after successful osseointegration seems to be of the order of 10% of implants and 20% of patients [1].
Accepted risk factors for peri-implant related diseases are poor oral hygiene, a history of periodontitis and cigarette smoking [2]. Biofilms have been described in detail by using hybridization techniques in peri-implantitis [3-6] and recently by high-throughput sequencing techniques in failing implants [7-9]. Supra- and submucosal biofilms on implants in individual subjects have not been described by using high-throughput sequencing techniques, although it has been shown that the composition of supragingival biofims significantly affects subgingival biofilm formation [10-12]. In consequence, supramucosal biofilms may also determine the composition of the submucosal microflora. The diverse surface properties (chemical composition, surface roughness, surface free energy) and tissue architecture at implants and teeth may affect bacterial adhesion and growth of biofilms as well [13] and may account for the proposed differences in inflammatory response at implants and teeth [14].
Therefore the aim of the following study was to further characterise the microbial composition of supra- and submucosal, repectively supra- and subgingival plaques at diseased implants and teeth.
Methods
Subject selection
Subjects included in the study had at least ≥30% sites with PD ≥4 mm and evident radiographic bone loss. All patients were partially edentulous (not fewer than 8 teeth), with at least 1 functioning oral implant restored with crowns or prostheses. Inclusion criteria were:
(A) one implant and teeth showing signs of active inflammation (tissue with manifest signs of inflammation (redness and swelling), bleeding on probing (BOP) and pocket depth (PD) ≥ 4 mm in at least one site and evidence of radiographic bone loss), (B) implants had to be functioning for at least 1 year. Exclusion criteria were: (A) any peri-implant or periodontal treatment 6 months before sampling. (B) systemic diseases such as diabetes mellitus, (C) smoking, (D) antibiotic or immunosuppressant medication within the previous 3 months.
A comprehensive medical history was recorded, followed by clinical and radiographic examination. Informed consent was obtained and the study was approved by the local Ethics committee of Hannover Medical School (no. 4348).
Clinical examination
Two experienced dentists examined all subjects. Pocket depth was measured using a pressure calibrated periodontal probe (Hawe Click-Probe, Kerr Hawe SA, Bioggio, Switzerland).
Probing depth was measured to the nearest millimeter on the scale. Bleeding on probing was assessed after probing using a dichotomous measure. All measurements were performed on 4 sites of all implants and teeth. Plaque deposits were recorded (presence/absence) without staining, using a modified Approximal Plaque Index (API)[15].
Sample collection
In each subject, the implant and the tooth with the deepest depths were chosen for plaque collection. After isolating the sampling area with cotton rolls and gentle drying with an air syringe, 2 sterile endodontic paper points (Absorbent Paper Points, VDW GmbH, Munich, Germany) were used supramucosally or supragingivally to collect the biofilms. Subsequently,
the residual supramucosal and supragingival plaques were completely removed with a dental scaler. Two sterile paper points were then placed submucosally or subgingivally. The samples were pooled separately for every implant, tooth and location and were placed in 2 ml cryotubes (Eppendorf, Hamburg, Germany) and frozen immediately at −80 °C before processing.
DNA extraction and sequencing DNA isolation
Paper points used for sampling were treated with 360 µl lysozyme solution for 30 min at 37
°C (20 mg/ml lysozyme, 20 mM TrisHCl, 2 mM EDTA, 1.2% Triton X100, pH 8.00), followed by proteinase K digestion for 30 min at 56 °C in 400 µl buffer AL (Qiagen, Hilden, Germany). Enzymes were inactivated by heating to 95 °C for 15 min. Sterile 0.5 mm glass beads (Roth, Karlsruhe, Germany) were added and bacterial cells were disrupted by vigorous shaking (6500 rpm, 3 x 20s, 15s break) with a Precellys 24 bead mill (Bertin Technologies, Montigny-le-Bretonneux, France). Subsequently, total DNA was purified with the QIAamp DNA Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol for gram-positive bacteria (QIAamp® DNA Mini and Blood Mini Handbook, Third Edition, Appendix D).
16S rDNA amplification and sample preparation
From each sample, an approximately 550 bp fragment of the 16S rRNA gene was amplified using the broad range primers 27f (5’-AGAGTTTGATCMTGGCTCAG-3´) and 521r (5’- ACCGCGGCTGCTGGCAC-3’; both Eurogentec, Seraing, Belgium). The primers targeted conserved DNA sequences flanking the V1 and V3 hypervariable regions within the 16S rRNA gene. PCR was performed on a TProfessional thermocycler (Biometra, Göttingen, Germany) in a total reaction volume of 50 µl. The PCR mix contained approximately 20 ng of template DNA, 200 nM of each primer, 1x PCR buffer (including 1.5 mM magnesium chloride; Qiagen, Hilden, Germany), 1.5U HotStar Taq polymerase (Qiagen, Hilden, Germany), 200 mM of each dNTP (Roth, Karlsruhe, Germany) and PCR-grade water (Roche, Penzberg, Germany). PCR conditions were as follows: Initial denaturation at 95 °C for 15 min; 32 amplification cycles consisting of denaturation at 94 °C for 1 min, annealing at 52 °C for 40s, elongation at 72 °C for 1 min; final extension at 72 °C for 10 min. PCR reactions were separated on a 1.0% agarose gel (Agarose MP; AppliChem, Darmstadt, Germany) and purified using the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany). The purified amplicons of each sample were used as template for a second PCR step with the primer 27f-
AdaB (5’-
CCTATCCCCTGTGTGCCTTGGCAGTCTCAGAGAGTTTGATCMTGGCTCAG-3´) and
an individual reverse primer 521r-MID_X (5’-
CCATCTCATCCCTGCGTGTCTCCGACTCAGXXXXXXXXXXXACCGCGGCTGCTGG CAC-3’; XXXXXXXXXXX = unique MID-tag) containing a unique Multiplex-Identifier (MID) barcode sequence. Amplification chemistry was the same as described above, however, 100 ng of template DNA were used per reaction, the annealing temperature was raised to 67 °C and the cycle number was reduced to 15. PCR reaction products were purified by agarose gel electrophoresis and extracted as described before. The DNA concentrations were determined using the AccuBlueTM High Sensitivity dsDNA Quantitation Kit (Biotium, Hayward, USA) in combination with a BioTekSynergy II fluorescence reader (BioTek, Bad
further processed according to the manufacturer’s instruction for the Titanium Library Preparation Kit (Roche, Penzberg, Germany). Pyrosequencing was performed on a GS FLX sequencer (Roche, Penzberg, Germany).
Bioinformatics Sequence processing
Qiime software version 1.6 [16] was used for preprocessing, the identification of operational taxonomic units (OTU), the taxonomic assignment and the community structure comparisons.
In the preprocessing step, every 454-read was removed if (a) the number of base pairs was <
200 or > 550, (b) the quality score was < 25, (c) the number of ambiguous bases was > 6, (d) there was a primer mismatch, (e) the number of errors in barcode were > 1.5, or (f) a homopolymer run was > 6. In addition to these quality filtering steps, a denoising step of the sequences was performed [17] with the “denoise_wrapper”-script in qiime. Chimeric sequences were removed using ChimeraSlayer with the qiime default settings after OTU- picking and taxonomic assignment.
OTU assignment and taxonomic classification
The sequences were assigned to OTUs with the uclust method in qiime with a similarity threshold of 0.97, which corresponds to genus level OTUs. For the following taxonomic assignment, we used the blast method in qiime with the greengenes 12_10 release with 97%
OTUs as the reference database. In addition, genera were categorized according to their Gram staining based on Bergey’s Manual of Systematic Bacteriology.
Statistical analyses
The OTU-table created by qiime after denoising and chimera checking was imported into the statistical programming language R [18] using the Bioconductor [19] package phyloseq [20].
The following graphical analyses were also performed using the phyloseq package and were created for (a) the whole data set, (b) the implant subset and (c) the tooth subset. The taxonomic rank used for the following analyses was the genus level. First, heat maps for the 50 most abundant bacteria were created. Second, Principal Coordinate Analyses (PCoA) of UniFac distances were calculated and plotted. The inferential statistical analysis was calculated with the Bioconductor package edgeR [21]. Therefore log Fold-Changes and corresponding multiplicity-adjusted p values were estimated from separate generalized linear models for every genus with patient as covariate and considering the paired design character.
Biodiversity was calculated using the Shannon-Diversity Index [22].
Results
Clinical data
Seven subjects (2 males, 5 females, mean age 60.1 ± 9.8 years) were eligible for the study between August and October 2010 at Hannover Medical School, Department of Prosthetic Dentistry and Biomedical Materials Science. Individual data and full-mouth scorings of all patients are summarized in Table 1. All implants investigated had been functioning for an average of 11.6 ± 5.5 years. Clinical signs of inflammation were apparent at investigated
implants (PD 4.9 ± 1.2 mm, BOP 39.9 ± 34.9 % ) and teeth (PD 4.1 ± 1.2 mm, BOP 35.7 ± 31.8%). Differences between the clinical recordings at implants and teeth were not significant (Table 1).
Table 1 Subject characteristics Study population
Number of patients 7
Gender (male/female) 2/5
Age (years) 60.1 ± 9.8
Implant longevity (years) 11.6 ± 5.6
Number of Implants per patient (n) 4.7 ± 3.6
Number of remaining teeth per patient (n) 16.7 ± 7.3 Full-mouth scores
Plaque index, API (%) 61.3 ±28.8
BOP (%) 22.1 ± 16.2
Number of periodontitis affected teeth per patient (%) 68.1 ± 15.5 Scores at sampled sites
Implants
Plaque index (%) 35.7 ± 37.8
BOP (%) 39.3 ± 34.9
PD (mm) 5.0 ± 1.3
Teeth
Plaque index (%) 28.6 ± 39.3
BOP (%) 35.7 ± 31.8
PD (mm) 4.1 ± 1.3
Data are presented as means and standard deviations.
API, Approximal Plaque Index; BOP, bleeding on probing; PD, probing depths.
Supra- and subgingival microbiomes
28 supra- and subgingival samples from 7 patients were analyzed and yielded a total of 43734 chimera-depleted, denoised sequences representing 1 phylum, 8 classes, 10 orders, 44 families and 150 genera. On implants, these sequences represented the families Porphyromonadaceae, Lachnospiraceae, Streptococcaceae and genera Rothia, Actinomyces, Paenibacillus, Microbacterium, Pseudoramibacter, Leptotrichia, Parascardovia, Tannerella, Granulicatella, Tessaracoccus, Clostridium, Aeromonadales, Veillonella, Capnocytophaga, Prevotella, TG5, Fusobacterium, Exiguobacterium, Enterococcus, Porphyromonas, Streptococcus at implants. On teeth, the sequences represented the families Coriobacteriaceae, Rs-045, Veillonellaceae, Neisseriaceae, and the genera Mogibacterium, Porphyromonas, Tannerella, Aggregatibacter, Treponema, Capnocytophaga, Lactococcus, Granulicatella, Enterococcus, Exiguobacterium, Atopobium, Veillonella. On implants and teeth, the above-mentioned bacteria accounted for > 90% of all sequences.
In supramucosal or supragingival plaques on implants and teeth, the most abundant taxa were Streptococcacea, Rothia, and Porphyromonas. In submucosal plaques at implants, the most abundant taxa found were Rothia, Streptococcaceae and Porphyromonas. The most abundant subgingival bacteria on teeth were Prevotella, Streptococcaceae and TG5 (Figure 1a, b).
Figure (a) Distribution of taxa in supra- and submucosal biofilms from inflamed implants and (b) taxa in supra- and subgingival biofilms of teeth affected by periodontitis. The listed genera (g), families (f) and classes (c) represents 90% of all sequences found.
The statistical analysis showed significant differences between supra- and submucosal plaque on implants for the genus Tannerella (p = 0.0067) and nearly significant differences for the genus Aggregatibacter (p = 0.056). After correction for multiple testing, these differences were no longer significant.
Gram stain categories
The Gram stain categories on implants and teeth are presented in Figure 2a and b. In general, Gram-positive bacteria were more prevalent than Gram-negative bacteria in all samples. On implants, Gram-positive bacteria were predominately found in supra- and submucosal samples. In supragingival samples of teeth, Gram-positive bacteria were more frequent than Gram-negative bacteria, but in subgingival plaque samples the abundances of Gram-positive and Gram-negative bacteria were similar. On implants and teeth, the number of Gram- negative bacteria were greater at submucosal and subgingival locations than at supramucosal and supragingival sites.
Figure 2 The identified taxa were classified according to their Gram staining characteristics. The bars represent the cumulative number of OTUs in supra- and submucosal areas at implants (a) and in supra- and subgingival areas at teeth (b).
Principal coordinate analysis (PCoA)
The Principal Coordinate Analysis (Figure 3) of weighted UniFac distances revealed no distinct partitioning of the bacterial communities associated with implants or teeth (p > 0.01).
Figure 3 Bacterial community structure at inflamed peri-implant and periodontal sites.
The panels show the Principal Co-ordinate Analysis of UniFac distances. There was no partitioning of the bacterial communities associated with implants or teeth (p > 0.01), as illustrated by the poorly graded distribution of dots representing the four sample areas of this study.
Heat map
Data visualization was performed using a heat map display, where the relative abundances of the 50 most frequent genera are represented by different brightnesses (Figure 4). Samples from different locations within individual patients shared only minimal similarities in bacterial community compositions, as shown with hierarchical clustering of bacterial taxa in the heat map display. Communities from supramucosal locations at implants closely clustered with communities from submucosal locations at implants. In contrast, samples taken from supragingival plaque were less similar to subgingival plaque samples at teeth.
Figure 4 Heat map presentation showing the abundances of the 50 most frequent genera in all samples. Individual samples are depicted on the x-axis as tooth (T) or implant (I), the location supra (= supramucosal or supragingival) or sub (= submucosal or subgingival) and a
number representing the patient. From this presentation, it is apparent that different locations within individual patients shared only minimal similarities in bacterial community
compositions.
Shannon diversity index
The Shannon Diversity index describes the biodiversity and considers the number of genera and their abundances [22]. Neither implants nor teeth demonstrated significant differences in the diversity index for supra- and submucosal locations at implants and supra- or subgingival locations at teeth (Figure 5).
Figure 5 The Shannon Diversity index was calculated for implants and teeth and showed that neither implants nor teeth demonstrated significant clustering of the diversity index of the sampling locations (blue and red dots).
Discussion
The present study describes in detail the supra- and submucosal, and supra- and subgingival microbiomes of inflamed peri-implant and periodontal sites in single subjects using 16S rRNA gene-based pyrosequencing. The current study demonstrated (1) frequent occurrence of members of the genus Rothia and members of the family Streptococcaceae at implants and teeth, (2) no significant differences between the microbiomes of diseased implants and teeth affected by periodontitis, (3) no significant differences between supra- and submucosal, or supra- and subgingival microbiomes.
The current 16S rRNA approach was aimed to detect the comprehensive composition of bacteria located at two different sites at implants and teeth. In the present study, the sequencing lengths were limited to 550 bp and therefore annotations were restricted to the genus level, an established approach for the analysis of complex biofilms [23,24]. In agreement with other current publications, the composition of microbiomes showed high inter-individual differences [8]. Prominent phylotypes at supra- and submucosal regions were Rothia and Streptococcaceae. Species belonging to the genus Rothia have been repeatedly described as members of oral communities [25-27], and have been associated with periodontal health [28,29]. High levels of this genus have been reported at healthy implant sites as well [30]. Specific members of the genus Rothia have been recently shown to cause clinical infections such as septic arthritis, pneumonia, septicemia in renal transplant patients, arteriovenous infections, acute bronchitis and endocarditis [31] and - as a member of biofilms - has been associated with joint infections in orthopedics [32]. The virulence factors and the capacity of this genus to induce infections have been studied in vitro as well [33]. Our study also detected high frequencies of genera that have not been previously described as common oral inhabitants [34]. E.g. Exiguobacterium has been described as a bacterium colonizing marine habitats and sea food [35-37], ancient Siberian permafrost, Greenland glacial ice, and hot springs [38]. From the present study, it is unclear if this genus was accidentally incorporated by contamination [39] or if it was incorporated in oral plaques by food consumption., Food intake should therefore be accurately controlled or recorded in future studies.
All analyses in the present study indicated that the diversity of biofilms colonizing diseased implants was similar to biofilms colonizing teeth affected by periodontitis. In contrast, Kumar
et al. [7] observed reduced diversity at implant sites than at diseased teeth and Koyanagi et al.
[8] reported significantly higher diversity at implant sites than at diseased teeth. A partial explanation for these differences may be that the subjects were from different ethnic populations. . It was hypothesized that diversity is an indicator of the complexity of a disease, whereas high diversity is associated with complex diseases,.
In the present study, bacterial genera associated with diseased implants were not significantly different from communities associated with infected teeth in the same subject, which is in accordance with other publications [40-42] and demonstrated that the intraoral transmission of bacteria from one niche to the other is a feasible event. In contrast, with hybridization techniques the genus Actinomyces was the most dominant taxon found at teeth affected by periodontitis and diseased implants [3,43], but was only found in low frequencies in the present study. Kumar et al. [7] used sequencing techniques and concluded that Actinomyces bacteria make up less than 5% of all sequences. The genera Treponema and Tannerella including species belonging to the red complex, as well as Aggregatibacter, were found in nearly similar frequencies at diseased implants and teeth affected by periodontitis; in contrast Porphyromonas was found more frequently at implants. The same observations were reported earlier by Cortelli et al. [44] but were not supported by other studies [7,8]. Again, differences in the experimental design may account for these observations, e.g. Kumar et al. [7]
investigated implants and teeth from different subjects.
In our study, the compositions of supra- or submucosal biofilms at implants were more similar than the supra- or subgingival biofilms at teeth, as demonstrated by the heat map analysis, which is in accordance to Ximenez-Fyvie et al. [43] who found identical genera in supra- and subgingival plaques of teeth affected by periodontitis. Utilizing DNA hybridization, Shibli et al. [3] also confirmed the similarities between biofilms at supra- and submucosal locations at implants.
At implant sites, the microbial composition was mainly composed of Gram-positive taxa. At teeth, Gram-positive taxa were also more frequent than Gram-negative taxa, but at much lower ratios. These differences between supra- and submucosal locations were not obvious on discrimination of sequenced genera, but became obvious using Gram characteristics. These data are partially in contrast to data reported by Kumar et al. [7], who stated that peri- implantitis of failing implants is a predominantly Gram-negative disease.
Conclusions
The present study using 16S rRNA sequencing techniques complemented the knowledge of the composition of supra- and submucosal, and supra- and subgingal biofilms. Based on the limitations of the study and the analysis on a genus level significant differences in the biofilm composition of diseased peri-implant and periodontal tissues were not observed.
Abbreviations
API, Approximal Plaque Index; BOP, Bleeding on probing; Bp, Base pair; DNA,
Desoxyribonucleic acid; dNTP, Desoxynucleotide triphosphate; min., Minute; ml, Milliliter;
mm, Millimeter; no, Number; OUT, Operational taxonomic units; PCoA, Principal Coodinate Analyses; PCR, Polymerase Chain Reaction; PD, Pocket depth; rRNA, Ribosomal
ribonucleic acid.
Competing interests
The authors declare that they have no competing interests.
Authors’ contribution
SS contributed with concept and design, clinical investigation, analysis of data, and was responsible for drafting; IS clinical investigation; RS analysis of data; MaS sequencing; AW and SNS sample preparation; JE and MeS concept and design critically revised and approved the final version of the manuscript.
Acknowledgements
The authors are grateful to Rainer Schreeb for excellent laboratory work.
The study was funded in part by the Dr. Dorka-Stiftung.
References
1. Mombelli A, Muller N, Cionca N. The epidemiology of peri-implantitis. Clin Oral Implants Res. 2012;23 Suppl 6:67–76.
2. Heitz-Mayfield LJ. Peri-implant diseases: diagnosis and risk indicators. J Clin Periodontol.
2008;35(8 Suppl):292–304.
3. Shibli JA, Melo L, Ferrari DS, Figueiredo LC, Faveri M, Feres M. Composition of supra- and subgingival biofilm of subjects with healthy and diseased implants. Clin Oral Implants Res. 2008;19(10):975–82.
4. Persson GR, Samuelsson E, Lindahl C, Renvert S. Mechanical non-surgical treatment of peri-implantitis: a single-blinded randomized longitudinal clinical study. II. Microbiological results. J Clin Periodontol. 2010;37(6):563–73.
5. Maximo MB, de Mendonca AC, Renata Santos V, Figueiredo LC, Feres M, Duarte PM.
Short-term clinical and microbiological evaluations of peri-implant diseases before and after mechanical anti-infective therapies. Clin Oral Implants Res. 2009;20(1):99–108.
6. Salcetti JM, Moriarty JD, Cooper LF, Smith FW, Collins JG, Socransky SS, Offenbacher S. The clinical, microbial, and host response characteristics of the failing implant. Int J Oral Maxillofac Implants. 1997;12(1):32–42.
7. Kumar PS, Mason MR, Brooker MR, O'Brien K. Pyrosequencing reveals unique microbial signatures associated with healthy and failing dental implants. J Clin Periodontol.
2012;39(5):425–33.
8. Koyanagi T, Sakamoto M, Takeuchi Y, Maruyama N, Ohkuma M, Izumi Y.
Comprehensive microbiological findings in peri-implantitis and periodontitis. J Clin Periodontol. 2013;40(3):218–26.
9. Dabdoub SM, Tsigarida AA, Kumar PS. Patient-specific analysis of periodontal and peri- implant microbiomes. J Dent Res. 2013;92(12 Suppl):168S–75S.
10. Hellstrom MK, Ramberg P, Krok L, Lindhe J. The effect of supragingival plaque control on the subgingival microflora in human periodontitis. J Clin Periodontol. 1996;23(10):934–
40.
11. Socransky SS, Haffajee AD. Dental biofilms: difficult therapeutic targets. Periodontol 2000. 2002;28:12–55.
12. Tezal M, Scannapieco FA, Wactawski-Wende J, Grossi SG, Genco RJ. Supragingival plaque may modify the effects of subgingival bacteria on attachment loss. J Periodontol.
2006;77(5):808–13.
13. Teughels W, Van Assche N, Sliepen I, Quirynen M. Effect of material characteristics and/or surface topography on biofilm development. Clin Oral Implants Res. 2006;17 Suppl 2:68–81.
14. Heitz-Mayfield LJ, Lang NP. Comparative biology of chronic and aggressive periodontitis vs. peri-implantitis. Periodontol 2000. 2010;53:167–81.
15. Lange DE, Plagmann H-C, Eenboom A, Promesberger A. Klinische Bewertungsverfahren zur Objektivierung der Mundhygiene. Dtsch zahnärztl Z. 1977;32:44–7.
16. Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman FD, Costello EK, Fierer N, Pena AG, Goodrich JK, Gordon JI, et al. QIIME allows analysis of high-throughput community sequencing data. Nat Methods. 2010;7(5):335–6.
17. Reeder J, Knight R. Rapidly denoising pyrosequencing amplicon reads by exploiting rank-abundance distributions. Nat Methods. 2010;7(9):668–9.
18. R Core Team. R: A language and environment for statistical computing. Vienna, Austria:
R Foundation for Statistical Computing; 2013.
19. Gentleman RC, Carey VJ, Bates DM, Bolstad B, Dettling M, Dudoit S, Ellis B, Gautier L, Ge Y, Gentry J, et al. Bioconductor: open software development for computational biology and bioinformatics. Genome Biol. 2004;5(10):R80.
20. McMurdie PJ, Holmes S. phyloseq: an R package for reproducible interactive analysis and graphics of microbiome census data. PLoS One. 2013;8(4):e61217.
21. Robinson MD, McCarthy DJ, Smyth GK. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics. 2010;26(1):139–40.
22. Shannon CE. The mathematical theory of communication. MD Comput 1997.
1963;14(4):306–17.
23. Bizzarro S, Loos BG, Laine ML, Crielaard W, Zaura E. Subgingival microbiome in smokers and non-smokers in periodontitis: an exploratory study using traditional targeted techniques and a next-generation sequencing. J Clin Periodontol. 2013;40(5):483–92.
24. Hu YJ, Wang Q, Jiang YT, Ma R, Xia WW, Tang ZS, Liu Z, Liang JP, Huang ZW.
Characterization of oral bacterial diversity of irradiated patients by high-throughput sequencing. Int J Oral Sci. 2013;5(1):21–5.
25. Tanner AC, Haffer C, Bratthall GT, Visconti RA, Socransky SS. A study of the bacteria associated with advancing periodontitis in man. J Clin Periodontol. 1979;6(5):278–307.
26. Lesher RJ, Gerencser VF, Morrison DJ. Presence of Rothia dentocariosa strain 477 serotype 2 in gingiva of patients with inflammatory periodontal disease. J Dent Res.
1977;56(2):189.
27. Segata N, Haake SK, Mannon P, Lemon KP, Waldron L, Gevers D, Huttenhower C, Izard J. Composition of the adult digestive tract bacterial microbiome based on seven mouth surfaces, tonsils, throat and stool samples. Genome Biol. 2012;13(6):R42.
28. Kistler JO, Booth V, Bradshaw DJ, Wade WG. Bacterial community development in experimental gingivitis. PLoS One. 2013;8(8):e71227.
29. Abusleme L, Dupuy AK, Dutzan N, Silva N, Burleson JA, Strausbaugh LD, Gamonal J, Diaz PI. The subgingival microbiome in health and periodontitis and its relationship with community biomass and inflammation. ISME J. 2013;7(5):1016–25.
30. da Silva ES, Feres M, Figueiredo LC, Shibli JA, Ramiro FS, Faveri M. Microbiological diversity of peri-implantitis biofilm by Sanger sequencing. Clin Oral Implants Res.
2014;25(10):1192–9.
31. Shakoor S, Fasih N, Jabeen K, Jamil B. Rothia dentocariosa endocarditis with mitral valve prolapse: case report and brief review. Infection. 2011;39(2):177–9.
32. Trivedi MN, Malhotra P. Rothia prosthetic knee joint infection. J Microbiol Immunol Infect. 2013;25:243–5.
33. Kataoka H, Taniguchi M, Fukamachi H, Arimoto T, Morisaki H, Kuwata H. Rothia dentocariosa induces TNF-alpha production in a TLR2-dependent manner. Pathog Dis.
2014;71(1):65–8.
34. Chen T, Yu WH, Izard J, Baranova OV, Lakshmanan A, Dewhirst FE. The Human Oral Microbiome Database: a web accessible resource for investigating oral microbe taxonomic and genomic information. Database (Oxford). 2010;2010:baq013.
35. Inbakandan D, Murthy PS, Venkatesan R, Khan SA. 16S rDNA sequence analysis of culturable marine biofilm forming bacteria from a ship's hull. Biofouling. 2010;26(8):893–9.
36. Wen W, Wang S, Zhou X, Fang B. Central carbon metabolism in marine bacteria examined with a simplified assay for dehydrogenases. Appl Biochem Biotechnol.
2013;170(3):473–82.
37. Yang J, Wang C, Wu J, Liu L, Zhang G, Feng J. Characterization of a multi-resistant mosaic plasmid from a fish farm sediment Exiguobacterium sp. isolate reveals aggregation of
functional clinically-associated antibiotic resistance genes. Appl Environ Microbiol.
2014;80(4):1482–8.
38. Vishnivetskaya TA, Kathariou S, Tiedje JM. The Exiguobacterium genus: biodiversity and biogeography. Extremophiles. 2009;13(3):541–55.
39. van der Horst J, Buijs MJ, Laine ML, Wismeijer D, Loos BG, Crielaard W, Zaura E.
Sterile paper points as a bacterial DNA-contamination source in microbiome profiles of clinical samples. J Dent. 2013;41(12):1297–301.
40. Sumida S, Ishihara K, Kishi M, Okuda K. Transmission of periodontal disease-associated bacteria from teeth to osseointegrated implant regions. Int J Oral Maxillofac Implants.
2002;17(5):696–702.
41. Quirynen M, Papaioannou W, van Steenberghe D. Intraoral transmission and the colonization of oral hard surfaces. J Periodontol. 1996;67(10):986–93.
42. Quirynen M, Vogels R, Peeters W, van Steenberghe D, Naert I, Haffajee A. Dynamics of initial subgingival colonization of 'pristine' peri-implant pockets. Clin Oral Implants Res.
2006;17(1):25–37.
43. Ximenez-Fyvie LA, Haffajee AD, Socransky SS. Microbial composition of supra- and subgingival plaque in subjects with adult periodontitis. J Clin Periodontol. 2000;27(10):722–
32.
44. Cortelli SC, Cortelli JR, Romeiro RL, Costa FO, Aquino DR, Orzechowski PR, Araujo VC, Duarte PM. Frequency of periodontal pathogens in equivalent peri-implant and periodontal clinical statuses. Arch Oral Biol. 2013;58(1):67–74.
Additional file
Additional_file_1 as ZIP Additional file 1
Additional files provided with this submission:
Additional file 1: 7790746414089538_add1.zip, 964K
http://www.biomedcentral.com/imedia/1880086148153969/supp1.zip
