Regulation of IL-2 expression by transcription factor BACH2 in umbilical cord blood CD4
þT cells
ML Lesniewski1, P Haviernik1, RP Weitzel1, S Kadereit2, MM Kozik1, LR Fanning1, YC Yang3, Y Hegerfeldt1, MR Finney1, MZ Ratajczak4, N Greco1,5, P Paul5, J Maciejewski6and MJ Laughlin1,5
1Department of Medicine, Case Comprehensive Cancer Center, Case Western Reserve University, Cleveland, OH, USA;
2Department of Biology, University of Konstanz, Konstanz, Germany;3Biochemistry, Case Comprehensive Cancer Center, Cleveland, OH, USA;4Department of Medicine, James Graham Brown Cancer Center, University of Louisville, Louisville, KY, USA;5Abraham J and Phyllis Katz Cord Blood Foundation, Cleveland Cord Blood Center, Cleveland, OH, USA and6Department of Hematologic Oncology and Blood Disorders, Cleveland Clinic Foundation Taussig Cancer Center, Cleveland, OH, USA
On activation, umbilical cord blood (UCB) CD4þ T cells demonstrate reduced expression of tumor necrosis factor-a (TNF-a) and interferon-c (IFN-c), whereas maintaining equiva- lent interleukin-2 (IL-2) levels, as compared with adult peri- pheral blood (PB) CD4þ T cells. Nuclear factor of activated T cells (NFAT1) protein, a transcription factor known to regulate the expression of IL-2, TNF-aand IFN-c, is reduced in resting and activated UCB CD4þ T cells. In contrast, expression of Broad-complex-Tramtrack-Bric-a-Brac and Cap‘n’collar homo- logy 1 bZip transcription factor 2 (BACH2) was shown by gene array analyses to be increased in UCB CD4þ T cells and was validated by qRT-PCR. Using chromatin immunoprecipitation, BACH2 was shown binding to the human IL-2 proximal promoter. Knockdown experiments of BACH2 by transient transfection of UCB CD4þ T cells with BACH2 siRNA resulted in significant reductions in stimulated IL-2 production.
Decreased IL-2 gene transcription in UCB CD4þ T cells transfected with BACH2 siRNA was confirmed by a human IL-2 luciferase assay. In summary, BACH2 maintains IL-2 expression in UCB CD4þ T cells at levels equivalent to adult PB CD4þ T cells despite reduced NFAT1 protein expression.
Thus, BACH2 expression is necessary to maintain IL-2 produc- tion when NFAT1 protein is reduced, potentially impacting UCB graft CD4þ T-cell allogeneic responses.
Keywords: human; T-cell; cytokine; Th1 response; T-cell development; gene regulation
Introduction
Umbilical cord blood (UCB) graft T cells are predominantly (490%) CD4þ and express a naive (CD45RAþ) phenotype with little or no CD45ROþ expression; this differs significantly when compared with adult CD4þ T cells infused in conven- tional allogeneic bone marrow or mobilized peripheral blood (PB) stem cell grafts.1 On CD3/CD28 stimulation, UCB graft T cells express activation markers equivalent to adult CD4þ T cells, as measured by downregulation of CD45RAþ and upregulation of CD25, CD69, T-cell receptor (TCR/CD3) and p56Ick.2During primary T-cell receptor stimulation, UCB T-cell proliferation is equal to adult, as measured by thymidine
incorporation.3Finally, UCB T-cell proliferation after secondary stimulation has been shown to be significantly reduced, and alloantigen-specific cytotoxicity is also decreased, thus reducing their response to foreign antigens.4,5
Resting UCB CD4þ T cells have lower constitutive nuclear factor of activated T cells 1 (NFAT1) protein expression and delayed upregulation of this transcription factor during primary stimulation compared with adult PB CD4þ T cells.6,7Impor- tantly, activated UCB CD4þ T-cell production of NFAT1 regulated cytokines: interferon-g (IFN-g) and tumor necrosis factor-a(TNF-a), are significantly reduced compared with adult PB CD4þ T cells.1,8Further, microarray analyses of activated UCB CD4þ T cells demonstrate maintained IL-2 expression compared with activated adult PB CD4þ T cells.7 Enzyme- linked immunosorbent assay studies have confirmed equivalent IL-2 production in resting and activated UCB CD4þcompared with adult PB CD4þ T cells.6,9 At the same time points of reduced NFAT1 protein during primary T-cell stimulation, a threefold higher expression of the 110 kDa protein, Broad- complex-Tramtrack-Bric-a-Brac and Cap‘n’collar homology 1 bZip transcription factor 2 (BACH2) has been observed in gene expression analyses, whereas JunB and FRA1 are reduced in UCB CD4þT cells relative to adult.6
Interleukin-2 (IL-2) has emerged as a critical regulatory cytokine in the development of acquired immunity. IL-2 is immune enhancing (that is, proproliferation, survival and differentiation of naive T cells into effector and memory subtypes).10 Exogenous IL-2 stimulates the proliferation of anergenic T cells.11 IL-2 also promotes activation-induced cell death and is a factor for maintaining the homeostasis of regulatory T cells (Treg)in vivo,12 but can also provide T-cell protection from apoptosis by upregulating the expression of the antiapoptotic protein bcl-2.13Exogenous addition of IL-2 to UCB CD4þ T cells results in proliferation and in vitro preferential development of Treg.14Current models of IL-2 gene regulation during CD4þ T-cell activation suggest that NFAT1, activating protein 1 dimer (AP1-Jun:Fos) and NF-kB, all bind to the human IL-2 proximal promoter to promote IL-2 produc- tion.15,16 Further studies have determined that NFAT1 is required for AP1 to bind to the combined NFAT1:AP1 sites on the IL-2 promoter.17–19Nonetheless, NFAT1 and AP1 are significantly lower in UCB CD4þ T cells.6
This report summarizes studies demonstrating a functional role for BACH2 in UCB CD4þ T cells. BACH2 expression is upregulated in UCB CD4þT cells relative to adult PB CD4þ T cells as seen by gene array and confirmed by quantitative real- time PCR (qRT-PCR) and western blot. In addition, BACH2 Correspondence: Dr MJ Laughlin, Department of Medicine, Case
Comprehensive Cancer Center, Case Western Reserve University, 10900 Euclid Avenue Wolstein Research Building 2-129, Cleveland, OH 44106-7284, USA.
E-mail: mary.laughlin@case.edu
Konstanzer Online-Publikations-System (KOPS) URN: http://nbn-resolving.de/urn:nbn:de:bsz:352-opus-123326
URL: http://kops.ub.uni-konstanz.de/volltexte/2010/12332 First publ. in: Leukemia 22 (2008), 12, pp. 2201–2207
doi:10.1038/leu.2008.234
promotes IL-2 expression in UCB CD4þ T cells via binding to the IL-2 proximal promoter as determined by chromatin- immunoprecipitation (ChIP) assay and luciferase activity. Taken together, we present evidence that before and during stimula- tion; UCB CD4þ T cells maintain equivalent IL-2 expression due to BACH2 regulation of IL-2 gene expression in the setting of reduced NFAT1 protein.
Materials and methods
CD4þ T-cell selection and stimulation
The T-cell lines Loucy and MOLT-4 cells were obtained from American Type Culture Collection, Virginia. Acquisition of both adult and UCB mononuclear cells conformed to Case Western Reserve University’s IRB protocol no. 3937. Human UCB and adult PB mononuclear cells were collected and purified as described.20 Naive CD4þ T cells were purified using Miltenyi naive T-cell kit and total CD4þ T cells were purified by sequential CD14and CD4þ selection using the Miltenyi autoMACS system (Auburn, CA, USA) per manufacturer’s instructions. Purity was assessed by multiparameter flow cytometry utilizing fluorochrome-conjugated antibodies (Abs) against CD3, CD4, CD14, CD56 and corresponding isotype controls (Pharmingen, San Jose, CA, USA). The purity of selected UCB and adult PB CD4þ T cells ranged from 80 to 97% (data not shown). Purified UCB and adult PB CD4þ T cells were stimulated by incubation with adherent anti-CD3 Abs (1mg/ml) and anti-CD28 Abs (5mg/ml) in RPMI-1640 media with 0.3 g/l
L-glutamine supplemented with 1 mMsodium pyruvate, 0.1 mM
minimal essential amino acids plus 10% fetal bovine serum, here referred to as complete RPMI.
Transfection of primary UCB or adult CD4þ T cells UCB CD4þT cells were prepared for electroporation using the Amaxa Nucleofector system (Gaithersburg, MD, USA). Between 1106and 6106CD4þT cells were resuspended in 100ml of unstimulated primary T-cell Nucleofector solution along with 2mg of pGL3hIL-2 firefly luciferase plasmid, 100 ng of pGL3TK Renilla(Promega, Madison, WI, USA), 2mg nonspecific random siRNA sequence (control siRNA) that does not induce any specific inhibition (Dharmacon, Lafayette, CO, USA), or 2.6mg
‘SMARTPool’ siRNAs (Dharmacon) targeting BACH2 mRNA.
Electroporated cells were allowed to recover in 1.5 ml of complete RPMI media for 24 h. The cells were harvested at this time or stimulated 6 h as described in CD4þT-cell selection and stimulation.
Quantitative RT-PCR
RNA was isolated from primary CD4þ T cells using Trizol reagent (Invitrogen, Carlsbad, CA, USA) and quantified by standard spectrophotometric assays. NFAT1, BACH2, IL-2 and b2-microglobulin (B2M) mRNAs were measured by quantitative real-time (qRT-PCR). B2M was used as an internal control.21,22 The qRT-PCR runs were performed in triplicate to quantify expression levels for each of these genes using the Lightcycler SybrGreen real-time RT-PCR system (Roche, Basel, Switzerland).
The primers used were: BACH2 forwardFATGCACA AGCTAACCTCAGA, BACH2 reverseFTCACTAGGTATAATCT TTCCTG; NFAT1 forwardFGATGGTGGCCGAGTCCC, NFAT1 reverseFCGGCTCTTTGGCTCGTGGCA; IL-2 forwardFTGGA GCATTTACTGCTGGATT, IL-2 reverseFAGCCCCTAGGGCTT ACAAAA; B2M forwardFGTGCTCGCGCTACTCTCTCT, B2M reverseFTCTCTGCTCCCCACCTCTAA.
Statistical analysis of qRT-PCR
Comparative analyses of gene expression changes in BACH2 siRNA-treated UCB CD4þ T cells versus UCB CD4þ T cells treated with a nonfunctional control siRNA was performed using the relative expression software tool (REST) 2006 program (http://www.gene-quantification.de/rest.html).23 The REST program uses a pairwise fixed reallocation randomization test to calculate the absolute gene regulation as well as the significance of observed changes. The data is presented as the relative gene expression±s.e.m.
Western blot
Cells from resting and stimulated UCB and adult CD4þT cells were lysed using radioimmuno precipitation assay buffer,24and protein was quantitated using the Bicinchoninic acid (BCA) assay (Bio-Rad, Hercules, CA, USA), and 40mg of protein were separated by 10% sodium dodecyl sulfate–PAGE. Membranes were immunoblotted with goat anti-BACH2 (E16) (Santa Cruz Biotechnology, Santa Cruz, CA, USA), anti-IL-2 (Abcam, Cambridge, MA, USA) and anti-b-actin Abs (Sigma, St Louis, MO, USA). Western blots were quantified with NIH J Image program and the data presented as relative protein expres- sion±s.e.m.
Identification of putative transcriptional BACH2-binding sites
The sequence 1 kb upstream of the IL-2 translation start site (http://www.ncbi.nlm.nih.gov/sites/entrez) was processed for putative transcription factor-binding sites specifically, NFAT1 (A/T)GGAAA- and AP1-binding sites, (G/A)(G/C)TGA(G/C) TCA(T/G)(A/T) using TESS (transcription element search system) at http://www.cbil.upenn.edu/cgi-bin/tess/tess.25 This region was reexamined manually for the same sites, with attention to regions adjacent to the NFAT1-binding sites for partial AP1 sites possibly missed by the algorithm. Regions of interest were aligned manually and examined for similarity to the known BACH2 consensus sequence TGA(G/C)TCA(T/C).26 Sequences with475% (that is,p2 mismatches) similarity to the BACH2 consensus site are indicated in Figure 3.
Chromatin-immunoprecipitation of BACH2- and DNA-binding sites from UCB CD4þ T cells
Purified CD4þT cells (1107to 1.5107) were formaldehyde treated and processed as described.27 ChIP lysates were immunoprecipitated with 20mg anti-BACH2 (Santa Cruz Biotechnology), 25mg anti-NFAT1 (BD Transduction, San Jose, CA, USA), 20mg anti-JunB (Santa Cruz Biotechnology) or 20mg anti-MafK (Santa Cruz Biotechnology) Abs, then immuno- precipitated with protein A/G agarose beads (Bio-Rad). After proteolytic digestion, eluted DNA was examined for the IL-2 proximal promoter (B500 bp region) by standard PCR.27 Primers used were: IL-2 forward-TTGCTCCAGTTGTAGCTGTG TTT and IL-2 reverse-CCACCCCCTTAAAGAAAGGA.
pGL3-luciferase plasmid constructs
The pGL3 luciferase and pGL3 Renilla expression plasmids were purchased from Promega. In addition, Dr A Avots (Pathologisches Institut Wu¨rzburg, Germany) graciously pro- vided a pGL3hIL-2 firefly luciferase expression vector28contain- ing the 503 base pair region from499 toþ5 of the human IL-2 gene cloned into the pGL3 basic vector.29
2202
Dual-luciferase reporter assay system was used to measure bothfireflyluciferase andRenillaluciferase activity (Promega).
The standard protocol for a dual injector luminometer was followed. Briefly, transfected cells were harvested by centri- fugation and lysed using the passive lysis buffer and 20ml of cell lysate was transferred into the luminometer plate and mixed with 100ml LARII. Ten-second measurements were initiated for each reporter assay and recorded. After firefly luciferase readings, the luminescence was quenched and lysates reread for the Renilla luciferase activity. The ratio of fireflyto Renilla luciferase activity was calculated in order to normalize for the assay variation. Relative light units were then compared to determine the amount of respective promoter activity.
Results
Expression of bZip transcription factors in UCB CD4þ T cells
On the basis of previous gene array data,6 we examined transcription factors responsible for IL-2 expression and related family genes comparing expression in UCB and adult CD4þ T cells at baseline resting state and at 6 h primary stimulation.
Increased BACH2 mRNA expression in UCB CD4þ T cells is confirmed, with a fourfold higher mRNA expression in UCB CD4þ T cells, compared with adult (Figure 1a). We next examined whether at the protein level there was also higher expression of BACH2 in UCB CD4þ T cells. BACH2 protein expression is noted to be higher in total UCB CD4þ T cells, when compared with adult PB CD4þ T cells (Figure 1b). To determine whether higher expression of BACH2 in UCB is due to a predominance of naive CD4þ T cells, we compared expression of BACH2 protein in purified UCB naive T cells to naive adult PB CD4þT cells. UCB naive CD4þT cells BACH2 expression was noted to be significantly higher (Po0.05) than that measured in naive adult PB CD4þ T cells (Figure 1c).
Knockdown of BACH2 with siRNA in UCB CD4þ T cells results in decreased IL-2 expression
Next, we examined whether the transcription factor BACH2 may regulate the expression of IL-2 in UCB CD4þ T cells. For this, we transfected freshly isolated UCB CD4þ T cells with BACH2 siRNA and assayed BACH2 and IL-2 mRNA expression 24 h after electroporation. Figure 2a shows that the knockdown of BACH2 mRNA was very efficient (420-fold), albeit transient, as BACH2 mRNA levels increased after 24 h. Loss of BACH2 expression at 24 h after transfection correlated with a 142-fold lower expression of IL-2 and remained 27-fold lower after 6 h of stimulation (30 h after transfection) (Figure 2a). Treating UCB CD4þT cells with BACH2 siRNA resulted in a BACH2 protein decrease of 51.7±7.2% (P¼0.001) compared with control siRNA-treated UCB CD4þ T cells (Figure 2d). At the same time, the amount of IL-2 protein decreased by an average 78.9±12.1% (P¼0.0004) of control siRNA-treated UCB CD4þ T cells (Figure 2d).
BACH2 putative consensus DNA-binding domains located within the IL-2 proximal promoter
We next determined if BACH2-binding sites could be found within the IL-2 proximal promoter. Previous reports have determined that the AP1 site associated with the NFAT1-binding region would be unoccupied in the absence of NFAT1 protein.17,30 Sequence comparison of the IL-2 promoter
revealed that the known AP1-binding sites had475% similarity to the BACH2 consensus DNA-binding sequence, including the AP1 sites associated with the NFAT1-binding sites (Figure 3).
BACH2 binds to the IL-2 proximal promoter in resting UCB CD4þ T cells
To determine if BACH2 can bind to the human IL-2 proximal promoter, ChIP assays were performed. The target IL-2 promoter was detected by standard PCR using primers encompassing the region containing these putative BACH2 sites. Figure 4a shows control reactions and includes ChIP experiments using BACH2 Ab (lane 4). Figure 4b shows ChIP precipitates from either adult or UCB CD4þT cells, using different Abs targeting transcription factors including those that were found to have binding sites in this region of the IL-2 promoter. We determined if the binding of BACH2 to the IL-2 promoter was unique to UCB CD4þT cells (lane 2). Lane 2 is a representative image of four separate ChIP experiments performed on four separate UCB units. NFAT1 Ab did not precipitate the target promoter (lane 3), which was expected as resting UCB CD4þ T cells do not express NFAT1 protein. In addition, in CD4þ UCB T cells, JunB bound to the promoter and was pulled down by JunB Ab (lane 7), represent- ing a positive control in the UCB CD4þT cells. In adult CD4þ T cells, NFAT1 bound to the promoter (lane 4) whereas BACH2 did not (lane 5).
BACH2 activates transcription at the proximal IL-2 promoter in UCB CD4þ T cells
The identification of the IL-2 promoter sequence from ChIP data suggests that BACH2 is present at the IL-2 promoter region but does not demonstrate that it can function as a transcriptional activator for IL-2 gene expression. In order to determine if BACH2 activates IL-2 gene expression, a luciferase reporter assay was employed. UCB CD4þT cells were transfected with a luciferase reporter plasmid with either BACH2 specific or control siRNA. IL-2 promoter-driven expression of luciferase gene in UCB CD4þT cells containing control siRNA exhibited enhanced luciferase activity compared with control. When cells were cotransfected with BACH2 siRNA, the IL-2 promoter- driven luciferase expression decreased 2.6-fold (Po0.05) (Figure 5), demonstrating BACH2’s functional role in activating the IL-2 gene. These analyses confirm that BACH2 binds and transcriptionally activates the IL-2 proximal promoter.
Discussion
UCB allogeneic stem cell grafts differ from adult donor marrow and mobilized PB in that the T-cell population is predominantly (490%) naive with noted skewing toward a Th2 response on primary stimulation.1,31In addition, UCB CD4þT cells differ from adult CD4þ/CD45RAþ by the suppression of NFAT1 protein expression.20In addition, UCB CD4þ T cells elicit reduced Th1 responses, including TNF-aand IFN-gexpression.6This would be expected due to the absence of NFAT1 protein in naive (CD45RAþ) UCB CD4þ T cells.20 Nonetheless, these same studies have noted that IL-2, a critical regulatory Th1 cytokine,6,32 which is also required for Treg homeostasis,33,34 demonstrates equivalent expression in UCB versus adult CD4þ T cells. This dichotomy supports the concept of alternative IL-2 regulation in the absence of NFAT1 protein in UCB graft CD4þ T cells.
Previous analyses have shown that BACH2 is undetectable in primary adult human CD3þ T cells,35 but is expressed in the
2203
T-cell leukemia cell lines: Jurkat and CEM.36,37 BACH2 was expressed at higher levels in UCB CD4þpopulation compared with adult CD4þ T cells. Herein, we report BACH2 expression in primary UCB CD4þT cells, and BACH2’s ability to promote IL-2 transcription in the absence of NFAT1 in UCB CD4þ T cells. BACH2 has previously been described in neuronal brain cells, spleen, developing fetal limb buds, and differentiating
B cells.38–40BACH2 can repress transcription of the immuno- globulin heavy chain gene during B-cell differentiation.35 In addition, BACH2 reduces B-cell proliferation, is involved in Ab class switching, is functional in reactive oxidative stress-induced apoptosis and is classified as a tumor suppressor gene.38,41 There has not been any role assigned to BACH2 in normal human T cells before this study.
Figure 1 (a) Relative Broad-complex-Tramtrack-Bric-a-Brac and Cap‘n’collar homology 1 bZip transcription factor 2 (BACH2) and nuclear factor of activated T cells (NFAT1) mRNA expression in umbilical cord blood (UCB) and adult peripheral blood (PB) CD4þT cells. qRT-PCR of resting and CD3/CD28-stimulated UCB and adult CD4þT cells was performed. Data are presented as the relative mRNA expression in three different UCB CD4þT-cell preparations and at least three different adult PB CD4þT-cell preparations. BACH2 mRNA expression was up to fourfold higher in UCB CD4þcompared with adult controls. Error bars represent s.e.m. (**Po0.05). (b) BACH2 protein expression in adult PB and UCB CD4þ T cells. Total resting UCB and adult PB CD4þ T cells were analyzed by western blot for BACH2. BACH2 protein in total UCB CD4þ T cells, compared with total adult PB CD4þT cells, was 3.9 (±0.072)-fold higher (P¼0.0001). BACH2 was normalized against the controlb-actin. (c) Protein expression of BACH2 in naive adult PB and UCB CD4þCD45RAþT cells. Resting naive UCB and adult CD4þT cells were analyzed by western blot for BACH2. BACH2 protein in UCB naive CD4þ T cells compared with adult naive CD4þT cells was 1.63 (±0.545)-fold higher (P¼0.044). BACH2 was normalized against the controlb-actin. Images are representative of multiple western blots from at least three different UCB units and adult samples.
2204
Figure 2 Broad-complex-Tramtrack-Bric-a-Brac and Cap‘n’collar homology 1 bZip transcription factor 2 (BACH2) and interleukin (IL)-2 effectively inhibited by BACH2 siRNA in UCB CD4þ T cells. Umbilical cord blood (UCB) CD4þT cells were transfected with BACH2 siRNA or control siRNA. At 24 h after transfection, an aliquot of cells was harvested (resting), and the remaining cells were stimulated with anti-CD3/CD28 antibodies for 6 h. (a) qRT-PCR analysis of nuclear factor of activated T cells (NFAT1)- and NFAT1-dependent genes in UCB CD4þ T cells transfected with BACH2 siRNA. Relative mRNA expression of BACH2, NFAT1, and IL-2 was compared between BACH2 siRNA-treated and control siRNA-treated UCB CD4þT cells. Results are the average of three separate knockdown transfections with three different UCB units. Error bars represent s.e.m. (**Po0.002). (b) BACH2 expression in UCB CD4þ T cells transfected with BACH2 siRNA. CD4þ T cells from cord units (n43) were treated with BACH2 siRNA (þ) or control siRNA (). Whole cell lysates from BACH2 siRNA-treated and control siRNA-treated UCB CD4þ T cells were analyzed for BACH2 by western blot.b-Actin was used as a loading control for all blots. BACH2 protein expression was undetectable in BACH2 siRNA treated UCB CD4þ T cells. (c) IL-2 expression in UCB CD4þT cells transfected with BACH2 siRNA. Whole cell lysates from BACH2 siRNA-treated and control siRNA-treated UCB CD4þT cells were analyzed for IL-2 by western blot. IL-2 protein was not detectable in BACH2 siRNA-treated UCB CD4þT cells. (d) BACH2 and IL-2 protein expression in BACH2 siRNA-treated UCB CD4þ T cells.
Results are the average of different cord blood units (n43) treated with BACH2 siRNA or with control siRNA analyzed from at least three different western blots. The image intensity was normalized againstb-Actin. Error bars represent the s.e.m. BACH2 protein decreased by 51.7±7.2%
(P¼0.001) of control UCB CD4þ T cells, whereas the IL-2 protein decreased by 78.9±12% (P¼0.0004) of control UCB CD4þ T cells.
þ
þ
þ
þ
þ
þ þ
þ
þ
2205
BACH2’s function in UCB CD4þ T-cell regulation was examined, by transient knockdown using BACH2 siRNA, followed by measuring the mRNA expression of Th1 cytokines. We chose the Th1 cytokines because their expression was previously determined to differ in UCB CD4þ T cells compared with adult CD4þT cells.3qRT-PCR and western blot revealed significant loss of IL-2 expression in the BACH2 siRNA-treated UCB CD4þT cells.
This was an unexpected finding. Although previous studies have shown that NFAT1 and AP1 are necessary for NFAT1:AP1 activation of the IL-2 gene,15,42 and that NFAT1 protein is significantly reduced in UCB CD4þT cells,20lower IL-2 expression in UCB CD4þ T cells has not been previously reported.7,20
However, the inhibition of IL-2 prompted a re-examination of IL-2 regulation in UCB CD4þ T cells. The IL-2 promoter has four identified AP1 sites. In addition, BACH2 and AP1 are members of the bZip protein family and their consensus DNA- binding site has significant sequence homology including the two AP1 sites dependent on NFAT1.19,42 This suggests that BACH2 may be capable of binding to the IL-2 promoter in the absence of NFAT1 protein. The hypothesis that BACH2 binds directly to the IL-2 proximal promoter was confirmed by ChIP analysis. In addition, BACH2 was shown not to bind to the IL-2 promoter in adult CD4þT cells. Finally, BACH2 functionality as a positive transcription factor for IL-2 was confirmed by luciferase assays. Thus, BACH2 activates IL-2 transcription by directly binding to the IL-2 proximal promoter in the setting of reduced NFAT1 protein in UCB CD4þ T cells.
We propose the following model of IL-2 activation in UCB graft CD4þ T cells: on CD3 and CD28 engagement, the downstream signals likely propagate normally through the JNK, MAPK and NF-kB pathways. However, the NFAT1 pathway terminates at NFAT1, but calcium release and calmodulin would still function, activating additional pathways such as protein kinase Cy. The absence of NFAT1 protein implies those binding sites dependent on active NFAT1 would be available for alternative transcription factors. In the UCB CD4þ T-cell, this would include the NFAT1: AP1 consensus site because the complete ternary complex is required for proper binding to these sites.17Alternative bZip protein complexes could competitively bind at vacant AP1 sites within various Th1 cytokine promoters.
We suspect it is in this configuration that an activated BACH2 binds to the IL-2 promoter and compensates for the lack of NFAT1 thereby stimulating IL-2 mRNA transcription. This results in equivalent levels of IL-2 expression by UCB CD4þ T cells without the concurrent activation of other NFAT1-regulated pathways, thereby contributing in part to the unique cytokine profile of UCB graft CD4þ T cells.6This unique expression of BACH2 and NFAT1 in UCB CD4þT cells is not attributable to their naı¨ve phenotype alone as adult CD4þCD45RAþ T cells do not express increased BACH2 nor reduced NFAT1 protein expression.20Our current model of BACH2 function does not exclude the possibility that BACH2 may also indirectly affect IL-2 expression. However, the ChIP data and the human IL-2 proximal promoter driven luciferase assay suggest BACH2 regulates IL-2 directly at the proximal promoter.
During primary stimulation, naive UCB CD4þ T cells have reproducibly exhibited both reduced Th1-associated cytokine, specifically IFN-gand TNF-a,43,44as well as significant changes in the composition of the transcription factors NFAT1, AP1 and BACH2.3Therefore, UCB CD4þT cell has the unique response for the co-stimulation of normal IL-2 expression coupled with rapid proliferation, which could have significant physiological and clinical ramifications in the allogeneic setting. This may alter the developmental fate of UCB donor CD4þ T cells responding to recipient antigen presenting cells. The unique transcription factor regulation of Th1 cytokines in UCB graft CD4þT cells would expectedly impact both the cytokine and cellular cascade necessary to amplify UCB donor T-cell alloreactivity to recipient antigens in vivo.2,45 The immuno- logically competent UCB CD4þ T cells in a graft, although capable of recognizing noninherited antigens, do not elicit normal Th1 cytokine levels directing the expansion and differentiation of these alloreactive T cells. Although further studies of UCB CD4þT-cell developmentin vivoin the context of infusion into HLA-disparate UCB allogeneic stem cell transplantation are warranted, these analyses of BACH2 transcription factor regulation of IL-2 in UCB graft CD4þ T cells provide a new understanding of mechanisms promoting a unique response to CD3/CD28 engagement. These analyses may guide future studies to delineate cellular and molecular mechanisms contributing to UCB allogeneic immune tolerance.
Acknowledgements
We thank Dr A Avots of the Pathologisches Institut, Wu¨rzburg, Germany, for his generous donation of the human IL-2 promoter plasmid construct. We also thank Abraham J and Phyllis Katz Foundation, Fannie E Rippel Foundation and Dr Donald and Ruth Weber Goodman Philanthropic Fund for their generous financial contribution to our laboratory.
Funding: This work was supported by RO1-AI47289-01 (MJL), NIH/NCI 5T32 CA059366-13 Research Oncology Training Grant (MLL). This research was supported by the Gene Expression and Genotyping Facility of the Case Comprehensive Cancer Center 5P30CA043703 (ClinicalTrials.gov identifier: NCT00003335), Abraham J and Phyllis Katz Foundation, Fannie E Rippel Foundation and Dr Donald and Ruth Weber Goodman Philan- thropic Fund (MJL).
References
1 Chalmers I, Janossy G, Contreras M, Navarrete C. Intracellular cytokine profile of cord and adult blood lymphocytes.Blood1998;
92: 11–18.
Figure 5 Luciferase assay. Umbilical cord blood (UCB) CD4þT cells (3106) were transiently transfected with pGL3Basic, pGL3hIL- 2lucifierase, pTK-renilla, and either control siRNA or Broad- complex-Tramtrack-Bric-a-Brac and Cap‘n’collar homology 1 bZip transcription factor 2 (BACH2) siRNA at a ratio of 2mg:100 ng:2mg, respectively, using the Amaxa Nucleofector system. Total andrenilla luciferase were measured in cell lysates (20ml). All experiments were performed in triplicate. Data is from three separate transfection experiments. Error bars represent the s.e.m. (P¼0.05).
2206
2 Risdon G, Gaddy J, Stehman FB, Broxmeyer HE. Proliferative and cytotoxic responses of human cord blood T lymphocytes following allogeneic stimulation.Cell Immunol1994;154: 14–24.
3 Kadereit S, Kozik MM, Junge GR, Miller RE, Slivka LF, Bos LSet al.
Cyclosporin A effects during primary and secondary activation of human umbilical cord blood T lymphocytes.Exp Hematol2001;
29: 903–909.
4 Risdon G, Gaddy J, Broxmeyer HE. Allogeneic responses of human umbilical cord blood.Blood Cells1994;20: 566–570; discussion 571–562.
5 Porcu P, Gaddy J, Broxmeyer HE. Alloantigen-induced unrespon- siveness in cord blood T lymphocytes is associated with defective activation of Ras.Proc Natl Acad Sci USA1998;95: 4538–4543.
6 Kaminski BA, Kadereit S, Miller RE, Leahy P, Stein KR, Topa DA et al.Reduced expression of NFAT-associated genes in UCB versus adult CD4+ T lymphocytes during primary stimulation. Blood 2003;102: 4608–4617.
7 Canto E, Rodriguez-Sanchez JL, Vidal S. Naive CD4+ cells from cord blood can generate competent Th effector cells.Transplanta- tion2005;80: 850–858.
8 Andersson J, Stefanova I, Stephens GL, Shevach EM. CD4+CD25+
regulatory T cells are activated in vivo by recognition of self.
Int Immunol2007;19: 557–566.
9 Krampera M, Tavecchia L, Benedetti F, Nadali G, Pizzolo G.
Intracellular cytokine profile of cord blood T-, and NK-cells and monocytes.Haematologica2000;85: 675–679.
10 Bachmann MF, Oxenius A. Interleukin 2: from immunostimulation to immunoregulation and back again.EMBO Rep2007;8: 1142–1148.
11 Powell JD, Ragheb JA, Kitagawa-Sakakida S, Schwartz RH.
Molecular regulation of interleukin-2 expression by CD28 co-stimulation and anergy.Immunol Rev1998;165: 287–300.
12 Wolf M, Schimpl A, Hunig T. Control of T-cell hyperactivation in IL-2-deficient mice by CD4(+)CD25() and CD4(+)CD25(+) T cells: evidence for two distinct regulatory mechanisms. Eur J Immunol2001;31: 1637–1645.
13 Bosque A, Marzo I, Naval J, Anel A. Apoptosis by IL-2 deprivation in human CD8+ T-cell blasts predominates over death receptor ligation, requires Bim expression and is associated with Mcl-1 loss.
Mol Immunol2007;44: 1446–1453.
14 Long SA, Buckner JH. Combination of rapamycin and IL-2 increasesde novoinduction of human CD4(+)CD25(+)FOXP3(+) T cells.J Autoimmun2008;30: 293–302.
15 Jain J, Loh C, Rao A. Transcriptional regulation of the IL-2 gene.
Curr Opin Immunol1995;7: 333–342.
16 Jain J, Valge-Archer VE, Rao A. Analysis of the AP-1 sites in the IL-2 promoter.J Immunol1992;148: 1240–1250.
17 Chen L, Glover JN, Hogan PG, Rao A, Harrison SC. Structure of the DNA-binding domains from NFAT, Fos and Jun bound specifically to DNA.Nature1998;392: 42–48.
18 Chen L, Oakley MG, Glover JN, Jain J, Dervan PB, Hogan PGet al.
Only one of the two DNA-bound orientations of AP-1 found in solution cooperates with NFATp.Curr Biol1995;5: 882–889.
19 Diebold RJ, Rajaram N, Leonard DA, Kerppola TK. Molecular basis of cooperative DNA bending and oriented heterodimer binding in the NFAT1–Fos–Jun–ARRE2 complex. Proc Natl Acad Sci USA 1998;95: 7915–7920.
20 Kadereit S, Mohammad SF, Miller RE, Woods KD, Listrom CD, McKinnon Ket al.Reduced NFAT1 protein expression in human umbilical cord blood T lymphocytes.Blood1999;94: 3101–3107.
21 Sterkers G, Henin Y, Kalil J, Bagot M, Levy JP. Influence of HLA class I- and class II-specific monoclonal antibodies on DR- restricted lymphoproliferative responses. I. Unseparated popula- tions of effector cells.J Immunol1983;131: 2735–2740.
22 Frandji P, Tkaczyk C, Oskeritzian C, David B, Desaymard C, Mecheri S. Exogenous and endogenous antigens are differentially presented by mast cells to CD4+ T lymphocytes.Eur J Immunol 1996;26: 2517–2528.
23 Pfaffl MW, Horgan GW, Dempfle L. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR.Nucl Acids Res2002;
30: e36.
24 Mitchell CA, Jefferson AB, Bejeck BE, Brugge JS, Deuel TF, Majerus PW. Thrombin-stimulated immunoprecipitation of phos- phatidylinositol 3-kinase from human platelets.Proc Natl Acad Sci USA1990;87: 9396–9400.
25 Schug J. Current Protocols in Bioinformatics. Wiley: Hoboken, 2003.
26 Oyake T, Itoh K, Motohashi H, Hayashi N, Hoshino H, Nishizawa M et al. Bach proteins belong to a novel family of BTB-basic leucine zipper transcription factors that interact with MafK and regulate transcription through the NF-E2 site.Mol Cell Biol1996;
16: 6083–6095.
27 Bhaumik SR, Green MR. Interaction of Gal4p with components of transcription machinery in vivo. Methods Enzymol 2003; 370:
445–454.
28 Chuvpilo S, Avots A, Berberich-Siebelt F, Glockner J, Fischer C, Kerstan A et al. Multiple NF-ATc isoforms with individual transcriptional properties are synthesized in T lymphocytes.
J Immunol1999;162: 7294–7301.
29 Muckenfuss H, Hamdorf M, Avots A, Sanzenbacher R, Tschulena U, Cichutek Ket al.IL-2 induction by simian immunodeficiency virus involves MAP kinase signaling but is independent of calcineurin/NF-AT activity.Mol Immunol2006;43: 1172–1182.
30 Jain J, McCaffrey PG, Miner Z, Kerppola TK, Lambert JN, Verdine GLet al.The T-cell transcription factor NFATp is a substrate for calcineurin and interacts with Fos and Jun. Nature 1993; 365:
352–355.
31 D’Arena G, Musto P, Cascavilla N, Di Giorgio G, Fusilli S, Zendoli Fet al.Flow cytometric characterization of human umbilical cord blood lymphocytes: immunophenotypic features. Haematologica 1998;83: 197–203.
32 Garcia Vela JA, Delgado I, Bornstein R, Alvarez B, Auray MC, Martin I et al.Comparative intracellular cytokine production by in vitro stimulated T lymphocytes from human umbilical cord blood (HUCB) and adult peripheral blood (APB).Anal Cell Pathol 2000;20: 93–98.
33 Ahmadzadeh M, Rosenberg SA. IL-2 administration increases CD4+ CD25(hi) Foxp3+ regulatory T cells in cancer patients.
Blood2006;107: 2409–2414.
34 Malek TR, Bayer AL. Tolerance, not immunity, crucially depends on IL-2.Nat Rev2004;4: 665–674.
35 Muto A, Hoshino H, Madisen L, Yanai N, Obinata M, Karasuyama Het al.Identification of Bach2 as a B-cell-specific partner for small maf proteins that negatively regulate the immunoglobulin heavy chain gene 30enhancer.EMBO J1998;17: 5734–5743.
36 Sasaki S, Ito E, Toki T, Maekawa T, Kanezaki R, Umenai Tet al.
Cloning and expression of human B cell-specific transcription factor BACH2 mapped to chromosome 6q15.Oncogene2000;19:
3739–3749.
37 Vieira SA, Deininger MW, Sorour A, Sinclair P, Foroni L, Goldman JM et al.Transcription factor BACH2 is transcriptionally regulated by the BCR/ABL oncogene.Genes Chromosomes Cancer2001;32: 353–363.
38 Muto A, Tashiro S, Tsuchiya H, Kume A, Kanno M, Ito E et al.
Activation of Maf/AP-1 repressor Bach2 by oxidative stress promotes apoptosis and its interaction with promyelocytic leukemia nuclear bodies.J Biol Chem2002;277: 20724–20733.
39 Hoshino H, Igarashi K. Expression of the oxidative stress-regulated transcription factor bach2 in differentiating neuronal cells.
J Biochem (Tokyo)2002;132: 427–431.
40 Muto A, Tashiro S, Nakajima O, Hoshino H, Takahashi S, Sakoda E et al.The transcriptional programme of antibody class switching involves the repressor BACH2.Nature2004;429: 566–571.
41 Sakane-Ishikawa E, Nakatsuka S, Tomita Y, Fujita S, Nakamichi I, Takakuwa Tet al.Prognostic significance of BACH2 expression in diffuse large B-cell lymphoma: a study of the Osaka Lymphoma Study Group.J Clin Oncol2005;23: 8012–8017.
42 Chen W, Zhang W, Zhu J. [Homozygous deletion and methylation of p16 and p15 gene in acute leukemia].Zhonghua xue ye xue za zhi¼Zhonghua xueyexue zazhi1999;20: 474–476.
43 Kadereit S, Junge GR, Kleen T, Kozik MM, Kaminski BA, Daum- Woods Ket al.Deficient IFN-gamma expression in umbilical cord blood (UCB) T cells can be rescued by IFN-gamma-mediated increase in NFATc2 expression.J Clin Immunol2003;23: 485–497.
44 Kleen TO, Kadereit S, Fanning LR, Jaroscak J, Fu P, Meyerson HJ et al.Recipient-specific tolerance after HLA-mismatched umbilical cord blood stem cell transplantation. Transplantation 2005;80:
1316–1322.
45 Han S, Williams S, Mustelin T. Cytoskeletal protein tyrosine phosphatase PTPH1 reduces T cell antigen receptor signaling.
Eur J Immunol2000;30: 1318–1325.
2207
