-Post-transcriptional control of amino acid identity in protein synthesis and temperature-dependent gene expression-
Dissertation submitted for the degree of Doctor of Natural Sciences (Dr. rer. nat.)
Presented by Athanasios Saragliadis
at the
Faculty of Natural Sciences Department of Chemistry
Date of the oral examination: 26.06.2013 First supervisor: Prof. Dr. J. Hartig Second supervisor: Prof. Dr. A. Marx
Konstanzer Online-Publikations-System (KOPS) URL: http://nbn-resolving.de/urn:nbn:de:bsz:352-240706
This work or parts of it was published in:
J. Am. Chem. Soc.
2013, in Press
A. Saragliadis, J.S. Hartig, „Ribozyme-based tRNA switches for post-transcriptional control of amino acid identity in protein synthesis”
RNA Biol.
2013, Apr 1, 10(6), in Press
A. Saragliadis, S.S. Krajewski, C. Rehm, F. Narberhaus, J.S. Hartig, „Thermozymes: Synthetic RNA thermometers based on ribozyme activity”
Mol Biosyst.
2012, Sep;8(9):2242- 8
B. Klauser*, A. Saragliadis*, S. Ausländer, M. Wieland, M.R.
Berthold, J.S. Hartig, „Post-transcriptional Boolean computation by combining aptazymes controlling mRNA translation initiation and tRNA activation”
* Authors contributed equally to this work
Book chapter for Methods in Molecular Biology:
2012,848:455-63
A. Saragliadis, B. Klauser, J.S. Hartig, „In vivo screening of ligand-dependent hammerhead ribozymes”
ἓν οἶδα ὅτι οὐδὲν οἶδα (Σωκράτης; c. 469 BC – 399 BC)
I
1. Introduction………1
1.1. The genetic code...……….1
1.2. RNA as a versatile tool...……….2
1.3. RNA stability....……….9
1.4. Catalytic RNA: ribozymes and riboswitches...…………...10
1.5. RNA thermometers...………...……….17
2. Aim of this work...………...…...………..20
3. Results and Discussion...……...………...………21
3.1. Post-transcriptional control of amino acid identity in protein synthesis 21 3.1.1. Introduction.………...……….21
3.1.2. Individual tRNA-switching systems.………...………23
3.1.2.1. Description and construction of individual tRNA switches...23
3.1.2.2. Description and construction of individual tRNASerCUA switches...25
3.1.2.3. Description and construction of individual tRNALeuCUA switches...29
3.1.2.4. Description and construction of individual tRNAAlaCUA switches...32
3.1.3. Dual tRNA-switching systems.………...………35
3.1.3.1. Construction and characterization of dual tRNA switch systems...35
3.1.3.2. Characterization of dual theoON-tRNAAlaCUA-tppON- tRNASerCUA switch system...36
Table of Contents
II
3.1.3.3. Characterization of dual theoON-tRNALeuCUA-
tppON-tRNASerCUA switch system...39
3.1.3.4. Characterization of dual theoOFF-tRNALeuCUA- theoON-tRNASerCUA(pMAB) switch system...41
3.1.3.5. Expanding application by investigating additional mutation sites...44
3.1.3.6. Mechanism investigation of ligand-induced tRNA activation...46
3.1.3.7. In vitro cleavage activity of ribozyme-tRNA-fusion constructs...47
3.1.4. Conclusion...……….50
3.2. Temperature-dependent gene expression using ribozymes …...51
3.2.1. Introduction...………...50
3.2.2. Design and construction investigation of temperature-regulated riboswitches ...53
3.2.2.1. Construction of Thermozymes...53
3.2.2.2. Communication module effect for temperature- regulated riboswitches...56
3.2.3. Conclusion...58
4. Summary and Outlook...………59
4.1. Zusammenfassung und Ausblick...……….60
5. Materials and Methods...………63
5.1. Materials.………….………...……….63
5.1.1. Consumables...…...63
5.1.2. Nucleotides...………...……….……….63
III
5.1.3. Standards and Kits...……....……….……….64
5.1.4. Enzymes and Proteins...64
5.1.5. Media and Culture buffers...65
5.1.6. Equipment...68
5.2. Molecular biology Methods...…………...……….69
5.2.1. Agarose gel electrophoresis...69
5.2.2. DNA extraction from agarose...………...…….70
5.2.3. Denaturing Polyacrylamide electrophoresis...…….70
5.2.4. Ethanol precipitation...………...…….71
5.2.5. Plasmid DNA isolation and nucleic acid quantification...…….72
5.2.6. Phenol Chloroform extraction...72
5.2.7. Total RNA isolation from bacterial culture....………...…….73
5.2.8. Transformation of electro-competent cells………...……....73
5.2.9. Northern Blot analysis...73
5.3. Enzymatic reactions………...74
5.3.1. Polymerase chain reaction (PCR)...…...74
5.3.2. Digestion of DNA using restriction endonucleases...75
5.3.3. Dephosphorylation of cut vectors...……...…….75
5.3.4. Ligation of fragments of double stranded DNA...…….76
5.3.5. Radioactive labeling of oligonucleotides for Northern Blot analysis...76
5.3.6. In vitro transcription of ribozymes...…….76
5.3.7. In vitro cleavage activity of ribozymes...77
Table of Contents
IV
5.4. Protein expression and purification...78
5.4.1. eGFP expression assays...…...78
5.4.2. Protein purification...78
5.4.3. Glycin SDS polyacrylamide electrophoresis...…….79
5.4.4. Protein concentration determination...…….79
5.4.5. Western Blot analysis...………...…….79
5.4.6. Protein mass spectrometry...…….80
5.4.7. Tryptic digest of protein samples...80
5.4.8. Liquid chromatography analysis of protein tryptic peptides...80
6. List of abbreviations...81
7. Experimental...83
7.1. Construct generation………...………...83
7.2. SDS-PAGE analysis of expressed eGFP protein using dual construct theoON-tRNAAlaCUA-tppON-tRNASerCUA.……...……….88
7.3. Mass spectrometry of intact protein expressed using dual construct theoON-tRNAAlaCUA-tppON-tRNASerCUA.…...……...……….89
7.4. Mass spectrometry of intact protein expressed using dual construct theoON-tRNALeuCUA-tppON-tRNASerCUA...……...……….91
7.5. In vitro cleavage activity of ribozyme-tRNA-fusion control constructs...93
8. References...94
9. Appendices...……....…………...……….102
9.1. Plasmid maps....………...……....………...102
9.2. Primers used for cloning………...………...108
V 9.3. Tryptic digest LC/MS total ion current chromatograms and ion
extraction…...………...………...110 10. Acknowledgements...……....………128 11. Eidesstattliche Erklärung...……....………...………129
1 1. Introduction
1.1. The genetic code
Deoxyribonucleic acid (DNA) is the macromolecule containing the necessary genetic information to build up an organism and regulate its functions. The genetic information contained in the DNA molecule can undergo specific procedure called transcription during which DNA is copied into a different macromolecule, the ribonucleic acid (RNA). DNA and RNA macromolecules consist of smaller building units, called nucleotides which in turn are composed of a sugar moiety and a base.
There are two sugar moieties, a deoxyribose for DNA and a ribose for RNA.
Moreover, the nucleobases in common for DNA and RNA are adenine (A), guanine (G) and cytosine (C) and additionally specific for DNA thymine (T) and for RNA uracil (U). Each nucleotide is coupled to the next one with a phosphodiester bond following a specific orientation from the 5’ to the 3’ carbon of the nucleotide’s sugar moiety.
Figure 1: Chemical structure of nucleotides, the building blocks of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). A phosphodiester bond connects a phosphate to a ribose (RNA) or a 2’- deoxyribose (DNA) at the 5’-carbon of the sugar moiety, while the 1’-carbon is connected to
Introduction
2
nucleobases which are shown below. The nucleobases in DNA are adenine, guanine, cytosine and thymine and the same in RNA with the exception of uracil instead of thymine. The nucleobases are connected at position 9 for a purine (adenine and guanine) or at position 1 for a pyrimidine (cytosine, thymine and uracil).
1.2. RNA as a versatile tool
Individual types of RNA can take part in a fundamental process in a living organism called protein synthesis. During protein synthesis, a biopolymer class called protein is synthesised using as building blocks amino acids in order to form polypeptide chains.
Initially RNA as a messenger molecule (messenger RNA or mRNA) contains the newly transcribed instructions from DNA indicating the amino acid order during protein synthesis. In a next step mRNA is translated, a process which involves another form of RNA, the transfer RNA (tRNA) which is responsible for the decoding of the specific message by supplying the correct amino acids to the ever-growing peptide chain in response to the correct corresponding codon on the mRNA. Finally another form of RNA, the ribosomal RNA (rRNA) is participating in the protein biosynthesis by forming large complexes with specific proteins in order to create the ribosome, which is the ‘factory’ where the protein synthesis is taking part in a cell.
Figure 2: RNA roles in protein synthesis. Messenger RNA (mRNA) is translated into protein with the aid of transfer RNA (tRNA) and the ribosome which is composed of ribosomal RNA (rRNA) molecules and various proteins. The generation of the polypeptide chain is catalyzed by rRNA allowing the peptide bond formation of the N-terminal amino acid and the incoming charged tRNA with another amino acid (aa-tRNA). From reference [1]
3 The character and function of the ribosome along with the participating components and factors are highly conserved and can be found in all kingdoms of life. Since the work described herein was performed in bacterial cultures (E. coli), therefore most of the general biological concepts discussed, will be in regard to prokaryotic organisms.
The prokaryotic ribosome is named after its sedimentation coefficient as 70S (S stands for Svedberg unit) for the intact structure, which in turn is composed of the large ribosomal subunit 50S and the small ribosomal subunit 30S. The large subunit consists of 23S and 5S rRNA molecules along with ~30 proteins and the small subunit of 16S rRNA and ~20 proteins.[2]
Introduction
4
Figure 3: Top panel showing the 23S and 5S rRNA, the proteins (blue), and CCA models (red). Middle panel showing the 50S ribosomal subunit with three tRNA molecules docked onto the A-, P-, and E- sites (yellow, red and white respectively). Taken from reference [3]. Lower panel showing the mechanism of peptide synthesis catalyzed by the ribosome (B stands for rRNA base). Taken from reference [4]
In order for the ribosome to carry out the feat of protein biosynthesis in a productive manner, several interactions are needed. For instance mRNA has to interact with the small subunit while for tRNA there are three distinct sites for interaction with both subunits. The latter sites are named after the corresponding tRNA moieties that can bind as: aminoacyl (A) site which has affinity for aminoacyl-tRNA (aa-tRNA), peptidyl (P) site which has affinity for peptidyl-tRNA and the exit (E) site with affinity for deacylated tRNA.[2,5] The message decoding is facilitated on the small subunit and in the large subunit is situated the catalytic core with the peptidyl transferase center.
This complicated process undergoes the steps of initiation, elongation, termination and recycling and it does necessitate not only RNA molecules but the participation of other individual factors during each stage. For instance, the initiation and termination steps are tightly regulated by the binding of initiation, release and recycling factors.[6- 11]
5 Figure 4: Representation of translation in prokaryotes, adapted from reference [5]
During protein biosynthesis the tRNA that participates into the translation process needs to be coupled (charged) with the correct cognate amino acid. This mechanism is mediated by the aminoacyl-tRNA synthetase in a two step mechanism. First step is the activation of the amino acid by adenosine triphosphate (ATP) in order to form the synthetase-bound aminoacyl adenylate (equation 1) and the second step is the transfer of the activated amino acid from the adenylate to the 3’-end of the tRNA (equation 2).[12]
aa stands for amino acid, aaRS the corresponding tRNA synthetase, PPi is the pyrophosphate and tRNAaa is the cognate tRNA for the specific amino acid.
Introduction
6
Although all the aminoacyl-tRNA synthetases catalyze the same reaction of transfer of the correct amino acid to the cognate tRNA, they are divided in two classes (I and II) based on similarities in the catalytical core specific motifs.[12] The task of the aminoacyl synthetases is twofold: first they have to select the correct amino acid and second the correct and cognate tRNA for the specified amino acid. The standard genetic code enables the relation between the three-nucleotide unit (codon) with a single amino acid. From a total of 64 combinations, the 61 encode for one of the 20 amino acid that are incorporated into proteins while three encode for a unique stop codon which results in the termination of the translation process.
Figure 5: The standard genetic code (RNA format). Taken from reference [13]
Selecting between tRNAs is a more straightforward process compared to selecting for the correct amino acid. tRNAs are relatively large molecules which are evolved with specific determination characteristics in their scaffolding. Specifically the three anticodon nucleotides and the acceptor stem residues (N73) are of major importance as identity recognition elements by the synthetases.[14] On the other hand selecting for the appropriate amino acid is more elaborate process since there are chemically and structurally similar amino acids. For this purpose a proofreading mechanism takes place composed of initially a discrimination of amino acid molecules based on size and chemical interactions which is followed by specific editing pathways that contain disassembly of non-viable products of erroneous activation or attachment.[15,16]
7 Figure 6: Identity elements for tRNA aminoacylation by class I and II aminoacyl tRNA synthetases.
Spheres depict the specific identity elements with size proportional to their frequency. Taken from reference [14]
Termination of protein synthesis occurs when release factors (RF) sense in the ribosomal A site one of the three codons used as stop signals (UGA, UAG or UAA).
Although these codons are generally reserved as stop signals, organisms deviate from the standard assignment.[17,18] For example UGA in vertebrate mitochondria encodes for tryptophan and AUA for methionine[19] while other organisms show selective preference for one over the other stop codon such as Tetrahymena which uses only UGA while UAA and UGA encode for the amino acid glutamine.[20]
Nevertheless, in bacteria the stop codons are recognized by class I release factors RF1 and RF2. From the three different stop codons, UAA is recognized by both release factors while RF1 recognizes additionally UAG while RF2 UGA.[21]
Additionally, a class II release factor (RF3) which does not recognize stop codons but possesses GTPase activity, assists in dissociating RF1 or RF2 from the ribosomal release complex.[22] Following this event, ribosome recycling factor (RRF) along with initiation and elongation factors assist in dissociating the release complex and the individual components (subunits, tRNA and mRNA) are released.[23]
Introduction
8
Figure 7: class I (RF2) and class II (RF3) release factor action in bacteria. Adapted from reference[24]
Except from the physiological function as signals to protein biosynthesis termination, stop codons have been utilized extensively by researchers as tools to investigate and influence protein function and structure. This can be done by the so-called codon reassignment where the identity of a stop codon is altered from non-sense into sense, encoding for natural or unnatural amino acids. Examples of natural suppression are tRNAs discovered in organisms encoding for selenocysteine[25,26]
and pyrrolysine[27] which are designated as the 21st and 22nd amino acids.
Additionally in E. coli and in other organisms have been described natural suppressor tRNAs where the codons are converted from nonsense into sense in presence of suitable tRNA.[28-30] The tRNA identity elements that were discussed earlier, have been exploited in the field of nonsense suppression by generating tRNA constructs with different identity encoding for diverse natural amino acids.[31-33] Moreover, scientists have utilized the suppression methodology in order to expand the genetic code by introducing unnatural amino acids with the aid of orthogonal pairs of tRNA and aminoacyl-tRNA synthetase. The orthogonality describes the characteristic of the imported constructs which are not recognized and therefore processed by the host
9 biological machinery. Scientists initially were able to decode nonsense codons by introducing the unnatural amino acid with a chemically aminoacylated suppressor tRNA [34] and then in a cell free translation system supplying the necessary aminoacyl-tRNA synthetase in order to produce the mutant protein or by microinjecting the necessary components into cells.[35] More advanced methods for in vivo incorporation of unnatural amino acids includes the use of the orthogonal tRNA-synthetase pairs that were applied effectively in prokaryotes and other organisms.[36-38] Furthermore, transorganismal transfer of tRNAs and synthetases allowed for reduced background tRNA misalcylation and the rational design of tRNAs and specific synthetases made possible to enhance performance and genetically encode more than 30 unnatural amino acids in various organisms.[39,40]
1.3. RNA stability
Depending on the resistance of RNAs to the cellular processes that degrade them, they are categorized into stable or unstable. RNA species such as mRNA undergo a more rapid decay as dictated by the protein requirements of the cell.[41] The stable RNAs, such as rRNA and tRNA, have a half-life that is longer than the doubling time of their corresponding cells and they amount to more than 95% of the total RNA in a cell culture at exponential growth.[42] They have the potential to complex with proteins in the ribosome or undergo aminoacylation reactions for the tRNA, adopting secondary and tertiary structures that offer protection to degradation mechanisms.
However under special growth conditions, such as nutrient lack, cell stationary phase or in general slow growth conditions, even stable RNAs might be subjected to decay process in order for the cell to adapt and survive during the new and unfavorable conditions.[43]
Next to RNA degradation of both stable and transient species, another process called RNA maturation, is similar from mechanistic point-of-view to the RNA degradation and in the meanwhile equally essential to the function of RNA population. Precursor RNAs are processed into processing intermediates which in turn are further processed to yield the mature RNAs.[44]
The RNA decay and maturation are initiated, controlled and finalized by specific enzymes called ribonucleases (RNases) which exhibit catalytic function in a overlapping fashion between the two processes.[44]
Introduction
10
Scheme 1: Degradation and maturation of RNA species in E.coli. The specific enzymes (ribonucleases or RNases) for each process are shown. Ref[44]
1.4. Catalytic RNA: ribozymes and riboswitches
RNA is a very versatile and important molecule. Apart from the fundamental role it holds in protein biosynthesis, another function was discovered in the early 1980s.
The innovating and independent discovery of Cech and Altman attributed the RNA molecules with the ability to catalyze biochemical reactions.[45,46] These RNA molecules with catalytic activity are called ribozymes.
It is noteworthy that ribonuclease P (RNase P) was the first described catalytic RNA molecule to be later known as ribozyme.[45]. After the initial discoveries and success in the field of RNA catalysis that resulted in the Nobel Prize in 1989, several other catalytic RNA domains were described, such as the hammerhead ribozyme (HHR), the Varkud satellite (VS), the hepatitis delta virus (HDV), and the hairpin motif, which are relatively small in size.[47-52] One the other side, group I and II introns and the already mentioned RNase P as well as the ribosome itself are much larger RNA constructs with catalytic activity.[53-56] Particularly the ribosome, is a multimeric complex of initially two unequal in size subunits which in turn are composed of rRNA
11 and proteins. However, based on structure analysis the active site where the catalytic reaction (peptidyltransferase center) takes place is based on RNA only.[3]
Specifically, the hammerhead ribozyme was initially discovered in viroids and plant viruses.[47,48,50,57] It is composed of three helices (I, II and III) surrounding a catalytic core and the first structures of the ribozyme solved, allowed the characterization of the so-called minimal motif which shed light on the geometrical requirements for the catalytic activity.[58,59] A more expanded structure was solved in the following years demonstrating the importance of tertiary interactions for stems I and II of the ribozyme in order to achieve high (1000-fold, compared to the minimal) catalytic efficiency.[60,61]
Figure 8: Figure showing comparison of the hammerhead ribozyme motifs. Ai, Aii minimal and Bi, Bii extended hhr motif. Below are the secondary structures with conserved nucleotides shown in bold.
Taken from references [59,60]
Depending on the connectivity of the helices I, II or III there are three different types of hammerhead ribozymes; type I and type II hammerhead ribozymes are the most
Introduction
12
frequently occurring in nature across various life domains, while type II thought to be absent in nature, has been very recently described.[62,63]
Figure 9: Figure showing the consensus secondary structure for type I, II and III hammerhead ribozymes. Depending on whether stem I or II or III are connected with a loop, determines the corresponding type of ribozyme.[63]
The catalysis reaction performed by the hammerhead ribozyme is a reversible RNA cleavage reaction generating 2’,3’-cyclic phosphate and 5’-hydroxyl fragments, in a similar reaction to the ones performed by the other ribozymes (such as hairpin, HDV and VS) and ribonucleases.[64,65] Although the exact role of divalent metal ions in relation to hammerhead ribozyme function still remains in question, Murray and co- workers have shown with in vitro experiments that the hammerhead ribozyme does not strictly require divalent metal ions for efficient catalysis.[66] The cations, however, seem to assist in RNA folding and enhance the catalysis.[67] Other researchers have additionally proposed models for ribozyme cleavage based on participation of two metal ions.[68]
13 Figure 10: Characteristics of the postulated mechanisms of the hammerhead ribozyme catalysis. A Positioning of catalysis specific residues as determined by crystal structure analysis and B transition- state of the catalysis.[60] C General acid-base catalysis mechanism [69] and D two metal ion participation catalysis mechanism (RDS: rate determining step).[68]
Next to the ribozymes found in nature, there are also the ones found through in vitro selection processes. By incubating the appropriate substrates along with RNA sequences composed of randomized segments, one is able to identify optimal and functional structures for the desired catalysis reaction conditions. This way various ribozymes with diverse catalysis functions have been described, ranging from (amino)acylation, peptidyl transfer, trans-esterification, sulphur-alkylation to Diels- Alder reaction.[70-74]
Introduction
14
Constant adaptation of bacteria to possible environmental variations is of paramount importance to their survival even in the most adverse conditions. In order to achieve that, bacteria have developed mechanisms that allow them to regulate their gene expression depending on the exact environmental input. Various regulatory mechanisms govern gene expression, and very frequently are related to proteins that affect the activity of RNA polymerase. This can be achieved by specific proteins that affect promoter binding and activation, RNA chain initiation and promoter escape, RNA transcript elongation and RNA transcript termination and release.[75] The majority of 285 E. coli protein factors that affect transcription during initiation process are DNA-binding proteins.[76,77]
Not only regulatory proteins can control gene expression but additionally regulatory RNAs are reported to have similar functionality.[78,79] It was suggested early that RNA could be involved in the process of gene regulation[80] but more recently we discovered that regulatory RNAs can have a multitude of functions in regard to gene expression control: can affect transcription attenuation, translation initiation and mRNA stability.[81-83] This regulation function can take part intermolecularly (in trans)[84,85] or intramolecularly (in cis)[86]. In some early experiments, the cis-acting mechanism was investigated in the 70s by characterizing the transcription attenuation mechanism of the trp operon and the tryptophane biosynthesis genes.[87] Another ‘feedback’ regulation mechanism that was elucidated was the one related to amino acid biosynthesis, the ‘T-box RNA’ mechanism, where the concentration of free amino acid and uncharged tRNA determines the activation or not of the downstream biosynthesis genes.[88,89]
Moreover, there can be RNA-only control of gene expression by binding of metabolites without the need for protein factors. That can be achieved with the help of RNA genetic control elements called riboswitches. They are normally located in 5’
untranslated regions (UTRs) and are composed of a domain which recognizes metabolites called aptamer domain and a domain located downstream of the aptamer domain called expression platform. Upon binding of the cognate ligand-metabolite to the aptamer domain, it undergoes structural rearrangement which alters the expression of the downstream located gene [90-92]. Depending on the specific riboswitch type, the exact mechanism of function might vary, however the most frequent mechanisms of gene expression regulation by riboswitch are based on the
15 formation of alternate structures that either change transcription termination or translation initiation [93-95]. The former mechanism is an alternative to Rho dependent termination of transcription[96], where there is no Rho-protein dependency however the increasing concentration of the cognate metabolite will induce upon binding on its aptamer domain, secondary structures of terminator stem- loop followed by poly uridyl residues, a structure known to destabilize transcription elongation complexes.[97] The latter mechanism operates on translational level and is based on the sequestration of the Shine-Dalgarno (SD) sequence within secondary RNA structures that are formed conditionally, depending on the intracellular concentrations of the metabolite, whose biosynthetic mRNA is regulated.[94]
Figure 11: Riboswitch mediated gene regulation based on transcription termination and translation initiation. Taken from reference [98].
There is a large variety of metabolite sensing riboswitches operating in similar fashion by binding of cognate metabolites to mRNA that encodes for metabolite biosynthesis and uptake.[92,93,99-101] Among the natural riboswitches that are able to sense their corresponding metabolites, are flavin mononucleotide (FMN), thiamine pyrophosphate (TPP), adenosylcobalamin (AdoCbl), S-adenosylmethionine (SAM), S-adenosylhomocysteine (SAH), cyclic di-GMP, adenine, guanine, glycine, and lysine.[94,95,102-108]
Introduction
16
Figure 12: Classes of metabolite-sensing riboswitches and their corresponding metabolites. Taken from reference [99].
Along with the natural systems that are able to sense biological metabolites and regulate gene expression, scientist have utilized, designed and selected artificial aptamers showing specific affinity towards designer molecules.[109] With the aid of systematic evolution of ligands by exponential enrichment or SELEX, nucleic acid sequences that bind specific ligands have been identified already more than 20 years ago.[110-115] Among the small molecules able to be recognized are various aromatic ligands such as theophylline[116], amino acids like citrulline and arginine
17 [117], oligosaccharides like tobramycin[118] and neomycin[119], peptides (REV- binding elements)[120-122] and proteins (phage MS2 coat protein)[123].
1.5. RNA thermometers
RNA-based sensors are able to respond not only to chemical inputs, but also to temperature variations. This class of RNA sensors, known as RNA-thermosensors, when they are encountered in nature they adopt different secondary structures in response to temperature changes. They function mainly by controlling gene expression via sequestering the Shine-Dalgarno (SD) sequence at low temperatures, hence inhibiting translation initiation. At elevated temperatures, the hairpin secondary structure unfolds and liberates the SD sequence allowing the expression of the downstream gene[124].
The first RNA thermometer identified in λ phages was described by Altuvia et al.[125]
This RNA thermometer functions by controlling the expression of the cIII protein at different temperatures, directing the path between the lytic or lysogenic cycle of the phage [125]. The most common RNA thermometer is the ROSE (Repression Of heat Shock gene Expression) element that controls the expression of heat shock genes [126,127]. Until recently more than 40 ROSE elements in various bacterial species ranging in sizes between 60 and 100 nt have been discovered [127,128]. Another class of RNA thermometers is the fourU RNA thermometer of Salmonella species.
Masking of the SD sequence is achieved by base-pairing of four uridines to the SD sequence at low temperatures while at higher temperatures the expression of the heat shock protein AgsA is induced by melting of this hairpin [129,130].
Complementary to RNA thermometers inducing gene expression with temperature increase, a cis-acting mRNA element that switches on gene expression upon a decrease of temperature has been described [131]. The induction of the cold-shock genes cspA and cspE in E. coli is facilitated by stabilizing alternate structures at lower temperatures that liberate the SD region in order to activate gene expression [132]. Moreover, trans-acting, small, non-coding RNAs can regulate translation in a temperature dependent fashion. An example of this kind of mechanism is the regulation of RpoS (σ38), where two sRNAs (DsrA – 85 nt and RprA - 105 nt) induce translation by base-pairing to the rpoS mRNA and forming secondary structure that
Introduction
18
resolves the hairpin which sequesters the ribosome-binding site at normal growth conditions.[133,134]
Figure 13: General mechanisms of RNA thermosensor function, acting in cis (A) or trans (B). Adapted from reference [124].
In addition to naturally occurring temperature-sensitive gene switches, artificial RNA thermometers have been constructed [135,136]. Starting from a computational design followed by an in vivo screening process, induction of gene expression upon increasing temperatures has been demonstrated.[135,137] Furthermore, four- stranded G-rich sequences capable of forming RNA quadruplex structures in E. coli, exhibited similar behavior: The potential quadruplex sequences were positioned in a way that formation of the quadruplex structure results in masking of the SD sequence. In effect, RNA thermometers displayed increased gene expression at elevated temperatures compared to control constructs lacking the said sequence [138].
19 Figure 14: Natural and artificial RNA-thermosensors. A. Temperature induced translation initiation, dependent on an RNA-thermosensor in Listeria monocytogenes.[139] Taken from reference [99]. B.
G-rich sequence-based RNA-thermosensor.[138] C. Alternative structures used for in silico-based RNA-thermosensor design.[136]
Aim of this work
20
2. Aim of this work
The aim of this study was to demonstrate that tRNA switches are suited for controlling the identity of individual amino acids post-transcriptionally. Such a control over protein synthesis could be a potentially invaluable tool to investigate protein structure and functionality. In order to achieve our goal, novel small-molecule dependent tRNA switches have been developed. The individual tRNA switches we generated showcase the versatility of the specific RNA tools and furthermore we combined them into dual tRNA switches allowing for conditional translation of the same message on mRNA level.
In the experiments described herein, we initially designed novel tRNA-switches for control of a single amber suppressor tRNA which were identified via in vivo screening process. Their highly modular design allowed for rational construction of additional single tRNA switches; by exchanging one amber suppressor tRNA for another or one aptamer domain for another and with the help of optimization experiments, the best single tRNA-switches were ultimately combined into dual ligand dependent tRNA- switches that were used in a set of experiments that serves as a proof of concept for the post-trascriptional control of amino acid identity.
The other aim of this research was to generate novel hammerhead-based riboswitches suited for temperature dependent regulation of gene expression. For this purpose we designed an RNA-based construct that regulates gene expression by masking (OFF) or releasing (ON) the Shine-Dalgarno (SD) sequence, depending on the temperature variation. To achieve this, a hammerhead ribozyme was utilized in a way that it is under temperature control with the aid of a thermosensing hairpin which in turn is fused in the place of stem III of the hammerhead ribozyme.
Functional temperature responsive constructs were identified after an in vivo screening process and were methodically characterized providing us with novel RNA tools that are able to respond to temperature change.
21 3. Results and Discussion
3.1. Post-transcriptional control of amino acid identity in protein synthesis 3.1.1. Introduction
In order to characterize proteins, often protein mutants are generated in transgenic cellular or organismal models to investigate the involvement of single amino acids with respect to the protein´s function. A given mutation needs to be generated and introduced into the respective model. However, transient studies with switching between mutant and wild-type phenotypes can hardly be realized utilizing conventional methods, making the study of essential or dominant negative mutations cumbersome. We have developed an RNA-based toolbox that allows for switching ribosomal amino acid incorporation from one amino acid to another by reading a given mRNA differently. Hence, the protein composition is controlled on a post- transcriptional level. The approach utilizes molecular RNA switches that allow for controlling the function of two competing tRNAs. The tRNAs both recognize and compete for suppression of an artificial amber codon introduced into the mRNA of interest, see figure 15. Depending on the external addition of a small molecule trigger, a decision of utilizing tRNA1 or tRNA2 is reached. Several orthogonal versions have been constructed and combined in order to switch between incorporation of alanine, serine as well as leucine. The strategy needs only little sequence space and enables switching from one protein variant to another without further manipulating the genetic repertoire of a given cell or organism. The approach should also prove useful in order to fine-tune protein activity by adjusting the level of the functional variant in a dose-dependent manner.
To our knowledge, there is no convenient method available for changing the identity of a specific amino acid post-transcriptionally. However, recent years have seen a series of discoveries related to RNA-based mechanisms that control gene expression. In bacteria, so-called riboswitches are regulating gene expression by binding of small metabolites to mRNAs that encode metabolite biosynthesis and uptake.[92,99] In most cases, ligand binding to an aptamer domain residing in the 5´- UTR triggers a conformational change of the so-called expression platform, thereby regulating transcriptional elongation or translational initiation of the respective mRNAs.[101] Interestingly, even before these natural mechanisms have been discovered, researchers have implemented similar but artificial, RNA-based switches
Results and Discussion
22
of gene expression by introducing aptamers into mRNAs.[109] Recent examples include the control of gene expression of viral, bacterial, as well as eukaryotic mRNAs by several mechanisms.[140-144] Although these examples allow the immediate control of expression without the need of additional protein factors, the approaches only allow to control whether a given message is translated or not. Here we present a novel technology that allows to read a given mRNA differently by implementing switchable designer tRNAs.
It is possible to interfere with protein synthesis by controlling codon usage during translation. Our group has recently presented specific designer amber stop codon- recognizing tRNAs that are placed under control of a self-cleaving hammerhead ribozyme (HHR).[145] For this purpose, the ribozyme was connected in such a way that the typical tRNA cloverleaf secondary structure is not able to fold in the case of an inactive ribozyme. Upon cleavage of the ribozyme, the two RNA fragments dissociate and enable the folding of the functional tRNA.[145] In addition, the system was engineered so that it responds to externally added chemical triggers by attaching aptamers to stem III of the HHR and screening for optimized connection sequences.
In a proof of concept study, a serine tRNA was activated upon addition of the small molecule theophylline to the growth medium.[145] Here we present post- transcriptional control of amino acid identity in proteins by manipulating the activity of two orthogonally controlled tRNAs both decoding an artificial amber codon.
Figure 15: General principle of switching amino acids identity via small molecule-addressable tRNAs.
Two different tRNAs (red and blue) both recognizing an amber codon introduced at the site of interest in the target mRNA can be switched on or off individually. In case of activating tRNA 1 amino acid 1 is incorporated into the protein of interest and vice versa.
23 3.1.2. Individual tRNA-switching systems
3.1.2.1. Description and construction of individual tRNA switches
In order to implement two orthogonally controlled tRNAs, we developed further ligand-dependent ribozyme-regulated tRNAs. We have previously described an amber suppressor tRNA charged with serine that gets switched on in presence of theophylline, termed pMAB501.[145] In order to demonstrate the versatility we decided to use a variety of different amber suppressor tRNAs that could eventually be tailored into the proposed dual system. For this purpose the generated individual amber suppressor tRNAs had identity of serine, leucine and alanine.
We obtained these different ligand-regulated tRNA systems by connecting the respective tRNA to the corresponding aptazyme as shown in figure 16. The ribozyme was positioned upstream of the respective tRNA, the 5´-extension complementary to the 5´-end of the tRNA (the acceptor stem) was designed individually for each tRNA in order to achieve blocking of the cloverleaf secondary structure of the tRNA.
The ribozymes contain an aptamer domain in stem III for regulation of cleavage activity upon external addition of a small molecule (theophylline or thiamine).[94,116]
In order to engineer ligand-dependency of tRNA systems mentioned above, two key features were optimized in the design: The length and composition of the 5´- sequence complementary to the 5´-end (acceptor stem) of the tRNA and the communication module (boxed and gray in figure 16) connecting aptamer and ribozyme domains.
Results and Discussion
24
Figure 16: Modular assembly of the individual tRNA switching system. The hammerhead ribozyme core is attached to an aptamer (Theophylline or Thiamine) and to an amber suppressing tRNA by means of a hybridization stem which renders it non functional in the non-processed form.
The amber suppressor tRNA in combination with eGFP containing an amber stop codon in its mRNA (Ser50CUA) was used as the reporter system. The initial evaluation in regard to the functionality of each particular switch was performed based on fluorescence read-out of the reporter gene. Namely in the condition of a non functional suppressor tRNAs there is a premature termination of translation process of the reporter gene at the amber stop codon and another condition where the suppressor tRNA is functional and able to suppress the amber stop codon on the
25 reporter gene mRNA, allowing the translation and synthesis of a full length protein – in this case eGFP using the fluorescence as a read-out. The amber suppressor tRNA charged with Ala is derived from a lysine amber suppressor tRNA with two point mutations and the amber suppressor tRNA charged with Leu is a leucine amber suppressor tRNA.[146,147] For details of construction of the individual switches see the experimental section.
3.1.2.2. Description and construction of individual tRNASerCUA switches We started off with constructing systems allowing for control of amber suppressor tRNAs with serine identity that switch on upon addition of thiamine (tppON- tRNASerCUA), and systems that switch on or off upon addition of theophylline theoON- tRNASerCUA, theoOFF-tRNASerCUA. We have previously described a switch that generates a serine tRNA in presence of theophylline (pMAB501)[145] and we wanted to identify additional systems that are thiamine or theophylline dependent.
The systems we realized systems inactivate or activate the ribozyme and hence the connected serine tRNA in presence of the corresponding ligand. In order to obtain such reactivities, the connecting sequence between ribozyme and aptamer domains of constructs was randomized and after generation of the libraries in E.coli, we performed an in vivo screen for ligand-dependent tRNA switches. Using eGFP expression levels as read-out, we screened 5000 clones in the presence and absence of ligands in the growth medium and we were able to identify a thiamine- dependent switch that is activated upon addition of ligand and theophylline- dependent switches that are both activated and inactivated upon addition of ligand (Figure 17).
Results and Discussion
26
27 Figure 17: Nucleotide sequence of the aptazyme–tRNA fusion constructs developed for controlling tRNASerCUA on a post-transcriptional level: Top: A serine amber-suppressor tRNA under control of a thiamine-responsive ribozyme (tppON-tRNASerCUA); bottom left: A serine amber-suppressor tRNA under control of a theophylline-responsive ribozyme (theoOFF-tRNASerCUA); bottom right: A serine amber-suppressor tRNA under control of a theophylline-responsive ribozyme (theoON-tRNASerCUA).
Optimized communication module sequences connecting aptamer and ribozyme parts are boxed and shown in grey colour.
In the context of theophylline dependent switches, the performance of the inactivating switch (theoOFF-tRNASerCUA) was evaluated with fluorescence measurements and it was determined to be a down-regulation from 76 to 26% (2.9-fold) compared to the wild type eGFP expression and the performance of the activating switch (theoON- tRNASerCUA) was determined to be an up-regulation from 11 to 54% (4.9-fold) respectively, see figure 18. As a comparison, the performance of the previously described theophylline activating system (pMAB501) that regulated a serine tRNA was an up-regulation from 13 to 52% (4-fold) of the wild type eGFP expression. It is striking the fact that the activating theophylline dependent construct exhibits almost the same functionality; however the connecting sequence between the ribozyme and the aptamer is entirely different. The connecting sequence of construct pMAB501 is a symmetrical one composed of 2 pairs of nucleotides, while the connecting sequence of the newly characterized construct with the same activity, is asymmetrical composed of 5 nucleotides in total, see figure 17.
In the context of thiamine dependent switches, the performance of the activating switch (tppON-tRNASerCUA) was evaluated with fluorescence measurements and it was determined to be an up-regulation from 10 to 55% (5.5-fold) compared to the wild type eGFP expression (figure 18)
Results and Discussion
28
Figure 18: In vivo eGFP expression using the individual constructs tppON-tRNASerCUA; theoOFF- tRNASerCUA and theoON-tRNASerCUA: Top: eGFP expression is dependent on theophylline concentration. With increase of theophylline concentration the gene expression (fluorescence) is increasing in the case construct theoON-tRNASerCUA was used, while gene expression is decreasing in the case construct theoOFF-tRNASerCUA was used; Bottom: eGFP expression is dependent on thiamine concentration. With increase of thiamine concentration the gene expression (fluorescence) is increasing in the case construct tppON-tRNASerCUA was used.
29 3.1.2.3. Description and construction of individual tRNALeuCUA switches In the context of leucine tRNA we realized individual systems that inactivate or activate the ribozyme and hence the connected leucine tRNA in presence of theophylline (theoOFF-tRNALeuCUA and theoON-tRNALeuCUA).
In respect to the theophylline inactivating system, we reasoned that we could directly transfer the connecting sequence between ribozyme and aptamer, from the previously characterized system theoOFF-tRNASerCUA (figure 17) into the designed leucine regulating system. After generating the construct (termed pSAs50x) bearing the inactivating connecting sequence we initially observed that the construct did exhibit the same functionality (inactivating ribozyme upon addition of theophylline) however not in the same extent as in the serine tRNA context (figure 20 ). In order to improve the functionality of the inactivating system regulating leucine tRNA, we re- designed the length and composition of the 5´-sequence complementary to the 5´- end (acceptor stem) of the tRNA, while retaining the same connecting sequence, responsible for the inactivating character of the ribozyme construct. During this optimization process we constructed various systems containing an extended hybridization stem from 3 up to 8 nucleotides long (figure 20 and table 1 ). As it appears the most extended hybridization (8 nucleotides) results into complete loss of function in respect to gene expression in both states, in presence and absence of ligand, indicating that the extended base pairing is thermodynamically too stable to allow for release of the functional leucine tRNA. The resulting OFF switch with extended hybridization (E128) in not functional even in the event of ribozyme cleavage which should be observed in the absence of ligand. A hybridization stem extension of base pairing by 3 base pairs appeared to be optimal. During this process we were fortunate to identify a construct with the desired functionality (theoOFF-tRNALeuCUA or H4). It is worth mentioning that not only the size of the hybridization sequence is of importance but also the content. Interestingly, the length of the 5’-sequence complementary to the acceptor stem of the leucine tRNA for constructs H4 and H1 is the same however they differ in composition (see table 1 ) which results in a slight improvement in the switching functionality from 2-fold for H1 to 3.2-fold for theoOFF-tRNALeuCUA (see figure 20 ). The performance of the inactivating switch (theoOFF-tRNALeuCUA) was evaluated with fluorescence measurements and it was determined to be a down- regulation from 64 to 20% (3.2-fold) compared to the wild type eGFP expression
Results and Discussion
30
Figure 19: Nucleotide sequence of the aptazyme–tRNA fusion constructs developed for controlling tRNALeuCUA on a post-transcriptional level: Left: A leucine amber-suppressor tRNA under control of a theophylline-responsive ribozyme (theoON-tRNALeuCUA); Right: A leucine amber-suppressor tRNA under control of a theophylline-responsive ribozyme (theoOFF-tRNASerCUA). Optimized communication module sequences connecting aptamer and ribozyme parts are boxed and shown in grey colour.
5’-sequence complementary to acceptor stem of tRNALeuCUA
pSAs50x CCGAUUCCACCAUCCGGGC
theoOFF-tRNALeuCUA (H4) UCUACCGAUUCCACCAUCCGGC
H1 UCUCCGAUUCCACCAUCCGGGC
E128 UGUGUCUACCGAUUCCACCAUCCGGGC
Table 1: Sequences of constructs generated with different 5’-complementarity to the acceptor stem of tRNALeuCUA
31 Figure 20: In vivo eGFP expression of individual systems utilizing theophylline responsive ribozymes controlling a leucine amber-suppressor tRNA: Top: eGFP expression using the individual constructs generated during optimization process in order to obtain theoOFF-tRNALeuCUA. The construct pSAs50x contains the original 19 nucleotide long hybridization stem, construct H4 is the construct termed as theoOFF-tRNALeuCUA with the hybridization stem shown in figure 19 3.4, construct H1 has an extended hybridization compared to pSAs50x by 3 nucleotides, and construct E128 extended by 8 nucleotides; Bottom: eGFP expression using the individual construct theoON-tRNALeuCUA.
Results and Discussion
32
In respect to the theophylline activating system, we chose to perform an in vivo screen in order to identify functional switches that turn on gene expression upon addition of theophylline. By randomizing again the connecting sequence between the ribozyme and the theophylline aptamer we performed a screening process as before in the context of serine tRNA allowing us to generate the theoON-tRNALeuCUA (figure 19). The performance of the activating switch (theoON-tRNALeuCUA) was evaluated with fluorescence measurements and it was determined to be an up-regulation from 16 to 47% (2.9-fold) compared to the wild type eGFP expression.
Surprisingly, the two connecting sequences of the generated constructs (theoOFF- tRNALeuCUA and theoON-tRNALeuCUA) differ only in one nucleotide; however they have a reverse functionality, a finding suggesting that the connecting sequence domain might participate in further stabilizing or de-stabilizing tertiary interactions with the hammerhead ribozyme catalytic core.
3.1.2.4. Description and construction of individual tRNAAlaCUA switches In a further effort we generated an additional switch that regulates the activity of an alanine amber suppressor tRNA. For this purpose we exchanged the leucine tRNA sequence from the previously constructed system (theoON-tRNALeuCUA) with the one of alanine tRNA while retaining the connecting sequence responsible for the activating ribozyme functionality. We generated three alanine tRNA regulating systems, before eventually identifying and generating the system with the desired functionality (theoON-tRNAAlaCUA), see figure 21. The constructs contained different amber suppressor tRNA sequences, all of them however reportedly having alanine identity.[146,148] The first two tRNAs we utilized had initially derived from glycine and alanine identity tRNAs (figure 22 A and B) but they did not trigger gene expression when incorporated in our construct. Nevertheless, the third tRNA which initially had lysine identity (figure 22 C and figure 21) did succeed into restoring gene expression and additionally when combined with our system allowed us to generate construct theoON-tRNAAlaCUA which is active in the presence of theophylline.
33
Figure 21: Nucleotide sequence of the aptazyme–tRNA fusion constructs developed for controlling tRNAAlaCUA on a post-transcriptional level. Leucine amber-suppressor tRNA under control of a theophylline-responsive ribozyme (theoON-tRNAAlaCUA). Optimized communication module sequences connecting aptamer and ribozyme parts are boxed and shown in grey colour.
Results and Discussion
34
Figure 22: Cloverleaf arrangement of nucleotide sequences of alanine amber suppressor tRNAs. It is depicted the alanine fidelity and suppression efficiency (%) along with the source tRNA identity, being for tRNA A) glycine tRNA, B) alanine tRNA and C) lysine tRNA. (Adapted from references[146,148]
The performance of the activating switch (theoON-tRNAAlaCUA) was evaluated with fluorescence measurements and it was determined to be an up-regulation from 15 to 55% (3.6-fold) compared to the wild type eGFP expression (figure 23).
35 Figure 23: In vivo eGFP expression of individual system utilizing theophylline responsive ribozyme controlling an alanine amber-suppressor tRNA: eGFP expression using the individual constructs generated during optimization process in order to obtain theoON-tRNAAlaCUA.
3.1.3. Dual tRNA-switching systems
3.1.3.1. Construction and characterization of dual tRNA switch systems After having obtained the different individual tRNA switches, we generated dual systems composed of two combined individual tRNA switches: theoON-tRNAAlaCUA
combined with tppON-tRNASerCUA, theoON-tRNALeuCUA-tppON-tRNASerCUA and theoON-tRNASerCUA-theoOFF-tRNALeuCUA by digesting and ligating the corresponding individual plasmids as described in experimental section
In order to show that the developed tRNA switches are suited for controlling the identity of individual amino acids post-transcriptionally, we expressed the dual amber suppressor tRNA systems using eGFP(S50X) as a reporter gene.
Results and Discussion
36
3.1.3.2. Characterization of dual theoON-tRNAAlaCUA-tppON-tRNASerCUA
switch system
The plasmid with the construct theoON-tRNAAlaCUA-tppON-tRNASerCUA was transformed by electroporation in E. coli BL21 (DE3) gold and bacterial cultures were grown in presence of 2 mM theophylline or 0.1 mM thiamine and additionally grown in cultures without any ligand, or presence of both ligands. Protein was expressed overnight at 37 °C and in order to characterize the performance of the system, fluorescence was measured. From the fluorescence evaluation (see figure 24 ) we observed that the dual construct (theoON-tRNAAlaCUA-tppON-tRNASerCUA) retained similar functionality as the individual systems of which it is composed of(theoON- tRNAAlaCUA and tppON-tRNASerCUA), exhibiting an activating ribozyme functionality with a 2.4-fold up-regulation in gene expression upon theophylline addition in the culture medium and an activating ribozyme functionality with a 2.6-fold up-regulation in gene expression upon thiamine addition in the culture medium.
In order to further characterize the dual system theoON-tRNAAlaCUA-tppON- tRNASerCUA eGFP protein was purified via a His-tag from E. coli cultures grown in culture media containing the corresponding ligands. Protein masses were determined by ESI-MS (see experimental section).
The masses detected correspond to the expected masses of the serine and alanine variants of the protein: In case of 2 mM theophylline added, masses with difference of 14.9 Da were obtained, reflecting the difference between serine (TPP-induced) and alanine (theophylline-induced).
Although the whole protein mass spectrometry data nicely demonstrates the feasibility of the approach, a quantitative analysis of the relative alanine / serine content in the expressed protein is not possible via this approach since the MS methodology is not quantitative with respect to the abundance of the proteins. For this purpose we carried out a tryptic digest of the two GFP samples and analyzed the resulting peptide fragments by LC-MS. Overall, the same peptides were found in both digested protein samples with the same abundance. However, the relative amounts of two peptides were changed, reflecting the digestion fragment containing the serine and alanine residues incorporated by decoding the amber stop codon, see figure 24 B for a magnified detail of the boxed region of the elution profile. The two peptides were detected by mass spectrometry as FAVSGEGEGDATYGK (measured: 744.7
37 Da (M+2H), calc.: 1487.5 Da) and FSVSGEGEGDATYGK (measured 752.7 Da (M+2H), calc.: 1503.7 Da). Integration of the respective peaks in the chromatography elution profiles yielded quantitative data with respect to the performance of the switching process: The switching of amino acid identity was achieved to a ratio of 14/86 (Ser/Ala) in presence of 2 mM theophylline and 84/16 (Ser/Ala) in presence of 0.1 mM thiamine added to the growth medium. Hence the ligand-dependent switching of tRNA systems results in some leakiness which is likely resulting from the imperfect switching performance of the individual switches and could possibly be optimized.
Results and Discussion
38
Figure 24: Analysis of eGFP expression and tryptic digest analysis. A) Fluorescence analysis of eGFP expression in E. coli using the following constructs: An alanine amber-suppressor tRNA under control of a theophylline-responsive ribozyme and simultaneously a serine amber-suppressor tRNA under control of a thiamine-responsive ribozyme (theoON-tRNAAlaCUA-tppON-tRNASerCUA); a control clone with wt eGFP gene (eGFP wt); an individual alanine amber-suppressor tRNA under control of a theophylline-responsive ribozyme (theoON-tRNAAlaCUA); and an individual serine amber-suppressor tRNA under control of a thiamine-responsive ribozyme (tppON-tRNASerCUA). In all constructs (excluding eGFP wt), the plasmid backbone contained an eGFP mRNA with an amber stop codon at position 50. B) Liquid chromatography profile of the tryptically digested, His-tag purified protein expressed in total absence, presence of one, the other or both ligands simultaneously in the growth medium regulating theoON-tRNAAlaCUA-tppON-tRNASerCUA riboswitch. Time interval relates to the elution time of the tryptic peptides of interest (FAVSGEGEGDATYGK and FSVSGEGEGDATYGK).
