Agrobacterium spp. DETECTION AND IDENTIFICATION METHODS AND NEW TESTS AS DEVELOPED AND USED IN THE FRAMEWORK OF COST873 FOR BACTERIA PATHOGENIC TO STONE FRUITS AND NUTSTumorigenic

(1)

DETECTION AND IDENTIFICATION METHODS AND NEW TESTS AS DEVELOPED AND USED IN THE FRAMEWORK OF COST873 FOR BACTERIA

PATHOGENIC TO STONE FRUITS AND NUTS Tumorigenic Agrobacterium spp.

T. Campillo^1,2, C. Lavire¹, M. Shams¹, J.F. Pothier³and J. Pulawska⁴

1 Université de Lyon, Université Lyon 1, CNRS, INRA, Laboratoire Ecologie Microbienne Lyon, UMR 5557, USC 1193, F-69622 Villeurbanne, France

2 Université de Lyon, Université Lyon 1, CNRS; INSA de Lyon, Bayer Crop Science, UMR 5240, Laboratoire Microbiologie, Adaptation et Pathogénie, F-69622 Villeurbanne, France

3 Agroscope Changins-Wädenswil ACW, Plant Protection Division, Schloss 1, 8820 Wädenswil, Switzerland

4 Research Institute of Horticulture, Pomology Division, ul. Pomologiczna 18, 96-100 Skierniewice, Poland

SUMMARY

Crown gall, caused by bacteria belonging to different species of the genusAgrobacterium, is one of the most serious diseases affecting nursery production of fruit trees and nuts. From a practical point of view, determination if the soil of fields designated for nursery planta- tions is free from tumour-inducing agrobacteria is very important. During the infection process, after transfer of bacterial DNA to the plant cell, the presence of bacteria is no longer required for gall development. There- fore, infections caused by Agrobacterium remain diffi- cult to detect although many methods are available for diagnosis of crown gall and identification of agrobacteria. In the present minireview, methods for isolation, identification and detection of tumorigenic agrobacteria developed within COST873 are described and ready-to- use protocols based on both classical or molecular methods are provided.

Key words:crown gall, diversity, MALDI-TOF, PCR, plasmid Ti, selective media.

INTRODUCTION

Tumorigenic Agrobacterium spp., the agents of crown gall on a large number of host plants, are classified as quality pathogens according to European Commission legislation (Anonymous, 1993). These plant pathogenic bacteria occur worldwide and induce tumorous out- growths on their hosts. The infection process of plants by Agrobacterium consists mainly in the transfer of a fragment (called T-DNA) of tumor-inducing (Ti) plasmid into the plant cell and its incorporation into the plant genome. Expression of T-DNA genes, which also

code for plant hormone (auxin and cytokinin) synthesis, causes uncontrolled plant cell division and growth, resulting in tumor formation. Once the plant cell has been transformed, the presence of the bacterium is not essen- tial anymore for the autonomous tumor growth. Tumors may inhibit plant physiological functions such as trans- port of water and nutrients. When many and large tumors are formed, which may partly girdle the bigger roots or crown, plants show reduced growth and may become severely stunted. The disease is most dangerous for young plants and it is the reason for the highest losses in nursery production. Agrobacterium spp. are Gram- negative rod-shaped bacteria belonging to the α-Pro- teobacteria. The latest taxonomic proposal, although far from unanimous acceptation, rejected the genus Agrobacterium and incorporated its members into the genus Rhizobium (Young et al., 2001). At present, tu- morigenic bacteria belong to the species complex A.

tumefaciens (=A. radiobacter = biovar 1) which consist of 10 genomovars (G1 to G7, G9, G13 and G14) and the six species A. vitis (= biovar 3), A. rubi, A. larry- moorei, A. rhizogenes (= biovar 2), the recently described A. fabrum (Lassalle et al., 2011) and Rhizobium skierniewicense (Pulawska et al., 2012).

Diagnosis of crown gall and identification of agrobacteria is not easy although many methods are available (Moore et al., 2001). Therefore, a workshop was organ- ized at the University of Lyon by Drs. C. Lavire, X.

Nesme and J.F. Pothier (CH), J. Pulawska (PL) and M.M. López (ES) in the frame of COST873 in Septem- ber 2011 (http://www.cost873.ch/5_activites/meeting_

detail.php?ID=37). Most of the methods presented here have been found useful over the years and were practised during the workshop.

HOST RANGE

Tumorigenic Agrobacterium spp. are polyphagous bacteria causing crown gall mainly on dicotyledonous plants. Some 643 plant species belonging to 331 genera

Corresponding author: J. Pulawska Fax: +48.46.8345375

E-mail: joanna.pulawska@inhort.pl

(2)

and 93 families have been reported as hosts (De Cleene and De Ley, 1976). Most extensive losses have been reported from pome- and stonefruit trees, walnut, al- mond, Rubus spp., Rosa sp. and grapevine. Susceptibili- ty of different cultivars of host plants species can be different. Among monocots, only some members of Lil- iales and Arales are susceptible to this disease. General- ly, agrobacteria of the A. tumefaciens species complex (biovar 1) and A. rhizogenes (biovar 2) have a wider host range than A. vitis, A. rubi andA. larrymoorei. The host range, however, is often strain-dependent. Some strains have a very narrow host range, just one plant species, or have an abnormally wide host range [so called “supervirulent” strains (reviewed by Pulawska, 2010)].

DETECTION AND IDENTIFICATION

Isolation methods and culture media. Agrobacteria can be isolated directly from their ecological niches in plants or soil using selective media combined with several purification steps (Fig. 1). Samples of bulk soil, roots, shoots or tumorigenic tissues are crushed and macerated in 1 ml of sterile distilled water for at least 30 min. The suspension can be directly streaked or dilution can be plated onto appropriate selective agar media (based on the ability to use specific compounds as carbon and nitrogen sources and to resist toxic compounds). Inoculated agar media are incubated 2-3 days at 28°C. After isolation, typical agrobacterium colonies (e.g. black colonies due to incorporation of tellurite in the colony) must be purified at least twice. To this aim, a single typical colony is suspended in sterile distilled water (at least 100 µl) and kept at 28°C overnight with shaking. The suspension is then spread on appropriate agar media without tellurite. Then one typical colony from the general agar plate is purified again (water plus streaking on selective media). These two purification steps are determinant to ascertain a pure culture of an agrobacterial strain.

Several selective media are useful to isolate and to identify agrobacteria. Most used are the well-known three biovars-specific media: medium 1A for biovar 1, medium 2E for biovar 2 and medium 3DG for biovar 3 (A. vitis) proposed by Brisbane and Kerr (1983). These media contain toxic selenite (Na₂SeO₃). However Mougel et al. (2001) have shown that in a sample containing a low density of agrobacteria: (i) the concentration of selenite is not sufficient to control competing bacteria and (ii) increased selenite concentration may be toxic to agrobacteria. They also showed that agrobacteria are able to reduce tellurite (K₂TeO₃) and concentra- tions of 200 mg/l of this toxic metal allow selective growth of almost all agrobacteria (A. tumefaciens species complex, biovar 2, A. rubi, A. vitisand A. larry-

moorei), while inhibiting most of the saprophytes. Thus it is recommended to supplement selective agrobacteria media with tellurite.

Generally, in agarized media such as nutrient agar (Difco, USA) or yeast-peptone-glucose agar (yeast extract 5 g, peptone 5 g, glucose 10 g, 1000 ml distilled water, pH 7.2), colonies of agrobacteria are cream-white, smooth, convex, glistening, circular with entire edges and mucoid (Fig. 2A). On media amended with tellurite, colonies are black (Fig. 2B, C). Commonly used media which are described below are all supplemented with tellurite (concentration depends on the media used) but only for the first isolation step. Composition of media al- ways per 1 liter deionized or distilled water, pH adjusted to 7-7.2 and autoclaved at 121ºC for 15 min.

All agrobacteria can be isolated on MG medium (Ophel and Kerr, 1990). Per 1 liter deionized or distilled water: D-mannitol 5 g, L-glutamic acid 2 g, KH₂PO₄0.5 g, NaCl 0.2 g, MgSO₄x7H₂O 0.2 g, yeast extract 0.5 g, potassium tellurite 0.2 g, agar 15 g.

Agrobacterium tumefaciens species complex (biovar 1), A. fabrum(biovar 1), A. rubiand A. larrymooreican be isolated on Schroth medium (Schroth et al., 1965) or medium 1A (Brisbane and Kerr, 1983). Selectivity of medium 1A is based on the ability of above mentioned agrobacteria to specifically use arabitol as sole carbon source: L-arabitol 3.04 g, NH₄NO₃ 0.16 g, KH₂PO₄ 0.54 g, K₂HPO₄1.04 g, MgSO₄x7H₂O 0.25 g, sodium taurocholate 0.29 g, 2 ml of crystal violet 0.1% (w/v) aqueous, agar 15 g. After sterilization add 1 ml of cycloheximide 2% and potassium tellurite 0.08 g.

A. rhizogenes(biovar 2) can be isolated on New and Kerr medium (New and Kerr, 1971) or medium 2E (Brisbane and Kerr, 1983). Both media, based on the specific ability of biovar 2 strains to use erythritol as sole carbon source, are highly selective for biovar 2. Colonies develop slowly on New and Kerr medium whereas 2E medium allows faster growth: erythritol 3.05 g, NH₄NO₃ 0.16 g, KH₂PO₄0.54 g, K₂HPO₄1.04 g, MgSO₄x7H₂O 0.25 g, sodium taurocholate 0.29 g, 1 ml of yeast extract 1% (w/v) aqueous, 5 ml of malachite green 0.1% (w/v), agar 15 g. Add after sterilization: 1 ml of cycloheximide 2% (w/v) and potassium tellurite 0.32 g.

A. vitis (biovar 3) and A. larrymoorei can be isolated on medium 3DG (Brisbane and Kerr, 1983) or Roy and Sasser medium (Roy and Sasser, 1983). Both media are based on specific sodium L-tartrate utilization by biovar 3 strains as sole carbon source (Brisbane and Kerr, 1983;

Ophel and Kerr, 1990). Roy and Sasser medium is most commonly used: adonitol 4 g, H₃BO₃1 g, yeast extract 0.14 g, MgSO₄x7H₂O 0.2 g, KH₂PO₄ 0.7 g, K₂HPO₄ 0.9 g, NaCl 0.2 g, agar 20 g. Triphenyltetrazolium chlo- ride 0.8 g and 1 ml of cycloheximide 2% (w/v) are added after sterilization. Colonies have a typical pinkish- white (with red centre) color on this medium.

Biochemical tests. Biochemical properties that allow

(3)

Fig. 1.Flow diagram for obtaining a pure culture of agrobacteria. At least two purification steps are necessary before performing identification with other tests.

(4)

presumptive identification of agrobacteria are: (i) reduc- tion of tellurite, (ii) utilization of mannitol as sole carbon source and (iii) presence of urease and esculinase hydrolysis enzymes. To test the presence of urease and esculinase, fresh cells are suspended in urease solution (L-tryptophane 3 g, urea 20 g, KH₂PO₄1 g, K₂HPO₄1 g, NaCl 5 g, ethanol 95% 10 ml, phenol red 25 mg, distilled water 1 liter, filter sterilized and/or esculine solution (peptone 10 g, esculine 1 g, ferric ammonium citrate 20 g, distilled water 1 liter, filter sterilized. After incubation (1 h at 28°C) observe a colorimetric change in the medium (pink for urease; black for esculinase).

Determination of specific carbon sources metabolism can be made either by growing the strain on minimal media supplemented with a carbon source (utilization) or by measuring alkali/acid production (Ayers et al., 1919; Keane et al., 1970; Kersters and De Ley, 1984; for a detailed protocol see Cubero and López, 2004).

The A. tumefaciensspecies complex (biovar 1) specifically uses arabitol as sole carbon source (tested on medium 1A or by determining acid production). They also share the ability to aerobically convert lactose to 3- ketolactose enzymatically. Bacteria are streaked on a medium containing lactose (Bernaerts and De Ley, 1963) and, after 2 days, Benedict’s reagent is added. The test is positive if a yellow colour appears (for a detailed protocol see Cubero and López, 2004).

A. fabrumis a member of the A. tumefaciensspecies complex and shares all the properties described above plus the specific ability to inhibit caffeic acid browning.

In AT minimal medium (Petit et al., 1978) supplemented with caffeic acid 0.1 mg ml^-1A. fabrummembers de-

grade caffeic acid. A non inoculated medium or a medium incubated with other agrobacterium strains do not degrade enzymatically caffeic acid, which allows its nat- ural oxidation resulting in a typical brown color. This is observed about 5 days after inoculation (T. Campillo, unpublished information).

A. rhizogenes(biovar 2) uses specifically erythritol as sole carbon source (tested on medium 2E or by determining acid production). It produces also more acid from glucose and faster than strains of other biovars (Bouzar and Jones, 1992). Acid production from glucose is tested by streaking a bacterial culture onto pota- to dextrose agar (PDA) supplemented with CaCO₃ 0.08% (w/v) (for protocol see Bouzar et al., 1995).

A. vitis(biovar 3) and A. larrymooreispecifically use L-tartrate as sole carbon source (tested on Roy and Sasser medium or by determining alkali production). A.

vitis strains are pectolytic (presence of polygalacturonase) while A. larrymooreiis unable to metabolize cis- aconitic acid (Bouzar et al., 2001). Pectolytic activity is tested by spotting bacteria onto PGA medium supplemented by polygalacturonic acid (Mcguire et al., 1991;

for protocol see Bouzar et al., 1995)^.

A. rubi. There is no specific biochemical tests for A.

rubi identification. It is ketolactose negative and produces acid from D(+)melezitose.

R. skierniewicense is 3-ketolactose negative but grows and produces a reddish brown pellicle at the surface of media containing ferric amonium citrate. It can be dif- ferentiated from closely related species by its inability to utilize L-fucose and by its ability to utilize β-hydroxybu- tyric acid (Pulawska et al., 2012).

Fig. 2. Plating of a 10^-1 dilution soil suspension on (A) 1A medium or (B) 1A medium amended with 60 ppm of K₂TeO₃. C. Enlarged (magnification, 30X) typical black colonies of A. tumefaciens on the amended medium. Arrows point to agrobacterial colonies (Mougel et al., 2001).

Fig. 3. Electrophoresis gel showing PCR products obtained in a multiplex PCR with DNA of the following Agrobacterium strains: lane 1, B6 (bv. 1); lane 2, LMG 150 (bv. 2); lane 3, LMG 8750 (A. vitis); lane 4, LMG 156 (A. rubi); lane 5, LMG 21410 (A. larrymoorei); lane 6, mixture of DNA of strains B6, LMG 150, LMG 8750, LMG 156 and LMG 21410; lane M, molecular weight marker 100 bp ladder (Fer- mentas, Lithuania) (Pulawska et al., 2006).

(5)

Storage of isolates/strains. Bacterial isolates can be stored as a mixture of glycerol-liquid culture (ca. 10¹⁰ CFU.ml^-1) (1:4 volume rate) at -78 to -82°C. If possible, a backup stock should be stored in a separate freezer.

Periodic check on viability, contamination and pathogenicity is advisable.

Reference strains – type strains of the species. A.

tumefaciens: ATCC 23308^T; CFBP 2413^T; HAMBI 1811^T; ICMP 5856^T; LMG 187^T; NCPPB 2437^T.

A. radiobacter: ATCC 19358^T; CIP 104325^T; DSM 30147^T; HAMBI 1814^T; IAM 12048^T; ICMP 5785^T; IFO (now NBRC) 13532^T; JCM 20371^T; LMG 140^T; NCCB 27005^T; NCIB (now NCIMB) 9042^T; NCPPB 3001^T.

A. larrymoorei: ATCC 51759^T; CFBP 5473^T; ICMP 14256^T; NCPPB 4096^T; LMG 21410^T.

A. rubi: ATCC 13335^T; CFBP 5509^T; CFBP 6448^T; CIP 104332^T; DSM 6772^T; HAMBI 1812^T; IFO (now NBRC) 13261^T; ICMP 6428^T; JCM 20918^T; LMG 156^T; LMG 17935^T; NCPPB 1854^T.

A. vitis: K309^T; ATCC 49767^T; CIP 105853^T; HAM- BI 1817^T; ICMP 10752^T; IFO (now NBRC) 15140^T; JCM 21033^T; LMG 8750^T; NCPPB 3554^T.

A. fabrum: C58^T; CFBP 1903^T; LMG 287^T; ATCC 33970^T; CIP 104333^T.

A. rhizogenes: ATCC 11325^T; CIP 104328^T; DSM 30148^T; IFO (now NBRC) 13257^T; CFBP 5520^T; HAM- BI 1816^T; ICMP 5794^T; JCM 20919^T; LMG 150^T; NCPPB 2991^T.

R. skierniewicense: Ch11^T; LMG 26191^T; CFBP 7420^T

Serological techniques To date there are no suitable and specific antisera for reliable detection/identification of tumorigenic agrobacteria available.

MALDI-TOF. In the framework of COST873, whole-cell MALDI-TOF mass spectrometry was applied to Agrobacterium and related species in order to create a comprehensive spectral reference database [MABRITEC AG, Riehen, Switzerland (Pothier et al., 2011)] that can be used for rapid identification of strains. Based on cross-referencing fingerprints with dis- criminatory peptide masses, rapid and reliable identifi-

cation at the species but also at the genomovar level is possible (Pothier et al., 2011). This technique was suc- cessfully applied to putative colonies of tumorigenic Agrobacteriumspp. grown for 48 h on YPG agar medium (yeast extract 0.3% w/v, peptone 0.5% w/v, dextrose 0.5% w/v and agar 1.5% w/v).

DNA isolation from pure culture and complex envi- ronments. Identification of tumorigenic agrobacteria in pure culture can be done by PCR of a rapid colony lysate. This method can be utilized for handling large numbers of isolates, e.g. in a biodiversity study or a large isolate-screening program according to the following protocol: introduce aseptically 15 µl of 20 mM NaOH in 0.5 ml Eppendorf tubes. Touch gently each colony to be tested with a sampler tip in order to obtain a reasonable number of bacterial cells to be suspended in the NaOH solution (preferably at density OD_600nm= 0.07). Mix the cells vigorously by vortexing, prepare a homogenized suspension and incubate at 37°C for 10 min. The Agrobacterium colony lysates are now ready for PCR reaction. For a 30 µl PCR reaction, 2 µl of colony lysate can be used. Colony lysates can be stored at -20°C as DNA stock. Simple heating of a light milky bacterial suspension in distilled water at 95°C for 15 min, then cooling in ice, will avoid preparing fresh NaOH or storing frozen NaOH.

Metagenomic DNA can be extracted from different complex samples such as bulk soil, rhizospheric soil and plant tumors using the PowerSoil DNA isolation kit (MO BIO Laboratories, USA).

Detection and identification of agrobacteria can also be performed using BIO-PCR as described by Pulawska and Sobiczewski (2005). This method includes preincubation of soil suspensions on a selective medium [named 1A+2E, modified from Brisbane and Kerr (1983) media] with the following composition per liter of deionized or distilled water: 20 mM arabitol, 25 mM erythritol, 2 mM NH₄NO₃, 4 mM KH₂PO₄, 6 mM K₂HPO₄, 1 mM MgSO₄x 7H₂O, 0.5 mM sodium taurocholate, 1% yeast extract, 0.5 mM Na₂SeO, 0.004% cycloheximide and 1.5% agar. After 3 days of incubation at 26°C, bacteria should be washed out with 4 ml of 0.01M PBS buffer and DNA isolated with a Genomic Table 1.Agrobacteriumspecies/biovar specific primers based on 23S rDNA sequences (Pulawska et al.,

2006).

Name of primer Target position* Sequence (5’ – 3’) Specific for:

UF f B1R r B2R r AvR r ArR r

171 – 193 338 – 360 1207 – 1230 640 – 662 1150-1173

GTAAGAAGCGAACGCAGGGAACT GACAATGACTGTTCTACGCGTAA TCCGATACCTCCAGGGCCCCTCACA AACTAACTCAATCGCGCTATTAAC AAAACAGCCACTACGACTGTCTT

universal biovar 1 biovar 2 A. vitis A. rubi

* E. coli position numbering f –forward; r – reverse

(6)

Mini kit (A&A Biotechnology, Poland) as described by Pulawska and Sobiczewski (2005).

Detection of tumorigenic Agrobacterium spp. by PCR. Universal primers for detecting Ti and Ri plasmids were proposed by Kawaguchi et al.(2005). These primers, VCF3 (5’-GGCGGGCGYGCYGAAA- GRAARACYT-3’) and VCR3 (5’-CGAGATTGCGT- GCTTGTAGA-3’), were designed on virC1-C2 genes and their annealing temperature is 55°C. Nesme et al.

(1989) designed another couple of primers for detecting octopine and nopaline plasmids F14-vir (5’-GAACGT- GTTTCAACGGTTCA-3’) and F749-vir (5’-GC- TAGCTTGGAAGATCGCAC-3’), working at an annealing temperature of 57°C.

For detection of tumorigenic agrobacteria, primers complementary to the tms2 gene located in T-DNA part of pTi plasmid are very useful (Pulawska and So- biczewski, 2005). Primers tms2F1 (5’-TTTCAGCTGC- TAGGGCCACATCAG-3’) and tms2R2 (5’-TCGCCA TGGAAACGCCGGAGTAGG-3’) can be used in stan- dard PCR or in semi-nested PCR combined with primer tms2B (5’-GGAGCACTGCCGGGTGCCTCGGGA- 3’) of Sachadyn and Kur (1997). Two round semi-nested PCR (first round with primers tms2F1 and tms2R2, and second round with primers tms2F1 and tms2B using 1 µl of first round product as DNA template) preceded by preincubation of soil suspensions on selective medium 1A+2E and DNA isolation on Genomic Mini kit (A&A Biotechnology, Poland) allows detection of 1-2 bacterial cells in 1 g of soil. Amplification conditions are:

PCR buffer (10 mmol l^-1Tris-HCl, pH 9.0, 50 mmol l^-1 KCl, 0.1% Triton X-100) with 1.5 mmol l^-1MgCl_2,200 µmol l^-1of each dNTP, 1 µmol l^-1of each primer and 1 U of thermostable DNA polymerase (Promega, USA).

Amplification is done with initial denaturation at 94°C for 1 min, followed by 35 cycles of denaturation at 94°C for 1 min, annealing at 63°C for 1 min, extension at 72°C for 1.5 min and a final extension step for 10 min.

Identification of Agrobacterium spp. by PCR. Par- tial recA gene sequencing can discriminate all species and genomovars of agrobacteria (Costechareyre et al., 2010). This indicates that recAhas a relatively high dis- crimination ability in comparison to amplified fragment length polymorphism (AFLP) (Portier et al., 2006) and 16S rRNA sequencing (Mougel et al., 2002). This dis- covery encouraged to focus on recA gene for designing species-specific and generalist primers for the A. tume- faciens complex and Rhizobiumstrains. For all A. tume- faciens genomovars, specific primers were designed on recA sequence and two sets of generalist primers to dis- criminate Rhizobiaceace and Agrobacteriumstrains were also defined (M. Shams and coworkers, unpublished information).

During the COST873 training workshop, the useful- ness of a multiplex PCR for identification of four taxa (species/biovar) within the genus Agrobacterium was

shown. This multiplex PCR consists of primers designed on the 23S rRNA gene sequence, i.e. one universal forward primer and four taxon-specific (A. rubi, A. vitis and Agrobacterium biovars 1 and 2) reverse primers (Table 1). The primers developed for the identification of A. vitis, A. rubior Agrobacteriumbiovar 1 yield ampli- cons of 478 bp, 1,006 bp and 184 bp, respectively. For identification of Agrobacteriumbiovar 2, a characteristic 1,066 bp PCR product should be obtained (Fig. 3). This product was also obtained when testing some rhizobial strains. Differentiation between Agrobacterium biovar 2 and false-positive strains was only possible after restric- tion analysis of the amplicon with endonuclease Alw26I (Pulawska et al., 2006). DNA amplification can be performed in total volume of 15 µl PCR buffer (10 mM Tris-HCl, pH 9.0; 50 mM KCl; 0.1% Triton X-100) with 1.5 mM MgCl₂, 200 µM of each dNTP, 1 µM of each primer and 0.5-1 U of thermostable DNA polymerase (Fermentas, Lithuania). Sample composition of the PCR mixture in a total volume of 15 µl: 1.5 µl of DNA (10-50 ng/µl), 1 µl of each primer (10 µM), 1 µl of dNTPs (0.2 mM), 1.5 µl DreamTaq Green buffer, 0.1 µl of Dream- Taq Green polymerase and 5.9 µl of H₂O. Amplification conditions are: initial denaturation at 94°C for 1 min, followed by 35 cycles of denaturation at 94°C for 1 min, annealing at 67°C for 1 min, extension at 72°C for 1.5 min and a final extension step for 10 min.

Pathogenicity tests. Virulence assays (adapted from Watson et al., 1975) can be conducted on stems of 3- week-old tomato plants or 7-day-old sunflower seedlings. Suspension of agrobacteria (OD_600nm 0.1 in H₂O) are prepared from overnight cultures in rich growth media (LB or YPG broth). Each tomato or sunflower stem is incised (length = 4 cm on tomato and 1 cm on sunflower; depth = 1 mm) with a scalpel or a sterile needle and 20 µl (ca. 1×10⁶CFU) are deposited into the scarification. On sunflower, incisions are made on the basal part of the stem so as to cover the inoculated wound with soil. Infected plants are incubated in a climatized greenhouse at 20°C with a night/day pho- toperiod of 16h/8h and 75% relative humidity. Number and size of tumors per incision are counted up to 28 days postinoculation. Other host plants, i.e. kalanchoe, tobacco and marigold can be used alternatively.

ACKNOWLEDGEMENTS

The authors thank the European Science Foundation research network COST Action 873 for its support of networking initiatives, leading to a productive coopera- tion among international research groups involved in developing methods and strategies for pest management of bacterial diseases of stone fruits and nuts and of agrobacteria in particular. The authors also thank V.

Pflüger for his valuable assistance when developing

(7)

methods during COST Action 873, X. Nesme for ex- pert advices, and F. Walsh for critically reading the manuscript. Part of the work presented here was sup- ported by the Swiss Secretariat for Education and Re- search (SBF C07.0139); by the Swiss Commission for Technology and Innovation (CTI 11225.1;6 PFLS-LS), by the Polish Ministry of Science and Higher Education (118/N-COST/2008/0) and by the French Agence Na- tionale de la Recherche - EcoGenome project (ANR-08- BLAN-0090).

REFERENCES

Anonymous, 1993. Commission Directive 93/48/EEC of 23 June 1993 setting out the schedule indicating the conditions to be met by fruit plant propagating material and fruit plants intended for fruit production, pursuant to Council Directive 92/34/EEC. Official Journal of European Community36: L 250/4-8.

Ayers S.H., Rupp P., Johnson W.T., 1919. A study of the alkali-forming bacteria in milk. United States Department of Agriculture Bulletin782.

Bernaerts M.J., De Ley J., 1963. A biochemical test for crown gall bacteria. Nature197: 406-407.

Bouzar H., Jones J.B., 2001. Agrobacterium larrymoorei sp.

nov., a pathogen isolated from aerial tumours of Ficus ben- jamina. International Journal of Systematic Evolutionary Microbiology51: 1023-1026.

Bouzar H., Jones J.B., 1992. Distinction of biovar 2 strains of Agrobacteriumfrom other chromosomal groups by differ- ential acid production. Letters in Applied Microbiology15:

83-85.

Bouzar H., Jones J.B., Bishop A.L., 1995. Simple cultural tests for identification of Agrobacterium biovars. In: Gartland K.M.A., Davey M.R. (eds). Agrobacterium Protocols, pp.

9-14. Humana Press, Totowa, NJ, USA.

Brisbane P.G., Kerr A., 1983. Selective media for three biovars of Agrobacterium. Journal of Applied Microbiology54:

425-431.

Costechareyre D., Rhouma A., Lavire C., Portier P., Chapul- liot D., Bertolla F., Boubaker A., Dessaux Y., Nesme X., 2010. Rapid and efficient identification of Agrobacterium species by recA allele analysis. Microbial Ecology60: 862- 872.

Cubero J., López M.M., 2004. Agrobacterium persistence in plant tissues after transformation, In: Peña L. (ed.). Trans- genic Plants, pp. 351-364. Humana Press, Totowa, NJ, USA.

De Cleene M., De Ley J., 1976. The host range of crown gall.

The Botanical Review42: 390-466.

Kawaguchi A., Inoue K., Nasu H., 2005. Inhibition of crown gall formation by Agrobacterium radiobacter biovar 3 strains isolated from grapevine. Journal of General Plant Pathology71: 422-430.

Keane P.J., Kerr A., New P.B., 1970. Crown gall of stone fruit II. Identification and nomenclature of Agrobacteriumiso- lates. Australian Journal of Biological Sciences23: 585-596.

Kersters K., De Ley J., 1984. Genus III. AgrobacteriumConn 1942, In: Krieg N.R., Holt J.G. (eds). Bergey’s Manual of

Systematic Bacteriology pp. 244-254. Williams and Wilkins, Baltimore, MD, USA.

Lassalle F., Campillo T., Vial L., Baude J., Costechareyre D., Chapulliot D., Shams M., Abrouk D., Lavire C., Oger-Des- feux C., Hommais F., Guéguen L., Daubin V., Muller D., Nesme X., 2011. Genomic species are ecological species as revealed by comparative genomics in Agrobacterium tume- faciens. Genome Biology and Evolution3: 762-781.

McGuire R.G., Rodriguez-Palenzuela P., Collmer A., Burr T.J., 1991. Polygalacturonase production by Agrobacterium tumefaciensbiovar 3. Applied Environmental Microbiology 57: 660-664.

Moore L.W., Bouzar H., Burr T., 2001. Agrobacterium. In:

Schaad N.W., Jones J.B, Chun W. (eds). Laboratory Guide for Identification of Plant Pathogenic Bacteria, 3rd Ed., pp. 17-35. APS Press, St. Paul, MN, USA.

Mougel C., Cournoyer B., Nesme X., 2001. Novel tellurite- amended media and specific chromosomal and Ti plasmid probes for direct analysis of soil populations of Agrobac- teriumbiovars 1 and 2. Applied and Environmental Micro- biology67: 65-74.

Mougel C., Thioulouse J., Perrière G., Nesme X., 2002. A mathematical method for determining genome divergence and species delineation using AFLP. International Journal of Systematic and Evolutionary Microbiology52: 573 -586.

Nesme X., Leclerc M. C., Bardin R., 1989. PCR detection of an original endosymbiont: the Ti plasmid of Agrobacterium tumefaciens. In: Nardon P., Gianinazzi-Peason V., Greines A. M., Margulis L., Smith D.C. (eds). Endocytobiology IV, pp. 47-50. INRA, Paris, France.

New P.B., Kerr A., 1971. A selective medium for Agrobacteri- um radiobacter biotype 2. Journal of Applied Bacteriology 34: 233-236.

Ophel K., Kerr A., 1990. Agrobacterium vitis sp. nov. for strains of Agrobacteriumbiovar 3 from grapevines. Interna- tional Journal of Systematic Bacteriology40: 236 -241.

Petit A., Tempe J., Kerr A., Holsters M., Van Montagu M., Schell J., 1978. Substrate induction of conjugative activity of Agrobacterium tumefaciens Ti plasmids. Nature 271:

570-572.

Portier P., Fischer-Le Saux M., Mougel C., Lerondelle C., Chapulliot D., Thioulouse J., Nesme X., 2006. Identifica- tion of genomic species from Agrobacterium biovar 1 by AFLP genomic markers. Applied Environmental Microbiol- ogy72: 7123-7131.

Pothier J.F., Pflüger V., Ziegler D., Tonolla M., Vogel G., Duffy B., 2011. MALDI-TOF mass spectrometry: Applica- tions for rapid bacterial identification and phylogenetic analysis. Phytopathology101: S145.

Pulawska J., Sobiczewski P., 2005. Development of a semi- nested PCR based method for sensitive detection of tumorigenic Agrobacteriumin soil. Journal of Applied Micro- biology98: 710-721.

Pulawska J., Willems A., Sobiczewski P., 2006 Rapid and specific identification of four Agrobacteriumspecies and biovars using multiplex PCR. Systematic Applied Microbiology 29: 470-479.

Pulawska J., 2010. Crown gall of stone fruits and nuts, eco- nomic significance and diversity of its causal agents: tumorigenic Agrobacterium spp. Journal of Plant Pathology 92: S87-S98.

(8)

Pu∏awska J., Willems A., Sobiczewski P., 2012. Rhizobium skierniewicense sp. nov. isolated from tumors on chrysan- themum and cherry plum. International Journal of System- atic and Evolutionary Microbiology62: 895-899.

Roy M.A., Sasser M., 1983. A medium selective for Agrobac- terium tumefaciensbiotype-3. Phytopathology73: 810.

Sachadyn P., Kur J., 1997. A new PCR system for Agrobacteri- um tumefaciens detection based on amplification of T- DNA fragment. Acta Microbiologica Polonica46: 145-156.

Schroth M.N., Thompson J.P., Hilderbrand D.C., 1965. Isola- tion of A. tumefaciens-A. radiobactergroup from the soil.

Phytopathology55: 645-647.

Watson B., Currier T.C., Gordon M.P., Chilton M.D., Nester E.W., 1975. Plasmid required for virulence of Agrobacteri- um tumefaciens. Journal of Bacteriology123: 255-264.

Young J.M., Kuykendall L.D., Martinez-Romero E., Kerr A., Sawada H., 2001. A revision of Rhizobium Frank 1889, with an emended description of the genus, and the inclusion of all species of Allorhizobium undicola de Lajudie et al. 1998 as new combinations: Rhizobium radiobacter, R. rhizogenes, R. rubi, R. undicola and R. vitis. International Journal of Sys- tematic and Evolutionary Microbiology51: 89-103.